ID: 903784237

View in Genome Browser
Species Human (GRCh38)
Location 1:25847144-25847166
Sequence TACATTTAGCAGCTGGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 195}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903784237_903784240 1 Left 903784237 1:25847144-25847166 CCAATTTCCAGCTGCTAAATGTA 0: 1
1: 0
2: 0
3: 18
4: 195
Right 903784240 1:25847168-25847190 TCATATGTGAAGATGCAAAAGGG 0: 1
1: 0
2: 3
3: 19
4: 297
903784237_903784241 24 Left 903784237 1:25847144-25847166 CCAATTTCCAGCTGCTAAATGTA 0: 1
1: 0
2: 0
3: 18
4: 195
Right 903784241 1:25847191-25847213 CTTTAAAAGACACTGAGAGCTGG 0: 1
1: 0
2: 5
3: 25
4: 275
903784237_903784239 0 Left 903784237 1:25847144-25847166 CCAATTTCCAGCTGCTAAATGTA 0: 1
1: 0
2: 0
3: 18
4: 195
Right 903784239 1:25847167-25847189 ATCATATGTGAAGATGCAAAAGG 0: 1
1: 0
2: 0
3: 20
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903784237 Original CRISPR TACATTTAGCAGCTGGAAAT TGG (reversed) Intronic
902210198 1:14899458-14899480 TAAATTTCGCATCTGGAAAAAGG - Intronic
903784237 1:25847144-25847166 TACATTTAGCAGCTGGAAATTGG - Intronic
904702580 1:32366643-32366665 TACATCTTCCAGCTGCAAATGGG + Exonic
909678915 1:78269240-78269262 AACATTTTGCAGCTGAAAATAGG - Intergenic
910260620 1:85290253-85290275 TAAATTTAGCATCTTGATATGGG - Intergenic
910641113 1:89463350-89463372 TACATTCAGCAGTTGGAAGAAGG - Intergenic
912973991 1:114311386-114311408 TACATTGAGGAACTGGGAATAGG - Intergenic
913121494 1:115745266-115745288 TACATTTGGCAGCTAGAGAAGGG - Intronic
917760829 1:178155166-178155188 TAGATATAGTAGCAGGAAATAGG + Intronic
918102099 1:181385401-181385423 TACAATTAGCAGCTGAACACAGG - Intergenic
919503404 1:198367214-198367236 AACATTTTGCAAATGGAAATTGG + Intergenic
920021028 1:202957071-202957093 TACATTTAGTAGCTGCAAGCCGG + Intronic
920921842 1:210303837-210303859 TAAATCTGGCAGCAGGAAATAGG - Intergenic
923067501 1:230532175-230532197 GACATTTAAAAGGTGGAAATGGG - Intergenic
923610841 1:235492013-235492035 GACATTTAGTAGAAGGAAATAGG - Intronic
924730078 1:246703260-246703282 TGTATTTATCAGCTGGAAGTTGG - Intergenic
1065271843 10:24041080-24041102 CACATTTATCAACTGTAAATGGG + Intronic
1066507097 10:36056772-36056794 TCCAGGAAGCAGCTGGAAATAGG + Intergenic
1071172060 10:82878109-82878131 TACAGTTAGTAGCTGGAGAAAGG + Intronic
1073325156 10:102639858-102639880 AACATTTATGAGATGGAAATTGG + Intergenic
1074095960 10:110312805-110312827 TACATTTACTACCTGCAAATAGG - Intergenic
1074805599 10:117048050-117048072 TGCATTTTGCAGCTGTAAAAAGG + Intronic
1075783273 10:125031106-125031128 CACATTTAAAAGCAGGAAATGGG - Intronic
1076108315 10:127842281-127842303 TACAATCAGCAGATGGAAACAGG - Intergenic
