ID: 903790297

View in Genome Browser
Species Human (GRCh38)
Location 1:25888245-25888267
Sequence GAGTGGGTGAGGAGGGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 665
Summary {0: 1, 1: 0, 2: 5, 3: 60, 4: 599}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903790290_903790297 28 Left 903790290 1:25888194-25888216 CCTAGAAAACACTGAAGAAACAT 0: 1
1: 0
2: 8
3: 124
4: 1042
Right 903790297 1:25888245-25888267 GAGTGGGTGAGGAGGGCTGTGGG 0: 1
1: 0
2: 5
3: 60
4: 599

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903790297 Original CRISPR GAGTGGGTGAGGAGGGCTGT GGG Intronic
900117884 1:1036247-1036269 GAGTGGGGGATGATGGCTGGAGG + Intronic
900317157 1:2062940-2062962 GGGTGGGTGATGGGGGCTGGGGG - Intronic
900348655 1:2224463-2224485 GAGTGGCTGGGGCTGGCTGTAGG - Intergenic
901877274 1:12174009-12174031 GAGTGCGGGGGGAGGGCTGTTGG + Intronic
901930959 1:12595857-12595879 GAGGGGGTGAGGAGGGGAGCCGG + Intronic
902275515 1:15336896-15336918 GAGTTGGTGAAGGGGGCTGCTGG - Intronic
902288495 1:15421808-15421830 GATTAGGTCAGGAGGGCTGTTGG - Intronic
902394673 1:16126152-16126174 GGGTGGGAAAGCAGGGCTGTGGG - Intronic
903024856 1:20420231-20420253 GAGTGGGTCTTGTGGGCTGTGGG - Intergenic
903044397 1:20554231-20554253 GAGGGAATGAGGAGGTCTGTGGG - Exonic
903623380 1:24714294-24714316 GAGTGGGTGAGTAGAGCACTGGG + Intergenic
903656082 1:24949682-24949704 GGCTGGGTGAGGTGGGCTGCTGG - Intronic
903790297 1:25888245-25888267 GAGTGGGTGAGGAGGGCTGTGGG + Intronic
904348727 1:29891164-29891186 GTGTGGAGGTGGAGGGCTGTGGG + Intergenic
904484246 1:30814380-30814402 GAGGAGGGGAGGAGGGCTGTTGG - Intergenic
904770413 1:32878115-32878137 GAGTGGGCCAGGGTGGCTGTGGG + Intergenic
905114996 1:35630922-35630944 ATGTGGGTGAGGAGGAATGTGGG + Intronic
905246372 1:36617166-36617188 GAGTGTGTGACTATGGCTGTGGG + Intergenic
905464355 1:38141426-38141448 GATTGGGAGAGCAGGGCTGAAGG - Intergenic
905894747 1:41538238-41538260 GTGTGGGTGGGGAGGTCTGGAGG + Intronic
906187333 1:43871715-43871737 GTGAGGGAGAGGAGGGATGTGGG + Intronic
906187366 1:43871826-43871848 GTGAGGGAGAGGAGGGGTGTGGG + Intronic
906418069 1:45638235-45638257 GAATGGATGAGGAAGTCTGTTGG - Intronic
906460912 1:46034709-46034731 GGGTGGGGGAGAAGGGGTGTGGG - Exonic
908642834 1:66244540-66244562 CAGGGAGTGAGGAGGGGTGTGGG - Intronic
909581685 1:77243122-77243144 GAGTTGGTGAGGAGGGGGGCAGG + Intergenic
910000541 1:82336217-82336239 GTGGTGGTGAGGAGGGCTGGTGG - Intergenic
910283106 1:85523344-85523366 GAGAAGGGGAGGAGGGCTGCAGG - Intronic
910351911 1:86307801-86307823 GTGTGGGTTAGGGGAGCTGTTGG + Intergenic
911348086 1:96721482-96721504 GAGAGAGTGTGGAGAGCTGTTGG + Intergenic
911600942 1:99847845-99847867 GAATGGATGAGGAAGGCTGAGGG + Intergenic
912706787 1:111920664-111920686 GAGTGGATGAGGAGGGAAGTAGG - Intronic
912766610 1:112418366-112418388 GAGTGAGTGAGGAGGATTCTGGG - Intronic
912947337 1:114096089-114096111 AAGTGGGGGAGGAGGGGTGGTGG + Intronic
912997645 1:114547273-114547295 GAGTGGGGAAAGAGGGCTGAGGG + Intergenic
913553278 1:119937727-119937749 TAGTGGGTGGGCAGGGCTCTGGG - Intronic
913585563 1:120272248-120272270 GAGGTGGGGAGGAGGGCAGTGGG - Intergenic
913622621 1:120626119-120626141 GAGGTGGGGAGGAGGGCAGTGGG + Intergenic
914206909 1:145539645-145539667 GAGAAGGGGAGGAGGGCTGCAGG + Intergenic
914437187 1:147670484-147670506 GAGTAGGTGAGGAGGTGGGTAGG - Exonic
914567569 1:148884107-148884129 GAGGTGGGGAGGAGGGCAGTGGG - Intronic
914605253 1:149246138-149246160 GAGGTGGGGAGGAGGGCAGTGGG + Intergenic
915121054 1:153629719-153629741 GAGTGGGAGAGGAGACCTGCAGG - Intronic
915270523 1:154750309-154750331 AAATGGGTGAGGAGGGGTGCAGG - Intronic
915340337 1:155173864-155173886 GGGGGTGTGAGGAGGGCTGGGGG - Intronic
915386021 1:155492926-155492948 GAGAGGCTGAGGTGGGATGTTGG - Intronic
915462895 1:156080625-156080647 GGGTGGGTGAGTGGGGGTGTTGG - Intronic
916550429 1:165844679-165844701 GAGAGGGAGAGGGGGGCTGAAGG + Intronic
917101362 1:171449156-171449178 GGGTGGGTGGGGTGGGATGTGGG - Intergenic
917262246 1:173182864-173182886 GTGTGGGTGAGGAGAACTCTTGG + Intergenic
917484922 1:175447213-175447235 GAGTGGGTGAGGAGGGGGTGGGG + Intronic
918006826 1:180549007-180549029 GATTGGGGGAGGAGGGCAGGAGG - Intergenic
918139447 1:181708134-181708156 GTGTGGCTGTGGTGGGCTGTAGG + Intronic
918295171 1:183149681-183149703 TGGTGTGTGAGGAGGGGTGTGGG - Intergenic
919333915 1:196207974-196207996 GAGTGGCTGAGGAGTGGTGGAGG + Intergenic
919785266 1:201254643-201254665 GAGTGGGTGAACAGAGCTGGAGG + Intergenic
920054387 1:203181847-203181869 GTGGGGGTAAGGTGGGCTGTAGG - Intronic
920500084 1:206480268-206480290 GAGAGGGGGAGGCGGGCTGGAGG + Intronic
920769993 1:208875074-208875096 GGGTGGGGGAGGAGGGGTGGAGG - Intergenic
920849998 1:209622353-209622375 GAGTGGGTGGGGAGGGCAGACGG + Intronic
921257453 1:213355274-213355296 GAGTGGGTGAAGGGGGCTGGTGG + Intergenic
923570042 1:235105265-235105287 CTGTGGGAGAGGAAGGCTGTGGG + Intergenic
924011654 1:239671685-239671707 GAGGAGGTGAGGTGGGGTGTAGG + Intronic
1062831352 10:608159-608181 GTGTGTGTGGGGGGGGCTGTGGG - Intronic
1062831375 10:608228-608250 GTGTGTGTGGGGGGGGCTGTGGG - Intronic
1062831428 10:608398-608420 GGGTGTGTGTGGGGGGCTGTGGG - Intronic
1063497585 10:6524743-6524765 AAGTGGGTGAGGAGGGAGGAGGG + Intronic
1065957348 10:30705352-30705374 GAAGGGGTGAGGAGCGCTGTGGG - Intergenic
1070604321 10:77888167-77888189 AGGTGGGCGGGGAGGGCTGTTGG + Intronic
1071499355 10:86192510-86192532 CAGTGGGTGCTGAGGGCTGAAGG + Intronic
1071731227 10:88250480-88250502 GAGGGTGTGAGGTGGACTGTGGG + Intergenic
1072188859 10:93064827-93064849 GAGTGGCAGAGAAGGGCAGTGGG - Intronic
1072263204 10:93702354-93702376 GGGTGTGTGAGGAGGGCTGTGGG - Exonic
1072990271 10:100186025-100186047 GAGTGGGCGGGGCCGGCTGTTGG - Exonic
1073001808 10:100291284-100291306 GAGAGGGTGAGCTGGGCTGATGG - Exonic
