ID: 903785592

View in Genome Browser
Species Human (GRCh38)
Location 1:25859224-25859246
Sequence TTACGCCTCCAGGCCCTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 69}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903785581_903785592 25 Left 903785581 1:25859176-25859198 CCGACTTCGCTTTCATCATCTCC 0: 1
1: 0
2: 1
3: 32
4: 293
Right 903785592 1:25859224-25859246 TTACGCCTCCAGGCCCTACCTGG 0: 1
1: 0
2: 0
3: 5
4: 69
903785583_903785592 4 Left 903785583 1:25859197-25859219 CCAGGTGTCCCCCAAACTCCTCC 0: 1
1: 1
2: 4
3: 21
4: 307
Right 903785592 1:25859224-25859246 TTACGCCTCCAGGCCCTACCTGG 0: 1
1: 0
2: 0
3: 5
4: 69
903785579_903785592 27 Left 903785579 1:25859174-25859196 CCCCGACTTCGCTTTCATCATCT 0: 1
1: 0
2: 0
3: 12
4: 128
Right 903785592 1:25859224-25859246 TTACGCCTCCAGGCCCTACCTGG 0: 1
1: 0
2: 0
3: 5
4: 69
903785586_903785592 -6 Left 903785586 1:25859207-25859229 CCCAAACTCCTCCCGTCTTACGC 0: 1
1: 0
2: 0
3: 3
4: 43
Right 903785592 1:25859224-25859246 TTACGCCTCCAGGCCCTACCTGG 0: 1
1: 0
2: 0
3: 5
4: 69
903785585_903785592 -5 Left 903785585 1:25859206-25859228 CCCCAAACTCCTCCCGTCTTACG 0: 1
1: 0
2: 0
3: 5
4: 74
Right 903785592 1:25859224-25859246 TTACGCCTCCAGGCCCTACCTGG 0: 1
1: 0
2: 0
3: 5
4: 69
903785584_903785592 -4 Left 903785584 1:25859205-25859227 CCCCCAAACTCCTCCCGTCTTAC 0: 1
1: 0
2: 1
3: 5
4: 143
Right 903785592 1:25859224-25859246 TTACGCCTCCAGGCCCTACCTGG 0: 1
1: 0
2: 0
3: 5
4: 69
903785587_903785592 -7 Left 903785587 1:25859208-25859230 CCAAACTCCTCCCGTCTTACGCC 0: 1
1: 0
2: 0
3: 7
4: 70
Right 903785592 1:25859224-25859246 TTACGCCTCCAGGCCCTACCTGG 0: 1
1: 0
2: 0
3: 5
4: 69
903785580_903785592 26 Left 903785580 1:25859175-25859197 CCCGACTTCGCTTTCATCATCTC 0: 1
1: 0
2: 1
3: 16
4: 191
Right 903785592 1:25859224-25859246 TTACGCCTCCAGGCCCTACCTGG 0: 1
1: 0
2: 0
3: 5
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903785592 Original CRISPR TTACGCCTCCAGGCCCTACC TGG Intronic
900910655 1:5594801-5594823 TGACTCCCCCAGGCCCCACCAGG + Intergenic
901129889 1:6955633-6955655 TTTCTCCTGAAGGCCCTACCTGG + Intronic
903785592 1:25859224-25859246 TTACGCCTCCAGGCCCTACCTGG + Intronic
906154650 1:43606819-43606841 CTATGCCTCCAGCCCCTACTCGG + Exonic
907423282 1:54361957-54361979 TTACGCCTCCAGTCTCTTTCTGG - Intronic
916278725 1:163024381-163024403 TTAAGCTTCCAGGCCTTTCCTGG - Intergenic
919239196 1:194889601-194889623 CTCAGCCTCCAGGCCCTCCCTGG - Intergenic
922765065 1:228152302-228152324 TTCCATCTCCAGGCCCTCCCAGG - Intronic
924265875 1:242281319-242281341 TCAGGTCTCCAGGCGCTACCTGG - Intronic
1066653305 10:37679554-37679576 TCTCTCCTCCAGGCCCTTCCAGG - Intergenic
1066718967 10:38317327-38317349 TCAGGTCTCCAGGCGCTACCTGG + Intergenic
1067480842 10:46596682-46596704 TTACGCCTCTAGACTCTACTAGG + Intergenic
1067613897 10:47745119-47745141 TTACGCCTCTAGACTCTACTAGG - Intergenic
1067727919 10:48786642-48786664 TTATACATCCAGGCTCTACCAGG + Exonic
1069826375 10:71257427-71257449 TTCCCCCTCCAGGCCCACCCAGG + Intronic
1069861580 10:71475063-71475085 TTGCCCCTCCAGGCCCTGCAGGG + Intronic
1071629303 10:87205096-87205118 TTACGCCTCTAGACTCTACTAGG - Intergenic
1072278161 10:93842712-93842734 TTACGCATCCAGGCACCTCCTGG + Intergenic
1076157989 10:128218148-128218170 TTACGCCTGCAGGCACTGCCTGG + Intergenic
1080823327 11:35827160-35827182 TTATGACTCCACGCCCTACAGGG + Intergenic
1083430838 11:62612895-62612917 CTCCGGCTCCAGGCCCTTCCCGG + Exonic
1083989142 11:66236056-66236078 TTTTGCCTCCAGGGACTACCTGG + Intronic
1096541313 12:52308757-52308779 TGGCGCCTCCCGGCCCTCCCCGG - Exonic
1106157785 13:27173287-27173309 TTAGACCTCTAGGGCCTACCTGG + Intergenic