1076389183 10:130084732-130084754 TACACTTATCACCTAGAAATTGG + Intergenic
1080993284 11:37568482-37568504 TAAATTTAGCAATTGGAATTTGG + Intergenic
1083649920 11:64196730-64196752 CAAATTTAGCACCTTGAAATGGG + Intronic
1083978940 11:66148986-66149008 CACATTTAGCAGCTGTTAAGTGG - Intronic
1085235747 11:75013970-75013992 GACATTCAGCAGCTGGTAAGAGG + Intronic
1086054142 11:82627743-82627765 TCCAGTGAGCAGCTGGAAAGGGG - Intergenic
1086450663 11:86913155-86913177 TAACTATAGCAGCTGTAAATTGG - Intronic
1088749423 11:112831303-112831325 TGCATTTAGTAGCTGGGCATTGG - Intergenic
1089021188 11:115216666-115216688 GACCTTTAGGAGCTGGAAAGTGG - Intronic
1089936498 11:122369829-122369851 TTCATTTGGGTGCTGGAAATTGG + Intergenic
1091163711 11:133451308-133451330 TACACTTAGAAGAAGGAAATGGG + Intronic
1092027212 12:5251658-5251680 TACATTTAGTAGAGGGTAATGGG + Intergenic
1099561999 12:84190721-84190743 TACATGCAGAAGCTGGAAACCGG + Intergenic
1100159565 12:91842717-91842739 TACATTTAGCAGTGTGAAAATGG + Intergenic
1101335542 12:103793334-103793356 TTGTTTTAGCAGCTGGAAATTGG - Intronic
1102353894 12:112216192-112216214 TAAATTTAGCAATTGGAAATGGG - Intronic
1105569168 13:21583912-21583934 TACAGTGAGAAGCTGTAAATGGG - Intronic
1110607900 13:77454524-77454546 TTCAGTTACCAGCTGTAAATGGG + Intergenic
1111206809 13:85021044-85021066 TATTTTTGGCAGCTGGCAATAGG - Intergenic
1112521558 13:100100140-100100162 TACATTTTGTAGATGGAAACGGG + Intronic
1113237575 13:108297577-108297599 TACATTAAGCAGATGAACATAGG - Intronic
1113353864 13:109558723-109558745 TACATGTAGAAGCATGAAATTGG + Intergenic
1114961552 14:27896994-27897016 TACATGTAGAAGAAGGAAATTGG - Intergenic
1126556086 15:49989051-49989073 TCTATTTAGCAGTGGGAAATAGG - Intronic
1127333845 15:57964573-57964595 TAGATTTAGGAGTTGTAAATTGG - Intronic
1133331348 16:4976607-4976629 CACAATTAGCATCTGGAGATGGG - Intronic
1135843002 16:25893668-25893690 TACGTTTAGAGCCTGGAAATGGG + Intronic
1138553948 16:57761570-57761592 TGCAAACAGCAGCTGGAAATGGG - Intronic
1139833648 16:69821012-69821034 TGCATTTGGCGGCTGGAACTGGG - Intronic
1140618932 16:76703672-76703694 TAGATTCTGTAGCTGGAAATGGG + Intergenic
1146319908 17:31839027-31839049 CACATTCAGCAGCTGGTGATGGG + Intergenic
1148231524 17:45938275-45938297 AACCTTTAGAAGCTGGAAAAAGG - Intronic
1149796579 17:59526593-59526615 TAGTTTTAGCTCCTGGAAATGGG + Intergenic
1151522182 17:74638192-74638214 TACATTTTACACCTGGAAAGAGG - Intergenic
1155192696 18:23444773-23444795 AACATTCAGAAGCTAGAAATAGG + Intergenic
1155354731 18:24941271-24941293 GACATTTAACAGATGGAAACAGG + Intergenic
1156022772 18:32618762-32618784 TTCATTTAGCATCTCAAAATGGG - Intergenic
1156077127 18:33292980-33293002 CAAATTTAGCAGCTTGAAACAGG - Intronic