1074165763 10:110872349-110872371 CAGAGGGGGAGGAGGGCTGAGGG - Intronic
1074189082 10:111120556-111120578 GAGAGGGTGAAGAGTGCTGGTGG - Intergenic
1074700019 10:116084462-116084484 GGGTAGGTGAGGATAGCTGTGGG - Intronic
1075753227 10:124791310-124791332 GAGTAGGAGGGGAGGGATGTGGG - Intronic
1075778031 10:125000528-125000550 GCGGGGGTGGGGAGGGGTGTAGG + Intronic
1075858938 10:125657000-125657022 GAGTGAATGAGGAAGCCTGTGGG - Intronic
1075933618 10:126321449-126321471 GAGTGGGTGGTGAGTGTTGTTGG + Intronic
1075985169 10:126779048-126779070 GAGGAGGTGAGGAGGTCAGTGGG - Intergenic
1076839581 10:133039434-133039456 GACTGGGTGAGGTGGGTTGGGGG + Intergenic
1077117842 11:893380-893402 GGGTGGCTGTGGAGGGCTCTGGG - Intronic
1077171910 11:1170400-1170422 GAGTGGGTGAGTAGGTGAGTGGG - Intronic
1077251924 11:1564555-1564577 GGGTGGGGGAGGAGGGCAGGAGG - Intronic
1077392097 11:2304887-2304909 GGGTGAGAGAAGAGGGCTGTGGG - Intronic
1077504103 11:2922297-2922319 GGGTGGGTGTGGGGGGCTGGAGG - Intronic
1077672564 11:4168870-4168892 GAGTGGGTGGGGAGGTTTTTTGG + Intergenic
1078208747 11:9253082-9253104 GAGTGGGGGAGGATGGCTTTAGG - Intronic
1078501507 11:11883686-11883708 GAGTGAGTGAGTAGGGCTTGGGG + Intronic
1078609748 11:12809923-12809945 GAGTGGGTGAGGAGGTGTGGAGG + Intronic
1081616947 11:44596715-44596737 GAGTGAAAGAGGAGGGCTGGAGG + Intronic
1081619703 11:44611992-44612014 GGGTGGGTGGGGAAGGATGTGGG + Intronic
1081856608 11:46308029-46308051 GAGGGAGGGAGGAGGGCTGGTGG + Intronic
1082029555 11:47594427-47594449 GAGGGGGAGAGGAGGGGAGTAGG + Exonic
1083597054 11:63922979-63923001 GAGTGGTGGAGGGGGACTGTGGG - Intergenic
1083936713 11:65873194-65873216 GACTGGGTTAGGTGGGCTCTAGG - Intronic
1083965532 11:66041800-66041822 AAGCGGTTGAGGAGGGTTGTAGG + Intergenic
1084085692 11:66854096-66854118 GAGTGGGTGATGAGGGTGATGGG - Intronic
1084164906 11:67371056-67371078 GAGTGGGTGAGGAGTGGGCTAGG + Intronic
1084574700 11:69981660-69981682 TAGCGGGAGAGGAGGGCTGGAGG - Intergenic
1084942598 11:72620873-72620895 GAGGGAGAGAGGAGGGCTGTGGG + Intronic
1085083839 11:73653798-73653820 GAGTGGGTAAGGAGGGAAGGAGG + Intronic
1085101058 11:73800409-73800431 GAGTGGGTGGTGAGAGCAGTGGG - Intronic
1085274098 11:75287281-75287303 GAGGGCGAGAGGAGGGCTGGGGG - Intronic
1085308138 11:75500063-75500085 GAATGGCTGTGGAGGGCTGAGGG - Intronic
1087248258 11:95866367-95866389 GAGGAGGTGAGGAAGGCTTTTGG - Intronic
1087682560 11:101232870-101232892 GAGTGGCTGGGAAGGGGTGTTGG + Intergenic
1089311438 11:117560788-117560810 CAGTGGGGGAGAAGGGGTGTGGG - Intronic
1089515106 11:119027233-119027255 GAGGGGGAGAGGAGAGCAGTGGG - Intronic
1089588120 11:119522780-119522802 GAGTGGGTGAGGCTGGCTCCTGG + Intergenic
1089669330 11:120042371-120042393 TAGGGGGTGAGGAGGTATGTGGG + Intergenic
1090405399 11:126473241-126473263 GAGTGGGTGGGGAGGGGGCTAGG - Intronic
1090408826 11:126493721-126493743 CTGTGGGTGAGGGGGGCTGTAGG - Intronic
1090854272 11:130598362-130598384 GGTTGGACGAGGAGGGCTGTGGG + Intergenic
1090873864 11:130771617-130771639 GAGGGAGTAGGGAGGGCTGTCGG + Intergenic
1090905347 11:131069616-131069638 GAGGGGGTGAAGAGGGGTGAGGG - Intergenic
1091044813 11:132316078-132316100 GTGAGGATGAGGAGTGCTGTGGG - Intronic
1091285781 11:134408154-134408176 AAGCGGGTGAGGAGGGAGGTGGG + Intronic
1091302214 11:134514890-134514912 GTGAGGCTGAGGAGGGCTGGAGG + Intergenic
1091403712 12:196289-196311 GAGGGTGTGGGGCGGGCTGTTGG + Intronic
1091589821 12:1836447-1836469 GGGTGGGTGAGGTGGGCTGGGGG + Exonic
1091682504 12:2537130-2537152 AAGTGGAGGAGGAGGGCAGTGGG - Intronic
1091778960 12:3201858-3201880 GGGTGGGAAAGGAGGGGTGTGGG + Intronic
1092971587 12:13700680-13700702 GAGTGTTTGACGAGGGCTGGAGG - Intronic
1095944267 12:47745228-47745250 GATTGGAGGAGGAGGGCTGGAGG - Intronic
1095961067 12:47834744-47834766 GAGTGGATGGGGAGGGCGGTGGG - Intergenic
1095976270 12:47942801-47942823 GAGGGGGTGAGCAGGTGTGTGGG - Intronic
1096617537 12:52842494-52842516 GAGTAGGTGAGGTGGGCGGCAGG - Intronic
1096793048 12:54057003-54057025 GAAGGTGGGAGGAGGGCTGTTGG + Intergenic
1097187850 12:57205114-57205136 CAGTGGGTGGTGTGGGCTGTGGG - Exonic
1098069288 12:66654673-66654695 AAGGAGGAGAGGAGGGCTGTGGG + Intronic
1098885358 12:75955321-75955343 GGGTGAGTGAGGAGGGCTTGGGG - Intergenic
1099440040 12:82687596-82687618 GAGTTGGTGAGCAGCGCTCTGGG + Exonic
1100210346 12:92392748-92392770 GAGTGGGTGGATAGGGGTGTTGG - Intergenic
1101239413 12:102823738-102823760 GTATGTGTGAGGAGGGGTGTGGG - Intergenic
1101909531 12:108850829-108850851 GAGCTGGTGGGGAGGGCAGTTGG + Intronic
1102016333 12:109650356-109650378 GAGAGGCTGAGGAGGGCAGATGG + Intergenic
1102256414 12:111418160-111418182 AAGAGGGCGAGGAGGGCTGCAGG - Exonic
1102457891 12:113082205-113082227 GCGTGGGTGGGGAGGGATGAGGG - Intronic
1102539457 12:113608209-113608231 GAGGGGTTGAGGAGGGATGTGGG - Intergenic
1102997487 12:117361349-117361371 GAGGGGGTGGGGAGGGATCTTGG - Intronic
1103738187 12:123073928-123073950 GGTTGGGTGAGGAGAGCTGGGGG - Intronic
1104047558 12:125173860-125173882 GAGTGGGGGGGGTGGGCTGGTGG + Intergenic
1104413254 12:128577092-128577114 TAGTGGTTGATGGGGGCTGTGGG - Intronic
1104601152 12:130154343-130154365 GAGTGGGTGCAGAGAGCTGAGGG - Intergenic
1105202340 13:18191146-18191168 GAGTGGGTGGGGAGGGCAAGAGG + Intergenic
1105320763 13:19319306-19319328 GGGTCGGGGAGGAGGGCTGGTGG + Intergenic
1105859043 13:24393567-24393589 GAGAGGGTGAGGAGGGGAGGGGG + Intergenic
1106073833 13:26440398-26440420 GAGTGGGTAGGGAGAGATGTAGG + Intergenic
1106456994 13:29936229-29936251 GTGTGGGTGTGGAGAGCAGTGGG + Intergenic
1106522568 13:30510840-30510862 GACTGATTGAGGAGGGCTGGAGG - Intronic
1107613274 13:42138367-42138389 GAGGGGGTGAGGAGAGATGGTGG + Intronic
1108042596 13:46353080-46353102 GAGTGGGACATGATGGCTGTGGG - Intronic
1109271053 13:60255299-60255321 GAGGGGGAGAGGAGGACTGGAGG - Intergenic