1108557004 13:51603360-51603382 CTGCTGCTCCAGGCCCTACCAGG - Intronic
1108593071 13:51927754-51927776 TTACCTCTCCAGTCCCTACTTGG + Intergenic
1119679381 14:76580628-76580650 TCACGCCTTCAGGCCTTCCCAGG + Intergenic
1202857881 14_GL000225v1_random:63120-63142 TTCCGCCACCAGGCCCTCCATGG + Intergenic
1202863932 14_GL000225v1_random:103755-103777 TTCCGCCGCCAGGCCCTCCATGG + Intergenic
1126099655 15:45111683-45111705 TCTCCCCTCCAGGCCCTGCCAGG + Intronic
1126103876 15:45135354-45135376 TCTCCCCTCCAGGCCCTGCCAGG - Intronic
1128780567 15:70356284-70356306 TTTCCCCTCCCTGCCCTACCTGG + Intergenic
1133234512 16:4381697-4381719 CTAAGCCTGCAGGCCCTGCCTGG + Exonic
1148513358 17:48192592-48192614 TTAAGACTCCAGGCCCCAGCGGG + Intronic
1148568215 17:48646407-48646429 GTGCGCCCCGAGGCCCTACCCGG + Intergenic
1150099267 17:62407804-62407826 TTAGGCCTAGAGGCCTTACCTGG - Intronic
1155918899 18:31583422-31583444 TTTCTCCTCCAGGCTCTTCCGGG + Intergenic
1161114894 19:2491188-2491210 CTGGGCCTCCAGGCCCTTCCCGG + Intergenic
925885730 2:8392487-8392509 TAATTCCTTCAGGCCCTACCAGG + Intergenic
932413294 2:71559699-71559721 TAACGCCTGCTGGCCCTGCCAGG + Intronic
934651170 2:96092124-96092146 TGTCCCCTCCAGGCCCTTCCAGG + Intergenic
935976608 2:108584862-108584884 CTACTGCTCCAGGCCCTACCTGG - Intronic
937929455 2:127193075-127193097 TTTGGCCTCCACGCCCTACCTGG + Exonic
944206775 2:197164883-197164905 TTCCGCCTCCAGGGCCCACTAGG - Intronic
944311264 2:198236227-198236249 TTACACCTACATGCCCTCCCAGG + Intronic
947841079 2:233208398-233208420 ACACGGCTCCAGGCCCTGCCTGG - Intergenic
1169422403 20:5471094-5471116 TTCCTCCCCCGGGCCCTACCGGG + Intergenic
1172856635 20:38009366-38009388 TTGCTCCTCAAGGCCCTACCAGG + Intronic
1180876228 22:19176480-19176502 GTGCGCCTCCAGGCCCTATGGGG + Exonic
1184173860 22:42774962-42774984 TTCAGCCTTCAGGCCCTCCCTGG - Intergenic
1185053093 22:48563866-48563888 GCCCGCCTCCAGGTCCTACCAGG + Intronic
950704710 3:14772704-14772726 TTGCCCCTCCTGGCCCAACCGGG + Intronic
955935234 3:64096670-64096692 TTATGCCTCCAGACCCCTCCGGG + Exonic
961536124 3:127572137-127572159 TCAACCCTCCAGGCCCTCCCAGG + Intergenic
967027059 3:185573977-185573999 TTATGTCTCCAGTCCCTACTCGG - Intergenic
986637084 5:9834083-9834105 TCCCCCTTCCAGGCCCTACCTGG + Intergenic
996011535 5:118486215-118486237 TTGAGCCTCCAGGTCCTTCCTGG - Intergenic
1005649458 6:27873378-27873400 TAACGCCTCCACGCCGTGCCAGG + Exonic
1006169988 6:32087124-32087146 TTCTACCTTCAGGCCCTACCTGG - Intronic
1016074187 6:139776746-139776768 GTACCCCTCTAGGCCCTACCAGG - Intergenic
1017056870 6:150444513-150444535 TCAAGCTTCCTGGCCCTACCTGG - Intergenic
1022864183 7:34400140-34400162 TGACGCCTCCAGACCAGACCAGG - Intergenic
1024536306 7:50437411-50437433 TGAAGCTTCCATGCCCTACCTGG + Intergenic
1048014687 8:130486842-130486864 CTTCACCTCCAGGCCCCACCTGG + Intergenic
1056262395 9:84862070-84862092 TTCCCCCTCCAGGCCCCATCTGG - Intronic
1058730440 9:107844961-107844983 TCATGCCTCCAGGCCTTTCCTGG - Intergenic
1059665858 9:116446036-116446058 TAACCCCTCCAGGCACTGCCTGG - Intronic
1060507590 9:124209622-124209644 TTACTCCTACAGGGCCTCCCGGG - Intergenic
1060805109 9:126570477-126570499 TTATGCCTTCAGGGCCTGCCTGG + Intergenic
1203740387 Un_GL000216v2:172261-172283 TTCCGCCGCCAGGCCCTCCATGG - Intergenic
1185890192 X:3815921-3815943 TCAGGCCTCCAGGCCCACCCCGG - Intergenic
1189874280 X:45419963-45419985 TAGCACCTCCAGGCCCAACCAGG - Intergenic
1190108192 X:47573711-47573733 TTCCTCCTCCAGGGCCTCCCAGG - Intronic
1199861114 X:151801231-151801253 TTCAGCCTTCAGGCCCTCCCTGG + Intergenic
1199980332 X:152917230-152917252 TTACCCCTCCAGTCCCTCCAGGG + Intronic