1156659081 18:39325425-39325447 TATTTTTAGCAGCTAAAAATTGG - Intergenic
1156911498 18:42416214-42416236 TCCACTTTGTAGCTGGAAATTGG - Intergenic
1156925696 18:42575221-42575243 TACATTTTGAAAATGGAAATAGG + Intergenic
1160288322 18:77567503-77567525 TACATTTAGCGACTGGTACTCGG + Intergenic
1160441553 18:78896581-78896603 AACATTTAACATCTTGAAATCGG - Intergenic
1162236727 19:9315474-9315496 TCCAGTGAGCAGCTGGAAAGGGG + Intergenic
1165220029 19:34308533-34308555 TTAATTAAGCAGCTGGAATTTGG + Intronic
925110090 2:1327530-1327552 TAAATTAAACAGCTGTAAATGGG - Intronic
927848088 2:26481762-26481784 TCCCTTTAGCACCTGGAAACCGG + Intronic
928088460 2:28359980-28360002 CACAGTTAGCAGGTGGGAATCGG - Intergenic
928251747 2:29686851-29686873 TACAACTAGCAGCTGGAGCTTGG - Intronic
928645857 2:33352014-33352036 TCCAATAGGCAGCTGGAAATAGG - Intronic
929975055 2:46625509-46625531 TACATACTGCAGTTGGAAATAGG - Exonic
930137201 2:47914489-47914511 CACATGTAGCAGTTGGAAAATGG + Intergenic
930171553 2:48256546-48256568 TATATTTTCCAGTTGGAAATAGG - Intergenic
931160553 2:59685722-59685744 TACATTTACAAGGTGGAAGTGGG + Intergenic
931787723 2:65635507-65635529 TCCATTTGGTAGCTTGAAATTGG + Intergenic
932067264 2:68578230-68578252 TACTTAAAGCATCTGGAAATAGG + Exonic
933081914 2:78000215-78000237 TCAATTTTGCAGCTGGTAATTGG - Intergenic
937144275 2:119629099-119629121 TACATTTAGCATCTCAAAATTGG + Intronic
938642709 2:133298270-133298292 TCCATTGAGAAGATGGAAATGGG - Intronic
940928833 2:159401935-159401957 TACAACTAGCATCTGGAGATGGG - Intronic
942395546 2:175544037-175544059 TACTTTAAGAAGCTGGAAAAAGG - Intergenic
942403913 2:175632714-175632736 TACATTTGTAAGTTGGAAATAGG + Intergenic
942536834 2:176973923-176973945 TAGATTTAGAAGGTAGAAATAGG + Intergenic
943123871 2:183772203-183772225 TACATTTACCACCTTTAAATTGG + Intergenic
943202788 2:184850377-184850399 TACATGAAGCTGCTGGAAACTGG + Intronic
945826224 2:214723143-214723165 TACATGTAGCAGATTGAAACTGG + Intergenic
945853303 2:215035755-215035777 TACATTTTTCACCAGGAAATGGG + Intronic
946176056 2:217922554-217922576 TCCATTTAGAAGCTGGGGATTGG + Intronic
947512433 2:230769016-230769038 TACAGTTAGCAACTTAAAATAGG + Intronic
947640101 2:231702434-231702456 TACAGATAGCAGCTGGAAAATGG + Intergenic
947689242 2:232119684-232119706 TACAGTTAATAGCTGGGAATGGG + Intronic
948167266 2:235872785-235872807 TCCATTTAGCTGCTGCACATGGG + Intronic
1169567332 20:6869343-6869365 GACCTTTAGCAGCAGGGAATAGG - Intergenic
1169981792 20:11393008-11393030 TACATTTAGCAGGTGTCAAGAGG + Intergenic
1171018817 20:21565623-21565645 TACATTAAGAAGGTGGAAATAGG + Intergenic
1175464961 20:59184680-59184702 TACGTTTAGCAGATAGAACTTGG - Intergenic