1109412711 13:61994372-61994394 GAGAGAGTGAGGAGGATTGTGGG - Intergenic
1111558414 13:89911030-89911052 GATGGGGGCAGGAGGGCTGTAGG + Intergenic
1111639172 13:90946554-90946576 GCATGGGGGAGGAGTGCTGTAGG - Intergenic
1111888711 13:94054752-94054774 AAGTGGGTTAGGAGACCTGTGGG + Intronic
1112336591 13:98521993-98522015 GAGTGGAGGAGGAGGGCTTTGGG - Exonic
1113043578 13:106130112-106130134 GAGTTGTGGAGTAGGGCTGTGGG + Intergenic
1113909813 13:113836560-113836582 GAGGGGGTGGGGAGGGGTGAGGG + Intronic
1113909825 13:113836582-113836604 GAGGGGGTGGGGAGGGGTGAGGG + Intronic
1113909839 13:113836604-113836626 GAGGGGGTGGGGAGGGGTGGGGG + Intronic
1114517606 14:23309820-23309842 GAGTGGGAGAGGAGGGTGGCAGG - Exonic
1114639978 14:24213184-24213206 GAGTGGGGGAGGACGGCGGACGG + Intronic
1114669289 14:24400176-24400198 GAGTCTGGGAGGAGGGCTATGGG + Intronic
1116115525 14:40645120-40645142 GAGAGGGTGAGGAGTGGTCTTGG - Intergenic
1116718255 14:48455848-48455870 GGGTGGGTGTAGAGGGCTATTGG + Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1118696962 14:68394890-68394912 GCGGGGGTGAGGGGGGCTGGAGG - Intronic
1119105606 14:71920436-71920458 GAGCTGGTGAGGAGGGCTGATGG + Intergenic
1120075074 14:80146879-80146901 GTTTGTGTGAGGAGGGGTGTAGG + Intergenic
1121281680 14:92703537-92703559 GAGAAGGTGAGGAAGGCTGGAGG + Intergenic
1121371949 14:93367030-93367052 GAGCAGGAGATGAGGGCTGTGGG - Intronic
1121469206 14:94138882-94138904 GTGGGGGTGAGCAGGGCTGACGG + Intergenic
1122637085 14:103135160-103135182 GAGCTGGTGAGTAGGGGTGTGGG + Intronic
1122819618 14:104334951-104334973 GGGTGTGTGCGGAGGGCTGTGGG - Intergenic
1122855238 14:104556882-104556904 GGGTGGGTGAGGGGGCCTGGGGG - Intronic
1122936078 14:104956899-104956921 GGGTGGGTGCTGTGGGCTGTAGG - Intronic
1123012919 14:105357904-105357926 GGTGGGGTGAGGCGGGCTGTTGG + Intronic
1124066107 15:26345631-26345653 GAGTGACTGAAGAGGGATGTGGG + Intergenic
1125474922 15:40040527-40040549 GTGGGGGTGAGGAGGGCTTGTGG + Intergenic
1125848220 15:42878593-42878615 GAGTGGGGGAGGAGAGCAGCTGG - Exonic
1127322754 15:57863563-57863585 GAGTGGGTGAGAAGGGAAATGGG - Intergenic
1127553741 15:60066713-60066735 GAGGGAGTTAGGAGGGCTTTGGG + Intergenic
1128475369 15:67992794-67992816 ATTTGGGTGAGGAGGGCTGAAGG - Intergenic
1128501571 15:68230367-68230389 AGGTGGGTCAGGAAGGCTGTTGG + Intronic
1128550810 15:68596861-68596883 GAGTGGCTGGGGTGGCCTGTGGG - Intronic
1129458261 15:75687242-75687264 GAGGTGGTGAGCAGGGGTGTGGG - Intronic
1129936096 15:79451434-79451456 GCGTGGGTGAGCAGGACTGCGGG + Intronic
1130137611 15:81195232-81195254 TAGTGGAGGAGGGGGGCTGTGGG + Intronic
1130141095 15:81227082-81227104 GAGGGGTGTAGGAGGGCTGTGGG + Intronic
1130200933 15:81826253-81826275 GAGTGGGTGAGGTGGGGTGGGGG + Intergenic
1130461775 15:84164622-84164644 GAGGGGGAGAGGAGGCCCGTGGG - Intergenic
1130844729 15:87734143-87734165 GAGTGGATGAAGAGGGATGGAGG + Intergenic
1130927144 15:88394186-88394208 GAGGAGGGGAGGAGGGATGTTGG + Intergenic
1131091745 15:89629142-89629164 GAGAGGGTGGTGAGGGCTGCAGG + Intronic
1132594745 16:743598-743620 GTGAGAGTGAGGAGGGCTGTTGG + Intronic
1132684634 16:1157196-1157218 GAGCGAGGGAGGCGGGCTGTGGG + Intronic
1132729210 16:1352305-1352327 TGGTGAGTGAGGAGCGCTGTTGG + Exonic
1132744633 16:1431579-1431601 GAGGGAGGGAGGAGGGCTTTGGG - Intergenic
1132768137 16:1545348-1545370 GAGGGGGAGAGGTGGCCTGTGGG - Intronic
1132797049 16:1729739-1729761 GCGTGGCTGAGCAGGGATGTGGG + Intronic
1132839283 16:1971015-1971037 GAGTGGGTGCAGAGGGCAGAGGG - Intergenic
1132851055 16:2025259-2025281 GAGTCTGTGAAGATGGCTGTGGG - Intergenic
1132886580 16:2184883-2184905 GGGTGGGGGACAAGGGCTGTCGG + Intronic
1132939619 16:2500352-2500374 GAGTGGCTGAGTGGGGCGGTGGG - Exonic
1133341144 16:5037025-5037047 TGGTGGGAGAGGAGGGCCGTGGG + Intronic
1133755753 16:8761300-8761322 GAGGGGGTGAGAAGGGAGGTGGG - Intronic
1135147128 16:19972348-19972370 TCGGGGGTGAGGAAGGCTGTTGG - Intergenic
1136004369 16:27318640-27318662 GAAGAGGTGAGGAGGCCTGTGGG - Intronic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1136073929 16:27805169-27805191 GGGGGTGGGAGGAGGGCTGTGGG + Intronic
1136613264 16:31380060-31380082 GTGCTGGTGAGGAGGGCTCTGGG + Exonic
1137581181 16:49634522-49634544 GAGGGGGTGAGGAGGGCAGAGGG - Intronic
1137602557 16:49766481-49766503 GCGTGGGTGAGGATGTCTGAAGG - Intronic
1138197207 16:55060485-55060507 GAGTGGGTGAGGCAGGCAGCAGG - Intergenic
1138288511 16:55828306-55828328 GAGTGGGCCAGGAGGTGTGTGGG - Intronic
1138299844 16:55916829-55916851 GAGTGGAAGAGAAGGCCTGTTGG - Intronic
1138414145 16:56861604-56861626 AAGTGGGTAGGGAGGCCTGTGGG + Intergenic
1139648685 16:68350737-68350759 GAGTGGGTGCCCAGGGCTGGGGG - Intronic
1139709308 16:68763627-68763649 AAGTGGGGGAGGAGGGCCGAGGG - Intronic
1140893863 16:79308125-79308147 GATTGGGTCAGCAGGGCTGTGGG - Intergenic
1141343103 16:83221641-83221663 GAGTGGGGGAGGAAGACGGTGGG + Intronic
1141612865 16:85192968-85192990 GACTAGGGCAGGAGGGCTGTTGG + Intergenic
1141651794 16:85396752-85396774 GAGTGGGTGAGGGTGGCGGCAGG + Intergenic
1141895894 16:86958671-86958693 GAGTTGGTGAGGAGGGGAGGTGG - Intergenic
1141953770 16:87356333-87356355 CAGTCAGTGAGGAGAGCTGTGGG - Intronic
1142215683 16:88828734-88828756 AGGTGGGTGGGGAGGTCTGTGGG + Intronic
1142359968 16:89621307-89621329 GGCAGGGTGAGGAGGGATGTGGG + Intronic
1142409813 16:89910299-89910321 CAGTGGCCGAGGATGGCTGTGGG + Intronic
1142759536 17:2034773-2034795 GAGTGGGGGAGGAGGGGAGGGGG - Intronic
1142875758 17:2851434-2851456 GTGTGGGTGTGATGGGCTGTGGG + Intronic
1142894275 17:2964157-2964179 GAGAGGTTGAGGGAGGCTGTGGG + Intronic
1143020938 17:3916939-3916961 CAGTGGGAGAGGAGAGCTGGGGG - Intergenic
1143023946 17:3930151-3930173 GAGTGGGGGCTGAGGGCTGGGGG - Intronic
1143023977 17:3930243-3930265 GAGTGGGGGCTGAGGGCTGGGGG - Intronic
1143026328 17:3943906-3943928 GAGTGGGAGAGGTGGCCTGAGGG - Intronic
