ID: 903788325

View in Genome Browser
Species Human (GRCh38)
Location 1:25875656-25875678
Sequence GCTGCTTGTGCGCGGCGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903788325_903788335 11 Left 903788325 1:25875656-25875678 CCCGCCCGCCGCGCACAAGCAGC No data
Right 903788335 1:25875690-25875712 AGGCCCACGTGTTGCACGCGCGG No data
903788325_903788336 12 Left 903788325 1:25875656-25875678 CCCGCCCGCCGCGCACAAGCAGC No data
Right 903788336 1:25875691-25875713 GGCCCACGTGTTGCACGCGCGGG No data
903788325_903788342 23 Left 903788325 1:25875656-25875678 CCCGCCCGCCGCGCACAAGCAGC No data
Right 903788342 1:25875702-25875724 TGCACGCGCGGGAGAGGGGTCGG No data
903788325_903788339 17 Left 903788325 1:25875656-25875678 CCCGCCCGCCGCGCACAAGCAGC No data
Right 903788339 1:25875696-25875718 ACGTGTTGCACGCGCGGGAGAGG No data
903788325_903788330 -9 Left 903788325 1:25875656-25875678 CCCGCCCGCCGCGCACAAGCAGC No data
Right 903788330 1:25875670-25875692 ACAAGCAGCTCTGCCCCGCCAGG No data
903788325_903788341 19 Left 903788325 1:25875656-25875678 CCCGCCCGCCGCGCACAAGCAGC No data
Right 903788341 1:25875698-25875720 GTGTTGCACGCGCGGGAGAGGGG No data
903788325_903788340 18 Left 903788325 1:25875656-25875678 CCCGCCCGCCGCGCACAAGCAGC No data
Right 903788340 1:25875697-25875719 CGTGTTGCACGCGCGGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903788325 Original CRISPR GCTGCTTGTGCGCGGCGGGC GGG (reversed) Intergenic
No off target data available for this crispr