1176249917 20:64115746-64115768 CACATTTTGGAGCTGGATATAGG - Intergenic
1178484277 21:33007459-33007481 CACATTCAGCAACTTGAAATTGG - Intergenic
1180116688 21:45711149-45711171 TACATTCAGCACCTAGATATTGG - Intronic
1181317519 22:21980272-21980294 TACATTTAGCGCCTGGACACAGG + Intronic
1181508239 22:23376148-23376170 TTCATTTCACAGCTGGAAAATGG - Intergenic
1181661720 22:24355309-24355331 CACATTTAGCACCTGGATCTTGG - Intronic
1182313689 22:29427618-29427640 TACTTTTAGCAGCAGGGCATTGG - Intergenic
1182352174 22:29705179-29705201 GACATTTACCAGCTGGGAAGTGG + Intergenic
953205299 3:40822520-40822542 TACTCTCAGCAGCTGGATATGGG - Intergenic
956784232 3:72628996-72629018 AACACCTAGCAACTGGAAATTGG + Intergenic
959683237 3:109119505-109119527 TTGAGATAGCAGCTGGAAATTGG - Intergenic
960570024 3:119176704-119176726 TACATTTAACAAGTGGAAAGCGG - Intronic
960654968 3:119993008-119993030 GGCATTTAGCAGCTGTAAAAAGG + Intronic
962055499 3:131867159-131867181 TACATTTTGAAGATAGAAATAGG + Intronic
964087952 3:152839937-152839959 TGCTTATAGCAGCTGGAATTTGG + Intergenic
964098160 3:152957601-152957623 TACAATTATTAGCTGCAAATGGG + Intergenic
965059275 3:163762586-163762608 TACATGAAGCAGCTTGAAACCGG - Intergenic
965438308 3:168680111-168680133 TACATTTAGCTGCTGGCACTTGG + Intergenic
965709015 3:171537679-171537701 TACATTTACCAGCAGGAATCAGG - Intergenic
966464242 3:180212333-180212355 CACTTTTAGAAGATGGAAATGGG - Intergenic
966646015 3:182247094-182247116 GTCATTTAGCAGCTGAAAAGTGG + Intergenic
968013681 3:195305862-195305884 TATATTTGGGAGCTGGAAGTTGG + Intronic
968248322 3:197178641-197178663 AACATTTAGCAGTAGGAAAAAGG + Intronic
970528483 4:16957125-16957147 AATATTTTGCAGTTGGAAATGGG - Intergenic
970687149 4:18581469-18581491 TAAATTAAGCATCTGAAAATCGG - Intergenic
971406490 4:26325302-26325324 TACATGTAGAAGCTGGATAAAGG - Intronic
972089833 4:35267645-35267667 TAGATGTAGGAGCTGGAAAGTGG - Intergenic
972513130 4:39788245-39788267 TACTTTTAGAAGATGGAAAGTGG + Intergenic
975421108 4:74165810-74165832 TACATTTTGCACATTGAAATGGG + Intronic
975592455 4:76013812-76013834 TTCATTTAGCATGTGAAAATTGG + Intronic
976197634 4:82548666-82548688 TAAGTGCAGCAGCTGGAAATTGG + Intronic
976578512 4:86705611-86705633 TAAATTTGGCAGCTGCTAATGGG + Intronic
977370953 4:96135033-96135055 AACATTAAGTATCTGGAAATAGG - Intergenic
977988384 4:103413051-103413073 TACTTTTTACAGCTGGAAATGGG + Intergenic
978003905 4:103592923-103592945 AGCATTGAGCAGATGGAAATTGG + Intronic
978636400 4:110812504-110812526 TACATTTAGCAACAAGAAAGCGG - Intergenic
979164556 4:117511210-117511232 TTCATTCAGAAGCTGAAAATGGG - Intergenic
979867419 4:125774189-125774211 AACCTTTAACAGCTTGAAATAGG + Intergenic