1143400578 17:6639949-6639971 GTGTGGGTGAACGGGGCTGTGGG - Intronic
1143445398 17:7006215-7006237 GAGGAGGTGAGGGGAGCTGTGGG + Intronic
1144447828 17:15347429-15347451 GAGTGGAAGGGGAGGGCTGATGG + Intergenic
1144447851 17:15347514-15347536 GAGTGGAAGGGGAGGGCTGATGG + Intergenic
1144447863 17:15347557-15347579 GAGTGGAAGGGGAGGGCTGATGG + Intergenic
1145988034 17:29060708-29060730 GAGTGAGGGAGGATGGGTGTGGG + Intergenic
1146466631 17:33091323-33091345 GGGTGAGTGTGGAGGGCTGTTGG + Intronic
1147042247 17:37727888-37727910 GAGTGGGTGTGGAGGGATTCGGG + Intronic
1147375752 17:40021688-40021710 GGGAGGGGCAGGAGGGCTGTGGG + Intronic
1147419326 17:40314362-40314384 GAGAGGGTGAGAGGGGCTGTGGG + Intronic
1147923467 17:43932724-43932746 GAGGTGGGGAGGAGGGCTATGGG + Intergenic
1148505158 17:48121428-48121450 CAGTCTGTGAGGAGGGCTGTGGG + Exonic
1148784369 17:50138438-50138460 GTCTGGGTGAGGGGGTCTGTGGG + Intronic
1148890744 17:50805556-50805578 GAGGAGGTGAGGAGGGTTGCTGG + Intergenic
1149436815 17:56640221-56640243 GAGTAGATGAGGAGGGGTGCTGG + Intergenic
1150221834 17:63500030-63500052 TAGAGGGTGGGGAGGGCTGTGGG - Intronic
1150228718 17:63538335-63538357 GAGAGGGTGGTGAGGGCTCTGGG - Intronic
1150326330 17:64261671-64261693 GAGAGGATGTGGAGGGCTCTGGG - Intronic
1150569957 17:66376770-66376792 GAGGGGGTGAGGATGGGTGGGGG + Intronic
1150621854 17:66813573-66813595 GAGTGGGTGAGAAGTGCTTTTGG + Intergenic
1151215578 17:72574639-72574661 GAGTGGTGGAGGAGAGATGTTGG - Intergenic
1151969395 17:77450111-77450133 GTGAGGGTGGGGAGGGCCGTGGG + Intronic
1151985607 17:77541307-77541329 GAGTGGGTGAGCTGAGGTGTGGG - Intergenic
1152192483 17:78897107-78897129 GAGGGGGTGAGGAGGCCGGCGGG - Intronic
1152293438 17:79453616-79453638 GAGTGGGTGCGGAGATGTGTGGG + Intronic
1152461523 17:80444650-80444672 GAGGGAGTGGGGAGGGCTGCAGG + Intergenic
1152626775 17:81391294-81391316 GGGTGGGAGAGGAGTGCTGGAGG + Intergenic
1152691977 17:81722452-81722474 GGGTGGGAGAGGAGGCCAGTGGG + Intergenic
1152756358 17:82088687-82088709 GGGTGGGTGAGCGGGGCTGCGGG - Intronic
1152851624 17:82639874-82639896 GTGTGGGTCGGGAGGGCTGCTGG + Intronic
1152889743 17:82873714-82873736 GTCTGGGTGTGGAGGGCTGGGGG + Intronic
1152911883 17:83009935-83009957 CTGTGGGGGAGGGGGGCTGTGGG + Intronic
1154355298 18:13619942-13619964 GGGTGGGAGTGGAGGGCAGTGGG - Intronic
1154412840 18:14150610-14150632 GAATGGGTGGGGATGGCTTTGGG + Intergenic
1155017910 18:21863641-21863663 GAGTGGGCAGGGTGGGCTGTGGG + Intronic
1155243423 18:23884887-23884909 GAGGGGGCGGGGAGGGCTGTGGG + Intronic
1156452306 18:37273861-37273883 GTGTGGGTGTGTAGGGCTTTAGG + Intronic
1157300318 18:46474372-46474394 CAGGGGGTGGGGAGGCCTGTGGG + Intergenic
1157317133 18:46601556-46601578 GTGTGGAGGAGGAGGGCTTTGGG - Intronic
1157385851 18:47259760-47259782 GATGGGGTGAGGAGAGCTTTGGG + Intergenic
1157894948 18:51457075-51457097 GGGTGGGTGGGGAGAGCTGAGGG - Intergenic
1159602986 18:70446289-70446311 AAGAGGGTGAGAAGGGCTGAGGG - Intergenic
1159912814 18:74162379-74162401 GAATGGGTGAGGCAGGCTGCTGG + Intergenic
1160136969 18:76280567-76280589 GGGTGGGTGTGGAGGGACGTGGG - Intergenic
1160486624 18:79299280-79299302 GAGGGGGTGAGGAGCTCTCTAGG - Intronic
1160505057 18:79422451-79422473 GAGTGGGTGACGGGGGTGGTGGG + Intronic
1160790141 19:919304-919326 GACTGGGAGAGGAGGGCAGGAGG - Intronic
1161087891 19:2343546-2343568 GAGTGGTTGAATAGGGCTGGAGG + Intronic
1161358349 19:3832084-3832106 CCATGGGGGAGGAGGGCTGTGGG + Intronic
1161458277 19:4381022-4381044 GAGAGGGAGAGGAGGCCGGTGGG - Intronic
1162087852 19:8259378-8259400 GAGTGGGTGAGGGGGAGGGTAGG + Intronic
1162237708 19:9321729-9321751 GAGTGGGGGAGGAGGGTGGCAGG - Intergenic
1162666909 19:12221017-12221039 GGGTGGGAGAGGGGTGCTGTTGG + Intergenic
1163099045 19:15082423-15082445 GGGTGGGGGTGGAGGGTTGTGGG + Intergenic
1163493357 19:17630340-17630362 GAGTGGGAGAGTTGGGCTCTAGG - Intronic
1163784234 19:19266453-19266475 GGGTGGGTGAGCAGGCATGTGGG - Intronic
1164430753 19:28186728-28186750 GAGAGGCTGAGGAGGGGTGGTGG - Intergenic
1164623695 19:29713201-29713223 AAGTGGGTGAGGAGGGAGGATGG + Intronic
1165811375 19:38614026-38614048 GATTGGGTGAGTAAGGCTGGGGG - Exonic
1166343111 19:42150414-42150436 GAGGGGGTGGAGAGGGCTGGGGG + Intronic
1167148720 19:47696860-47696882 GAGTGGGTGGACATGGCTGTTGG + Intronic
1167313558 19:48751331-48751353 GGGAGGCTGAGGAGGGATGTGGG + Intronic
1167602011 19:50459842-50459864 GAGGAGGTGAGGAGGGATGAGGG + Intronic
1167694780 19:51009109-51009131 GAGAGGGTGAGGGGTGCTTTAGG - Intronic
1167777679 19:51571519-51571541 GGGTGGGTGATGGGTGCTGTGGG + Intronic
1168135317 19:54347131-54347153 ACGTGGGTGAGGAGGGCTCAAGG + Intergenic
926053261 2:9758016-9758038 GGGTGGCTGAGGCGGGCTTTCGG - Intergenic
926065787 2:9838755-9838777 GTGGGAGTGGGGAGGGCTGTGGG - Intergenic
926706280 2:15840063-15840085 TAGTGTGTGAGGAGGGGTGAAGG - Intergenic
927178148 2:20424722-20424744 GAGTGGGTGAGGTGCGGGGTGGG - Intergenic
927214241 2:20657775-20657797 GAGAGGGTAAGCAGGGCTGCAGG + Intergenic
927309907 2:21618264-21618286 GGGTGGGTGAGGGGTGGTGTTGG + Intergenic
928139678 2:28717757-28717779 GTTTGGATGAGGAGGGATGTAGG + Intergenic
928277190 2:29913561-29913583 GTGTGGGTGAGGATGGTTGTAGG - Intronic
929449702 2:42028468-42028490 GAGCTGGTGAGCAGGGCTGTGGG - Intergenic
929493994 2:42423451-42423473 GAGTGTGTGAGGAGTGCTGTTGG - Intronic
930130963 2:47850148-47850170 GAGTGGGTATGGTGGGCTGGGGG + Intronic
930388493 2:50729663-50729685 GAGAGGGTGAAGAGTGCTGATGG - Intronic
931083692 2:58804773-58804795 GAGTGGGTTAGGTGGGGTGTTGG + Intergenic
931228169 2:60351792-60351814 AAGCAGGTGAGGAGGGCAGTCGG - Intergenic
932771061 2:74501112-74501134 GGGTGGGGGAGGGGGGTTGTTGG - Intronic
932827986 2:74958920-74958942 GAGTGGGGGAGGTGGAGTGTGGG + Intronic
933652577 2:84861183-84861205 GAGCAGGTGAGGGGTGCTGTTGG + Intronic
933856706 2:86421094-86421116 GAGTAAGTGAGGTGGGGTGTGGG - Intergenic
933979617 2:87539359-87539381 GACTGGCCGAGGAGAGCTGTAGG + Intergenic
934536693 2:95140128-95140150 CAGTGGGTGAGGGGAGCTGAGGG + Intronic
935327363 2:101948949-101948971 GAGTGGGTGGGAAGGGCATTGGG - Intergenic
935432489 2:102991023-102991045 GACTGGGAGTTGAGGGCTGTGGG + Intergenic
936093004 2:109512816-109512838 GAGGGGGTGAGGAGGGGTCAGGG - Intergenic
936314203 2:111411432-111411454 GACTGGCCGAGGAGAGCTGTAGG - Intergenic
936315712 2:111422558-111422580 GAGTTGGTGGCGAGGGCTGGAGG + Intergenic
937314311 2:120921340-120921362 AAGTGGGTTAGAAGGGCCGTTGG + Intronic
938310171 2:130284397-130284419 GGGTGAGTGAGGTGGGCTCTGGG + Intergenic
938397724 2:130963482-130963504 GCGGTGGTGAGGAGGGCTGGTGG - Intronic
938444751 2:131367972-131367994 GGGTGAGTGAGGTGGGCTCTGGG - Intergenic
939525722 2:143291393-143291415 GAGTGAGTGAGGAGGGAGGGAGG - Intronic
941410257 2:165146963-165146985 AGGTGGGTTAGGAGAGCTGTTGG - Exonic
941447301 2:165617915-165617937 GAGTGGATGTGGAGAGATGTTGG + Intronic
942075307 2:172351968-172351990 GAGTGTGTGAGCAGGGGTGGGGG - Intergenic
942191200 2:173472222-173472244 GACTGGGTGATGCTGGCTGTTGG + Intergenic
942192282 2:173482132-173482154 GAATGGCTGAGGTGGGCTGGAGG + Intergenic
942236561 2:173914306-173914328 GATTGGGGGAGGAGGGGAGTTGG - Intronic
942301095 2:174563330-174563352 GAGAGGTTGAGGAGGGATGATGG + Intronic
942674581 2:178413636-178413658 GAGAGGATGGGGAGGGGTGTGGG - Intergenic
942716167 2:178895008-178895030 GAGTAGGTGAGGAGGGCCAGGGG - Intronic
943769916 2:191705223-191705245 GAGTGGGAGAGGAAGGTGGTGGG + Intergenic
945709048 2:213273327-213273349 GAAAGGGTGAGGAGGGATATTGG + Intergenic
946028342 2:216686105-216686127 GACTGGATGATGAGGGCTATAGG + Intronic
946199875 2:218065249-218065271 GAGTAGGAGAGGAGGGGTGGGGG + Intronic
946385917 2:219384470-219384492 GAGTGGGGGTGGAGGGTTGAAGG - Intronic
946407931 2:219502040-219502062 GAGGGGGTCAGGAGGGCTGGAGG + Intronic
947573116 2:231250765-231250787 GAGTGTGGAAGGAGGGCTGGAGG + Intronic
947860039 2:233352322-233352344 GAGCGGGTGACGAGGGATTTTGG - Intergenic
949041621 2:241852314-241852336 GAGGGGCTGGGGTGGGCTGTGGG + Exonic
949059486 2:241948875-241948897 AGGTGGGTGAGCAGGGCTGCGGG + Intergenic
1168856701 20:1013787-1013809 GAGTGGATGAGGATGGGAGTTGG + Intergenic
1168984818 20:2039057-2039079 GAGTGGTTTAGGAGGGATGGAGG - Intergenic
1169066163 20:2695213-2695235 GAGTGGGTGAGGAGTGCTGATGG + Intronic
1169698864 20:8424144-8424166 TGGTGGGGGAGGAGGGGTGTGGG - Intronic
1169723163 20:8700876-8700898 CAGTGGGTGAGGATGGATGTGGG + Intronic
1170438346 20:16352732-16352754 GAGCGGGTGAGGAGGGCGAGGGG + Intronic
1170513334 20:17102072-17102094 GGGAGGGTGAGGCGGGCAGTTGG + Intergenic
1170900483 20:20457772-20457794 GAGAGGGTGATAAAGGCTGTGGG + Intronic
1171227390 20:23452923-23452945 GAGGAGGAGAGGAGAGCTGTGGG - Intergenic
1171869373 20:30513383-30513405 GTGTGGGGGAGGAGGGGTGGCGG - Intergenic
1171884229 20:30640167-30640189 TAGGGGGTGAGGAGGGTTGGGGG - Intergenic
1172273947 20:33669780-33669802 GAGTTGGTGGGGTGGGATGTGGG - Intronic
1172831960 20:37843455-37843477 GAGTGAGAGACTAGGGCTGTGGG + Intronic
1173422916 20:42918552-42918574 GCGTGGGTGAGGAGAGCAGGTGG - Intronic
1173586562 20:44187168-44187190 CAGTGGGTGTGCGGGGCTGTCGG + Exonic
1173803513 20:45909889-45909911 GAGTGGGTCAGGAGGGCTGGAGG - Intronic
1174162631 20:48562599-48562621 GAGCCAGTGAGAAGGGCTGTTGG - Intergenic
1174414662 20:50358854-50358876 GGGTGGGTGCAGAGGGCTGGTGG - Intergenic
1174526390 20:51175317-51175339 TTGTGGGTGATGAGGGCTGCAGG + Intergenic
1174698460 20:52583706-52583728 GAGTGGGTGGTGATGGCTGGAGG + Intergenic
1175852377 20:62100440-62100462 GAGTGAGCGGGGAGGGCAGTCGG - Intergenic
1175895137 20:62332764-62332786 GAGTGGGAGGGGAGGGAGGTGGG - Intronic
1176119989 20:63450074-63450096 GAGGGGGTGAGGCGGGGTGAGGG - Intronic
1176188498 20:63795014-63795036 GAGTGGGTGCTGCGGGCTGCAGG + Intronic
1176270476 20:64233365-64233387 GAGTGGGGGAGGTGGGGGGTGGG - Intronic
1176304476 21:5115965-5115987 CAGTGGGTGGGGAGGGCCGAGGG + Intergenic
1176715612 21:10346862-10346884 GAGTGGGTGGGGAGGGCAAGAGG - Intergenic
1176860168 21:14007645-14007667 GAATGGGTGGGGATGGCTTTGGG - Intergenic
1178292369 21:31379857-31379879 GATTGGGTGAGAAGAGCTGGAGG + Intronic
1178675299 21:34626302-34626324 GAGTGGGCGAGCAGGTCAGTTGG - Intergenic
1178769239 21:35487249-35487271 GAGTGGGTAGGGAGGGCAGAAGG + Intronic
1179025288 21:37674495-37674517 CAGTGGGTGAGGAGGGGAGTGGG - Intronic
1179177784 21:39021508-39021530 GGGTGGGTGGGCAGGGCTGGTGG + Intergenic
1179374561 21:40838358-40838380 CAGGGGCTGAGGGGGGCTGTTGG - Intronic
1179516767 21:41913935-41913957 AAGTGGGTGAAGGGGGATGTAGG - Intronic
1179577724 21:42318232-42318254 GGGTGGCTGGGGAAGGCTGTGGG - Intergenic
1179852580 21:44146065-44146087 CAGTGGGTGGGGAGGGCCGAGGG - Intergenic
1179953799 21:44726946-44726968 AGGTGGGTCATGAGGGCTGTTGG - Intergenic
1180041806 21:45283927-45283949 GAGGGGGTGAGGAGCGCTGTGGG - Intronic
1180048888 21:45322343-45322365 TAGCGGGCAAGGAGGGCTGTTGG + Intergenic
1180081611 21:45490038-45490060 GAGTGGGGGAGGAGGTGTGGGGG - Intronic
1180254908 21:46620209-46620231 GAGTGGAACAGGATGGCTGTAGG + Intergenic
1180602735 22:17033091-17033113 GAGTGGGTGGGGAGGGCCAGAGG + Intergenic
1180818432 22:18807971-18807993 AAGTGGGGGAGGGGGGCTGATGG + Intergenic
1181049360 22:20231341-20231363 GGCTGGGGCAGGAGGGCTGTGGG + Intergenic
1181204654 22:21242426-21242448 AAGTGGGGGAGGGGGGCTGATGG + Intergenic
1183314026 22:37127500-37127522 GAGTGGCTCAGGAGGACGGTAGG + Exonic
1183364446 22:37399670-37399692 GGGTGGGAGAGGTGGGCTGATGG - Intronic
1183580965 22:38726497-38726519 GAGTGGGTGAGCAGGGCATCTGG - Intronic
1184361582 22:44022374-44022396 GGGTGGGGGAGAAGTGCTGTGGG - Intronic