980152550 4:129065132-129065154 TACATTTTGAAGCTTGAAGTTGG + Intronic
980559182 4:134450134-134450156 CAGATAAAGCAGCTGGAAATAGG - Intergenic
986148605 5:5105342-5105364 TTCATTTTCCAGCTGTAAATGGG - Intergenic
989358960 5:40577480-40577502 TACATTTACAAAATGGAAATTGG - Intergenic
990115945 5:52390925-52390947 TATATATAGCAGCTGTACATTGG + Intergenic
990122903 5:52477639-52477661 TACATTTAGAATCTTAAAATTGG - Intergenic
990626187 5:57613856-57613878 GACATTTAGTACCTGGAAAAAGG - Intergenic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
992653365 5:78883948-78883970 TATATTTTGCAACTGGAAATTGG + Intronic
995707192 5:114998180-114998202 TCCAGTGAGCAGCTGGAAAGGGG - Intergenic
998870133 5:146543547-146543569 TTAATTTAGCAGCTGCAAATGGG - Intergenic
998933016 5:147201974-147201996 TACCTTGAGGAGCTGGAAGTTGG + Intergenic
1000984524 5:167852450-167852472 GACATTCAGCAGCTGCAAAACGG + Intronic
1004067516 6:12263267-12263289 TACATTTAGCAGGTGAAATTTGG - Intergenic
1005234028 6:23738970-23738992 TACAGTTATCAGCTGGACACAGG - Intergenic
1007081293 6:39106682-39106704 TTCATTTAGCAGTTGTACATAGG - Intronic
1008022590 6:46597650-46597672 TACATTTAGAAAATGGCAATGGG + Intronic
1008355239 6:50544861-50544883 TAGATTGAGCATCTGGCAATAGG - Intergenic
1009385198 6:63078937-63078959 TCCAGTGAGCAGCTGGAAAGGGG + Intergenic
1009972504 6:70639728-70639750 TACAATTACCAACTGAAAATGGG - Intergenic
1011410548 6:87061727-87061749 TACTATTAGTAGCTTGAAATTGG - Intergenic
1012886208 6:104849141-104849163 TTCATTTGGCAGCAAGAAATGGG - Exonic
1013192249 6:107813496-107813518 TACATTTTGAAGCTGGAGGTGGG + Intronic
1015295750 6:131590385-131590407 TACATAAAGCAACTGGAATTCGG + Exonic
1016795739 6:148115213-148115235 TGAATTTAGCAGCTGGAAAAAGG + Intergenic
1016986083 6:149896957-149896979 GACATTTTGCAGTTGGAAAATGG - Intronic
1018772417 6:166982983-166983005 TACCTCTAGAAGCTGGAAAAGGG - Intergenic
1020926057 7:14326190-14326212 TCCACTTAGCAGCTGCTAATAGG - Intronic
1021090036 7:16472613-16472635 TAAATATAGCAGAAGGAAATGGG - Intronic
1021344849 7:19513790-19513812 AACATTTAGAGGCTGGAAAAAGG - Intergenic
1021509595 7:21421047-21421069 TACACTTAGCTCCTGAAAATGGG + Intergenic
1023048225 7:36229810-36229832 AACAATTAGCAGCTGGAAACAGG - Intronic
1026447220 7:70495491-70495513 TACCTTTAGCAGCAGAAATTTGG + Intronic
1027948806 7:84785707-84785729 TACTTTTAGCAACTGGCAAGTGG - Intergenic
1028230061 7:88296451-88296473 TTAATTTAACAGCTGTAAATAGG + Intronic
1028494478 7:91448479-91448501 TCCAGTGAGCAGCTGGAAAGGGG + Intergenic
1030010601 7:105162714-105162736 TACATTTAGCAGCAGGCATAGGG + Intronic
1031050604 7:116941176-116941198 TACAGTTGGCAGGAGGAAATTGG + Intergenic
1033227955 7:139575610-139575632 TACTTTCAGCATCTGGAAAATGG + Intronic
1033424988 7:141236076-141236098 AACATTTGGAAGCTGGAATTAGG - Intronic
1037937210 8:22923099-22923121 AACACGTAGCAGCTGCAAATAGG - Intronic
1038256894 8:25958553-25958575 GAAATTAAGCAGCAGGAAATGGG - Intronic
1039678842 8:39706005-39706027 CATCTTTAGCAGTTGGAAATGGG + Intronic
1039811915 8:41056794-41056816 TGCACGTTGCAGCTGGAAATAGG - Intergenic
1042534136 8:69841808-69841830 AACATCTAGAAGCTGGAATTTGG - Intergenic
1042807930 8:72792077-72792099 CCCATTTAGCAGCAGTAAATGGG + Intronic
1044316784 8:90758787-90758809 TTCATTTAGCAACAGGTAATGGG + Intronic
1045772813 8:105764000-105764022 TACTTTCAGGATCTGGAAATGGG + Intronic
1045920993 8:107528855-107528877 TACATTTAGAACCTAGAAATTGG - Intergenic
1046270214 8:111885959-111885981 TGTATTTAGCAGCTGGTAAATGG - Intergenic
1048979585 8:139696010-139696032 TACATTTAGAAACTGGAACGTGG - Intronic
1049929287 9:440614-440636 TACATTTAGCATCTGGCTAGAGG + Intronic
1051137200 9:13935617-13935639 AACATTAAGCAGGTGGAGATGGG - Intergenic
1052092805 9:24350084-24350106 AACATTTACCAGATGGAAAAGGG - Intergenic
1053608388 9:39682997-39683019 TAAATTTATAAGGTGGAAATGGG - Intergenic
1053866230 9:42439361-42439383 TAAATTTATAAGGTGGAAATGGG - Intergenic
1054245142 9:62659412-62659434 TAAATTTATAAGGTGGAAATGGG + Intergenic
1054559270 9:66693943-66693965 TAAATTTATAAGGTGGAAATGGG + Intergenic
1059930868 9:119259102-119259124 TCCATTGAGCACCTGGAAAGAGG + Intronic
1189877551 X:45452435-45452457 TACATATAGCAGTTGAAGATAGG - Intergenic
1190463253 X:50699870-50699892 TACATTTAGGAGATGAAAAAGGG + Intronic
1191689941 X:63929000-63929022 TTCATTTGACAACTGGAAATAGG - Intergenic
1192090222 X:68146923-68146945 TACATATGGCAACTGAAAATTGG + Intronic
1194530809 X:95045812-95045834 TACAATTAGCAGCTAGCAATTGG - Intergenic
1194964960 X:100277775-100277797 TACTTTTAGCAGATGGAAGTGGG - Intergenic
1195252454 X:103062761-103062783 TTCAATTAGAAGCTGGTAATAGG + Exonic
1195278653 X:103309456-103309478 TTCATTTAGAAGCTGGTAATAGG + Exonic
1195471364 X:105234201-105234223 TACTTTTAGCAGTTGGAGAAAGG - Intronic
1196044851 X:111246370-111246392 TACCTCCAGCAGCTGGACATGGG - Exonic
1197853557 X:130890332-130890354 TACATTCTGGAGCTTGAAATCGG - Intronic
1199019693 X:142863527-142863549 TATATTTAGCATTTGGAATTAGG - Intergenic
1199934536 X:152559445-152559467 TGCATTTTGTAGCTGGAAATGGG + Intergenic
1201430309 Y:13896063-13896085 TCCAGTGAGCAGCTGGAAAGGGG - Intergenic
1201468904 Y:14313312-14313334 TCCAGTGAGCAGCTGGAAAGGGG - Intergenic
1201495912 Y:14591324-14591346 TCCAGTGAGCAGCTGGAAAGGGG + Intronic
1201911696 Y:19139306-19139328 TCCAGTGAGCAGCTGGAAACGGG - Intergenic