1184627916 22:45752488-45752510 CAGTGGGTGAGCAGGTGTGTGGG + Intronic
1184851188 22:47122170-47122192 GAGAGGGTCAGAGGGGCTGTGGG + Intronic
1185034361 22:48463843-48463865 GAGAGGGAGAGGACAGCTGTTGG - Intergenic
1203222270 22_KI270731v1_random:52989-53011 AAGTGGGGGAGGGGGGCTGATGG - Intergenic
949106885 3:210404-210426 GAGTGGCTGGGGTGGGCTGGTGG + Intronic
949119945 3:373411-373433 CAGTGGGTGTGTTGGGCTGTGGG + Intronic
949710192 3:6862724-6862746 TAGTGGGTGAGGGGGGCGGGGGG - Intronic
950340923 3:12243674-12243696 CTGGGGGTTAGGAGGGCTGTAGG + Intergenic
950553732 3:13682722-13682744 GAGTAGGAGAGGAGGGCCCTGGG + Intergenic
950967965 3:17159538-17159560 GAGTGGGTGAGGATGGCAGAGGG - Intronic
951345042 3:21537704-21537726 GAGTGAGTGAGGTGGGCAGTGGG + Intronic
951623165 3:24628970-24628992 GAGTGGTTGGGGAAGGCTGAGGG - Intergenic
951746071 3:25978766-25978788 GCCTGGGAGAGGTGGGCTGTTGG - Intergenic
952231123 3:31432150-31432172 GAGTGGGAGGGGAGTGCAGTGGG - Intergenic
952337943 3:32421054-32421076 GGGTGGGAGAGGAGGGCAGCAGG - Intronic
953357351 3:42266218-42266240 GAGTGGGCGAGGCGGGGTGGGGG + Intergenic
953358258 3:42272646-42272668 AAGGGAGTGAAGAGGGCTGTGGG + Intergenic
953744797 3:45566203-45566225 GAGAGAGGAAGGAGGGCTGTGGG - Intronic
954146478 3:48636786-48636808 GAGTGGCTGTGCAGGGCTGGGGG - Exonic
954554262 3:51505816-51505838 TAGTGGGTGAGGAGGGTTATTGG + Intergenic
955898355 3:63725171-63725193 GAGGGTGTGAGGAGCGGTGTTGG + Intergenic
955942263 3:64157751-64157773 GAGTGGCTGGGGAGGGAGGTGGG + Intronic
956157871 3:66317639-66317661 GAGTGGGTGTGCTGTGCTGTGGG + Intronic
956497120 3:69839891-69839913 GACTTGGGGAGGAGGGGTGTGGG - Intronic
956588055 3:70884711-70884733 GTGTTGGTGAGCAGGGCTGCAGG - Intergenic
957262801 3:77922482-77922504 GAGTGGGGGAGGAGAGCTCTGGG - Intergenic
959585742 3:108023585-108023607 GAGTGGGGCAGGAAGTCTGTAGG - Intergenic
960786027 3:121373515-121373537 GGGTGGATGTGGAGGGATGTTGG - Intronic
960961690 3:123075313-123075335 GAGTGGGTGAAGTTGGCTGGGGG + Intronic
961171738 3:124802100-124802122 TAGAGGGTGATGAGTGCTGTGGG - Intronic
961197408 3:125014512-125014534 GAGTGTGTGTGGAGGGCTGGGGG + Intronic
961441862 3:126958144-126958166 GGGTGGGGGAGGAAGGCAGTAGG - Intronic
961499882 3:127324642-127324664 GAATGGCTGTGGAGGGCTGCAGG - Intergenic
961863780 3:129938785-129938807 GAGTGAGAGAAGAGGGCTGGGGG - Intergenic
962269637 3:133968215-133968237 AAGTAGGTGAGGAGGTGTGTGGG - Intronic
963916677 3:150865112-150865134 GAGAAGGTGAGGAGAGCAGTCGG + Intergenic
964496221 3:157293176-157293198 GAGTGGGTGGAGAGGGAGGTAGG + Intronic
965263331 3:166510804-166510826 CAGTGGGTGTGTTGGGCTGTGGG - Intergenic
965521313 3:169670140-169670162 GAATGGGTGAGGGGGGCTTGAGG - Intergenic
967751354 3:193119705-193119727 TAGTGGGTGGGAAGGGCTGTTGG - Intergenic
967802416 3:193677710-193677732 CACTGGGGGAGAAGGGCTGTGGG - Intronic
967873742 3:194252264-194252286 GATTGGGGGTGGAGGGCTGGGGG + Intergenic
968514519 4:1010629-1010651 GAGGGTGTGAGGCGGGATGTGGG + Intronic
968589814 4:1451750-1451772 GAGTGTGTGAGCTGGCCTGTTGG + Intergenic
968909292 4:3469419-3469441 GGGTGGGTGGGCAGGGCTGATGG + Intronic
968909310 4:3469480-3469502 GGGTGGGTGAGCAGGGCCGATGG + Intronic
968954182 4:3709872-3709894 GAGTAGGTGAGGGGAGCTGCAGG + Intergenic
969142885 4:5095112-5095134 GACTGGGAGGAGAGGGCTGTAGG + Intronic
969311038 4:6353403-6353425 CTGTCGGTGTGGAGGGCTGTCGG - Intronic
969492542 4:7508218-7508240 AAGGGGGTGAGGAGGGATGAAGG + Intronic
969692171 4:8709788-8709810 GTGTGGAAGGGGAGGGCTGTGGG - Intergenic
970011851 4:11468141-11468163 GAGTTGGTGAGGTGGGGTGCGGG - Intergenic
970596709 4:17606780-17606802 GAGTGGATGAGGCAGGTTGTGGG - Intronic
971189789 4:24416478-24416500 GAATGGGAGAGAAGGGCTGAGGG + Intergenic
971767732 4:30854788-30854810 AAGTGGAAGAGGAGGGTTGTGGG + Intronic
972265194 4:37453315-37453337 GAGTGGGTGAGGAGGGGACGGGG + Intergenic
972466879 4:39366133-39366155 GGGTGGGGGAGGATGGCGGTGGG - Intronic
972557218 4:40193522-40193544 GGGTGGGGGAGGAGGGGAGTGGG + Intronic
974857041 4:67473782-67473804 GAGAGGCTGAGGAGGGCTTGAGG - Intronic
975656133 4:76642800-76642822 GGGTGGGGGAGGAGGGTAGTGGG + Intronic
975692678 4:76981303-76981325 GAGGGGGTGGAGAGGACTGTGGG + Intronic
975800716 4:78057260-78057282 GCCTGGGTGAGGAGGGCTGCGGG - Intergenic
976738456 4:88334269-88334291 AAGTGGATGAGGAGGGATGAGGG - Intergenic
977800884 4:101229759-101229781 GAGAGGGTGAAAAGGGCAGTAGG + Intronic
978203126 4:106046586-106046608 GGGATGGTGAGGAGGCCTGTTGG + Exonic
979649005 4:123107733-123107755 GGGAGGCTGAGGAGGGCTGAGGG - Intronic
980126703 4:128781371-128781393 GAGAGGCTGAGGAGGGCTGATGG + Intergenic
982209078 4:153020485-153020507 GAGTGGGGAAGGAGGGGAGTGGG - Intergenic
984432226 4:179664223-179664245 GAGTGAGTGAGGACGAATGTGGG - Intergenic
984501690 4:180566027-180566049 GAGTGGGTGAGGGTGAGTGTGGG + Intergenic
984784278 4:183553763-183553785 GACTGGGTGAGGGTGGGTGTGGG + Intergenic
985511537 5:316779-316801 CAGAGGGTGAGGAGGGCGGTGGG + Intronic
985516001 5:344908-344930 AGGTGTGTGTGGAGGGCTGTGGG + Intronic
986470357 5:8067681-8067703 GAGTGGGAAAGGAAGGCTGGAGG + Intergenic
986781084 5:11066437-11066459 GAGGGAGTGAGGGGGGCTGTAGG - Intronic
987114124 5:14713190-14713212 GGGAGGGTGGGAAGGGCTGTGGG - Intronic
988798435 5:34673958-34673980 GAGTGGGTGGGGAGGGTAGGAGG + Intronic
988835804 5:35031145-35031167 GTGTGGATGAGGATGGCTATAGG + Intronic
988912018 5:35852740-35852762 AAGCAGGTGAGGATGGCTGTAGG - Intronic
989325493 5:40188314-40188336 GAGTTGGTCAGGAGGCGTGTTGG - Intergenic
991518153 5:67463156-67463178 GAGTGGTTTATGAGGGCAGTGGG - Intergenic
992549066 5:77844511-77844533 GAGCGGCTGATTAGGGCTGTTGG + Intronic
994087316 5:95773445-95773467 GAGTTGGGGAGGGGAGCTGTAGG + Intronic
995039417 5:107571137-107571159 GAGTGGGGGAAGAGGGCTTAGGG + Intronic
995207931 5:109503845-109503867 GACTGTCTGAGGAGGGATGTGGG + Intergenic
995597067 5:113759088-113759110 GAGTGAGTGAGGAGGCATGAGGG + Intergenic
996573386 5:124957278-124957300 GAGCTGGTGAGAAGGTCTGTGGG + Intergenic
996762922 5:127003976-127003998 GAGTGGCTGAGGGAGGCTGGGGG + Intronic
997737955 5:136228283-136228305 GAGTGGGTGGGGTGGGGGGTAGG + Intronic
998265051 5:140661731-140661753 CAGGGTGTGAGGAGGGGTGTGGG + Intronic
999143540 5:149378310-149378332 GTGTGTGTGAGGAGGGCTTGGGG - Intronic
999246756 5:150159076-150159098 CAGTGGGAGAGGGGGGCTCTGGG + Intergenic
999263066 5:150249434-150249456 GAGTGGCTGGGGAGAGCTTTTGG - Intronic
999432321 5:151535213-151535235 GAGTGTGTAACAAGGGCTGTGGG - Intronic
999452866 5:151691506-151691528 GAGTGGTTGGAGAGGGCAGTGGG - Intergenic
999532828 5:152480833-152480855 GAGAGGGAGAGGAAGACTGTGGG + Intergenic
999851194 5:155541494-155541516 GAGGGGGTGAGGTGGGCTATGGG - Intergenic
1001238999 5:170053912-170053934 GAGGGTGTGAGGTGGGCTGGGGG + Intronic
1001626754 5:173142720-173142742 GAGGGTGTGTAGAGGGCTGTAGG + Intergenic
1001701371 5:173708945-173708967 GAGTGGGTGAGGATGGAGGCCGG - Intergenic
1002063041 5:176637730-176637752 GGGAGGGAGAGGAGGGCTGGAGG + Intronic
1002406989 5:179042453-179042475 GGGAGGGTGAGGAGGGAAGTAGG + Intergenic
1002791611 6:441488-441510 GTGTGGGAATGGAGGGCTGTGGG - Intergenic
1003003852 6:2362319-2362341 AGGTGGGTGGGGAGGGCTTTGGG - Intergenic
1003110606 6:3249463-3249485 AAATGGGTGAGCAGTGCTGTAGG - Intronic
1003327552 6:5104154-5104176 GATTGGAAGAGGAGGGCTGGTGG - Intronic
1004675721 6:17840057-17840079 CAGTGGTTGACTAGGGCTGTGGG + Intronic
1006112939 6:31759759-31759781 GAGTGGGTGAGGAAGGGAGCTGG - Intronic
1006116708 6:31779550-31779572 GAGGGGGTGAGGGGGCCTGGAGG + Intronic
1006162859 6:32048208-32048230 GAGTGGGAGAGGAGAGCTCAGGG + Intronic
1006211522 6:32399899-32399921 AGGTGGGAGAGGAGGGCTCTGGG - Intronic
1007345119 6:41223318-41223340 GAGGGAGTGAGGAAGGCAGTGGG - Intergenic
1007412879 6:41674946-41674968 GTGTGGGTGAGGAGGGCTAGAGG + Intergenic
1007733438 6:43965712-43965734 GGCTGGATGAGGAGGGGTGTGGG - Intergenic
1008058096 6:46966315-46966337 TAGTGGGTGTGAAGGGCTGGGGG - Intergenic
1009864933 6:69385751-69385773 AAGTTGGTGATGAGAGCTGTAGG - Intronic
1010643943 6:78364632-78364654 TAGGGGGTGAGGTGGGCTGTAGG - Intergenic
1010952448 6:82053691-82053713 GAGTGGGGCATGAGGTCTGTGGG + Intergenic
1011704126 6:89984182-89984204 GAATGGATGTGGAGGGCAGTGGG - Intronic
1012370411 6:98498663-98498685 GTGGGAGTGAGGAGGGCAGTAGG + Intergenic
1012967941 6:105695774-105695796 GGGTGGGTGGGGTGGGCTGCTGG - Intergenic
1014713145 6:124832801-124832823 GAGTGTGTGAGGTGGGTTGAAGG - Intergenic
1014724769 6:124961975-124961997 GGGGCGGCGAGGAGGGCTGTAGG + Intergenic
1015364460 6:132381910-132381932 GAGTGGGTGAGGATGTCATTTGG - Intronic
1016567346 6:145471544-145471566 GAGTGGGGAAGGAGTGGTGTTGG - Intergenic
1017828069 6:158097403-158097425 GAATAGGTGAGAAGTGCTGTTGG - Exonic
1018027234 6:159816117-159816139 GGGTGGGTGGGGAGGGGTGTGGG - Intronic
1018301012 6:162403218-162403240 GAGTGAGTGAGGAGAGCTGGAGG - Intronic
1018702681 6:166439651-166439673 ATGTGGGTGAGGGGGGCTGCTGG + Intronic
1018722973 6:166587905-166587927 GAGTGAGTGAGGAGGGCGCAGGG - Intronic
1018906340 6:168078535-168078557 GTGGGGGTGAGCAGGGCCGTGGG - Intronic
1018906365 6:168078625-168078647 GTGGGGGTGAGCAAGGCTGTGGG - Intronic
1019314271 7:377306-377328 GAGTGGGTGGGGCTGCCTGTTGG - Intergenic
1019332956 7:469960-469982 GGGTGGGTGAAGAGGGAGGTGGG - Intergenic
1019409486 7:900369-900391 GAGTGAGGCAGGAGGGCTGCAGG + Intronic
1019488165 7:1298945-1298967 CAGGGGGAGAGGGGGGCTGTGGG + Intergenic
1019498641 7:1353126-1353148 CAGTGGGTGGGGAAGGCGGTGGG - Intergenic
1019577535 7:1744605-1744627 GCGTGGGTGGGGCGCGCTGTGGG + Exonic
1019591638 7:1838668-1838690 GACTGGGAGAGGATGGCTATGGG + Exonic
1019643935 7:2119209-2119231 GAGAGGGAGAGGAGGGCACTGGG - Intronic
1019982246 7:4630155-4630177 GAGTGGGTGGGCAAGGCTGATGG - Intergenic
1020959228 7:14781479-14781501 TAGCAGGTGAGGAGAGCTGTGGG - Intronic
1021717259 7:23471129-23471151 GAGTGGGTGAGGGGGGCAGGGGG + Intergenic
1022741268 7:33123617-33123639 GAGTGTGGGAGGAGTGGTGTTGG + Intergenic
1023378357 7:39580742-39580764 GGGTGGATGAGGAGGGCTTTTGG + Intronic
1023665044 7:42514155-42514177 GAGTGGGTAAGGGGTGCTTTGGG + Intergenic
1023746954 7:43330699-43330721 GAGTTGGTGAGAAAGACTGTAGG + Intronic
1024030092 7:45453650-45453672 GAGGGGGTGAGGAGGGATGGAGG + Intergenic
1025002742 7:55331123-55331145 GAGTGGGAGGGGAGGGAAGTTGG - Intergenic
1025019102 7:55466858-55466880 GCATGGGTGAGGTGGGCTGTTGG - Intronic
1025709024 7:63890868-63890890 GAGAGGAGGAGGAGGGCTGAAGG + Intergenic
1026583810 7:71639515-71639537 GATTGCACGAGGAGGGCTGTGGG + Intronic
1026944652 7:74307823-74307845 GGGTGGTTCAGGAGGGCTGGAGG + Intronic
1027297546 7:76793249-76793271 GAGGGGTGGAGGAGGGCTGAAGG - Intergenic
1028297890 7:89158372-89158394 GAATGGGTGTGGAGGGCTAAGGG - Intronic
1028480125 7:91295121-91295143 GAGAGGGTGGGGAGGGAGGTGGG + Intergenic
1029413812 7:100430874-100430896 AAGGGGGTGAGAGGGGCTGTGGG - Exonic
1030331866 7:108279625-108279647 GGGTGGGTGGGGAGGGCAGGGGG - Intronic
1030496569 7:110308018-110308040 GAGTGTGTGAGGAGGGAGGCTGG + Intergenic
1031491692 7:122397449-122397471 GAGAGGGAGAGGAGGGGTGGGGG + Intronic
1031980474 7:128121385-128121407 GGGTGGGTGATGAGGGCTCTGGG + Intergenic
1032234618 7:130109325-130109347 GGGTGGCTGAGGTGGGCTGGAGG - Intronic
1032429171 7:131847010-131847032 GTGTGGGTGGGGAGGCGTGTTGG + Intergenic
1033597416 7:142867374-142867396 GTGTGGATGTGGAGGGCTGTGGG + Intronic
1034117480 7:148596807-148596829 GAGTGGGGGAGGAAGGGAGTGGG - Intronic
1034355163 7:150445440-150445462 GAGTGGGTGGGGAGGGGAGAGGG + Intergenic
1034457612 7:151179733-151179755 GAGAGGTGGAGCAGGGCTGTGGG + Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035752649 8:2007408-2007430 GAGTAGCTGAGGAGGGCTTGGGG + Intergenic
1036692403 8:10952088-10952110 GAGAGGGGCAGGAGGGCTGCAGG - Intronic
1036940854 8:13050288-13050310 GAGTGGGTGATAAGGGTGGTGGG + Intergenic
1036989939 8:13580894-13580916 GAGGGGGTGAGGATGGGTGAGGG + Intergenic
1037433174 8:18835697-18835719 AAGTGGGAGAGCAGGGCTCTGGG + Intronic
1037750941 8:21682023-21682045 GAGTGGGTGGAGAGGGCAGCTGG + Intergenic
1037825838 8:22160101-22160123 AAGGGGGTGAGGAGGGTGGTGGG + Intronic
1038148816 8:24923799-24923821 GGGTGGGTGAGGTGGGTAGTGGG + Intergenic
1038668760 8:29564365-29564387 GAGTGAGTGAGGCCAGCTGTGGG - Intergenic
1038674636 8:29612676-29612698 GACAGCGTGAGGAGAGCTGTAGG - Intergenic
1039792079 8:40884175-40884197 GGGTGGGTGAGGCGGGGTGGGGG - Intronic
1041031450 8:53739925-53739947 GAGTGGGTGAGGAGCGGTGGAGG - Intronic
1041090413 8:54296729-54296751 GAGAGGGCGAGCAGGGCTGATGG + Intergenic
1041908138 8:63055844-63055866 GCCTGGGTGTGGAGGGCTGTGGG + Intronic
1042795885 8:72662753-72662775 GAGTGGGACAGGAGGGCTAATGG + Intronic
1043147776 8:76678254-76678276 GCCAGCGTGAGGAGGGCTGTTGG - Intergenic
1043826006 8:84929306-84929328 CAGTGGGTGTGTTGGGCTGTAGG - Intergenic
1043917155 8:85936319-85936341 GAGTGGCTGAGGAAGGATGGAGG + Intergenic
1044809833 8:96048386-96048408 ATGTTGGAGAGGAGGGCTGTGGG + Intergenic
1044866454 8:96575603-96575625 GGGTTGGTGAGGATGGCAGTAGG + Intronic
1047230856 8:122996639-122996661 ATGTGTGTGTGGAGGGCTGTGGG - Intergenic
1048209678 8:132444268-132444290 GGCTGGGTGAGGAGGGCAGGAGG - Intronic
1049222371 8:141433935-141433957 GGGTGGGGGAGGATGGCTGGAGG + Intergenic
1049298060 8:141854493-141854515 GTGTGGGGGGGGGGGGCTGTGGG - Intergenic
1049358279 8:142199438-142199460 GTGGGGGTGAGTTGGGCTGTGGG - Intergenic
1049479860 8:142816761-142816783 GAGTGGGAGGCGAGAGCTGTGGG - Intergenic
1049569995 8:143365124-143365146 GAGTGGAAGAGGTGGGCTTTGGG - Intergenic
1049688514 8:143948849-143948871 GAGTGGGTGGGCAGGGGTGCCGG + Intronic
1049707405 8:144049259-144049281 GGGTGGCTGAGGAGGGCGGCGGG + Intergenic
1049854897 8:144855255-144855277 CAGGGGGAGAGGAGGGCAGTAGG + Intergenic
1051035595 9:12741106-12741128 GAGTGGGTGGGTATGGCTCTAGG + Intergenic
1051305752 9:15707092-15707114 GAGGAGCTGAGGATGGCTGTAGG + Intronic
1051335743 9:16064404-16064426 GAGAGGGTGAGGGAGGCTGAGGG + Intergenic
1051505984 9:17828310-17828332 AGGTGGGAAAGGAGGGCTGTAGG - Intergenic
1052043547 9:23768595-23768617 CAGTGGGTGAGGGTGGCTGATGG - Intronic
1053482550 9:38426554-38426576 GAGTGGGGGAGGACGGCTTGAGG - Intergenic
1054815974 9:69475945-69475967 ATGTGGGTCAGGAGCGCTGTAGG + Intronic
1055000997 9:71448199-71448221 GAGAGGGTGAGAAATGCTGTGGG + Intergenic
1056928526 9:90854971-90854993 GAGAGAGAGAGGCGGGCTGTAGG - Intronic
1057373748 9:94498816-94498838 GAGAGGCTGAGGTGGGCTGATGG + Intergenic
1058743754 9:107969460-107969482 GAGTAGGTGTGAAAGGCTGTGGG + Intergenic
1058842259 9:108921272-108921294 TAGTGGTTGGGTAGGGCTGTGGG - Intronic
1059491823 9:114674235-114674257 GAGTTGGTGATGAGGGTTGTGGG - Intergenic
1059623203 9:116032102-116032124 GAGGGTCTGAGGAGGGCTGGGGG - Intergenic
1059865790 9:118512630-118512652 TAGTGGGTGATGGGGGCTGCTGG - Intergenic
1060451951 9:123750964-123750986 GAGTCGGGGAGGAAGGCTGTGGG - Intronic
1060555859 9:124506929-124506951 GAGTGTGTCTGGAGGGCTCTGGG - Intronic
1060752550 9:126182884-126182906 GGCTGGGTGAGGAGTGATGTGGG + Intergenic
1060811002 9:126611532-126611554 GAGGGGGAAAGGAGAGCTGTAGG + Intergenic
1060977676 9:127774555-127774577 GAGGGGCTGAAGAGGGCTGGCGG + Intronic
1060984720 9:127813461-127813483 GGGTGGGTGAGGAGGCCCTTTGG - Exonic
1061229992 9:129310042-129310064 GAGAGGGAGATGAGGGCTGGTGG - Intergenic
1061239410 9:129360423-129360445 GAGCCTGTGTGGAGGGCTGTGGG - Intergenic
1061874214 9:133535850-133535872 GAGGGGGTGGGGAGAGCTGAGGG + Intronic
1062030223 9:134358837-134358859 ATGTGGGTGGTGAGGGCTGTGGG + Intronic
1062303109 9:135886945-135886967 GTGTGGAGGAGGAGGGCAGTCGG + Intronic
1062615329 9:137393581-137393603 CAGTGGGTGCTGAGGGCTGTGGG - Intronic
1203451669 Un_GL000219v1:122668-122690 AGGTGGGTGAGGTGGGGTGTGGG + Intergenic
1185821627 X:3210452-3210474 CAGTGTGTGAGGTGGACTGTGGG - Intergenic
1187500313 X:19833484-19833506 GGGAAGGTGAGGAGGACTGTGGG - Intronic
1188004849 X:25010215-25010237 GAGGGAGGGAGGAGGGCTGGGGG - Intronic
1189114149 X:38326657-38326679 GAGTGAGTGATCAGGGCTGTGGG - Intronic
1189290121 X:39878839-39878861 AATTTGGTGAGAAGGGCTGTTGG - Intergenic
1189492619 X:41481842-41481864 GGGTTGGTGAGGTGGGCTTTAGG - Intergenic
1190329696 X:49228234-49228256 TACTGGGTGAGGTGGACTGTGGG - Exonic
1190597365 X:52062719-52062741 GAGGGGGTGAGGCGGGCCGCGGG - Intronic
1190611459 X:52191354-52191376 GAGGGGGTGAGGCGGGCCGCGGG + Intronic
1192147790 X:68693603-68693625 GCGTCGGCGAGTAGGGCTGTAGG - Intronic
1192451013 X:71244941-71244963 GGGTGGGGCAGGAGGGCTGCAGG - Intronic
1192633071 X:72791837-72791859 GGGCCGGAGAGGAGGGCTGTAGG - Intronic
1192648638 X:72928964-72928986 GGGCCGGAGAGGAGGGCTGTAGG + Intronic
1195108816 X:101624908-101624930 GGCTGGGGGAGGAAGGCTGTGGG - Exonic
1195648881 X:107264029-107264051 AAGTGGGTGAGGTGGGAGGTAGG - Intergenic
1196456169 X:115893024-115893046 GAGTGGCTTGGGAGTGCTGTGGG - Intergenic
1197576533 X:128219137-128219159 GAGAGGGGGATGAGAGCTGTTGG - Intergenic
1197802587 X:130367301-130367323 GACTGGATGTGGAGGGGTGTGGG + Intronic
1198808330 X:140510158-140510180 GAGCGCGTGAGGAGAGTTGTGGG - Intergenic
1199153518 X:144518708-144518730 GAGTGGCTGAGCAGGGAGGTGGG - Intergenic
1201311415 Y:12601263-12601285 GAGTGGCTGGGAAGGGGTGTTGG + Intergenic
1201613791 Y:15873038-15873060 GAGTGAGTGATGAGAACTGTAGG + Intergenic
1202377492 Y:24250528-24250550 GAGGGGGAGAGGAGGCCCGTGGG + Intergenic
1202493289 Y:25419594-25419616 GAGGGGGAGAGGAGGCCCGTGGG - Intergenic