ID: 903792107

View in Genome Browser
Species Human (GRCh38)
Location 1:25900846-25900868
Sequence ATGTTGTTTTAGGGGCTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 1, 2: 2, 3: 18, 4: 147}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903792107_903792113 -5 Left 903792107 1:25900846-25900868 CCCTTTAGCCCCTAAAACAACAT 0: 1
1: 1
2: 2
3: 18
4: 147
Right 903792113 1:25900864-25900886 AACATCTTACAGTCTGGATCTGG 0: 1
1: 0
2: 0
3: 8
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903792107 Original CRISPR ATGTTGTTTTAGGGGCTAAA GGG (reversed) Intronic
900566088 1:3332483-3332505 ATTTTGTTTTGGGGGCTTTATGG + Intronic
903792107 1:25900846-25900868 ATGTTGTTTTAGGGGCTAAAGGG - Intronic
903915115 1:26758116-26758138 ATGCTGTTTTAGGGACCAGAAGG - Intronic
906401784 1:45509751-45509773 ATGTTGTTACAGGGCCTAAGGGG + Exonic
908522625 1:64958837-64958859 ATGGTGTTTTAAGGACTTAAGGG - Intronic
909986627 1:82168982-82169004 ATATTTTTTTAGTGGCTACAGGG - Intergenic
910771206 1:90834568-90834590 ATGTTGATTTAGTTGCTAATTGG - Intergenic
911147678 1:94568376-94568398 ATGCTGTTATATGGGCTGAAAGG - Intergenic
911246775 1:95526475-95526497 ATTTTGTTATAGGAGCTCAAAGG + Intergenic
911565101 1:99455152-99455174 ATGTTGTTTTGATGGCTTAAGGG - Intergenic
912581595 1:110725864-110725886 ATGTTGTTCTAGGTGCTGCAAGG - Intergenic
913973289 1:143433193-143433215 ATTTTGTTTTAGCGGCTCAAAGG + Intergenic
914067675 1:144258800-144258822 ATTTTGTTTTAGCGGCTCAAAGG + Intergenic
914111480 1:144707554-144707576 ATTTTGTTTTAGCGGCTCAAAGG - Intergenic
916499889 1:165377277-165377299 ATGTTGTTTTAGTGACAAACTGG - Intergenic
916843062 1:168620172-168620194 ATGTTGTTATGGGGGTTAACAGG + Intergenic
917385496 1:174469370-174469392 ATGTTGGATTAGTGGCTTAAAGG - Intronic
919899048 1:202030236-202030258 CTGTATGTTTAGGGGCTAAATGG + Intergenic
920332641 1:205221407-205221429 AGTTTGTTTTATGGACTAAATGG + Intergenic
921371848 1:214431787-214431809 AAGTTGTTACAAGGGCTAAATGG + Intronic
1062865047 10:845233-845255 TTTTTGTTTTGGGGGATAAAGGG - Intronic
1066587192 10:36948894-36948916 ATCTTGTTTTATGGGCATAATGG + Intergenic
1067550511 10:47231508-47231530 ATTCTGTTTTAGTTGCTAAATGG + Intergenic
1069689859 10:70343334-70343356 ATGTGGTTTTGGGGGGGAAAAGG + Intronic
1071961788 10:90814340-90814362 CTGTGGTTATAGGGGCTAAAGGG + Intronic
1072320117 10:94241439-94241461 TTGTTGTTTTAAGAGCAAAAAGG - Intronic
1074863304 10:117529648-117529670 TTGTTGTTTTAGTGACTGAAAGG - Intergenic
1075318458 10:121470495-121470517 ATGTTGCTGCAGGGGCAAAACGG + Intergenic
1078070982 11:8110201-8110223 ATTTTGTTTGTGGGGCTAATGGG - Exonic
1079698791 11:23518457-23518479 ATGTTGTTTTGGGGGGAAATAGG - Intergenic
1081215634 11:40393789-40393811 ACTTTGTTTTAGGGGACAAAAGG - Intronic
1081832467 11:46125176-46125198 AGATTGTTGTAAGGGCTAAATGG + Intergenic
1082640318 11:55651811-55651833 ATGTTTTCTTGGAGGCTAAAGGG + Exonic
1087412490 11:97809181-97809203 ATGCTGGATTAGGGGCCAAATGG + Intergenic
1088164476 11:106916972-106916994 ATGTTGTTCTAGGAGCTAACTGG + Intronic
1088683553 11:112265874-112265896 ATGTTGATTTATGAGCTAATTGG + Intronic
1088708104 11:112481842-112481864 CAGTTGTTTTAGGGGGTAAGAGG + Intergenic
1089255140 11:117190158-117190180 ATGTTGTTGAAGGCGCTAGAAGG - Exonic
1092564782 12:9653062-9653084 ATGTCCTATTAGGGGCAAAAAGG - Intergenic
1093245684 12:16733336-16733358 ACATTGTTGTTGGGGCTAAATGG + Intergenic
1094410191 12:30160204-30160226 ATTTTGTTATAGAGGCTGAATGG - Intergenic
1094578918 12:31715177-31715199 ATGTTGTTTTAGGAGCTAAAGGG - Intronic
1095778517 12:46034539-46034561 ATGCTGTTTCATGGGCTGAAAGG + Intergenic
1098148186 12:67519151-67519173 ATGTTGTTACAGGGGGTAAGTGG - Intergenic
1101729799 12:107417539-107417561 AGGTTGTTTAGTGGGCTAAATGG - Intronic
1106273851 13:28183830-28183852 AGGTTGTTTTCAGGACTAAATGG + Intronic
1107721241 13:43250564-43250586 ATTTTCTTTTGGGGGCTGAATGG + Intronic
1108679527 13:52767553-52767575 ATTTTGTTTTAGCAGCTCAAAGG + Intergenic
1108993042 13:56688285-56688307 AGCTTGTTTTTGTGGCTAAATGG - Intergenic
1111184327 13:84711633-84711655 TTGTTCTTTTAGAGGATAAATGG + Intergenic
1118841748 14:69518749-69518771 GTGTTGTTTTATGGCCTCAAGGG + Intronic
1119955240 14:78791140-78791162 ATGTTGTTTTAGGTGTGATAAGG - Intronic
1126993963 15:54418369-54418391 ATGTCGTTTTAGTGGGGAAATGG + Intronic
1127751335 15:62047919-62047941 ATGTTGTTTTAAGGTAGAAAAGG - Intronic
1133676258 16:8075749-8075771 ATGTTGTCTTAGGGGTGAAAGGG - Intergenic
1135069305 16:19338292-19338314 ATGTTGTTGAAGGGGCAAAATGG + Intergenic
1136012438 16:27372547-27372569 ATGGTGTTTTAGGGTCCAGAGGG - Intergenic
1136120553 16:28130433-28130455 AGGTTATTTGAGGGGGTAAATGG + Intronic
1139167299 16:64582284-64582306 ATGTTGTTTGTTAGGCTAAAGGG - Intergenic
1141769689 16:86082302-86082324 ATGATGGTTTGGGGGCAAAAGGG - Intergenic
1148825009 17:50386464-50386486 ATGTCCTTTTAGGGCTTAAAAGG + Intronic
1149303861 17:55330248-55330270 ATTCTATTTTAGGGGCTATAAGG - Intergenic
1150585090 17:66510266-66510288 ATTTTGTTTTCGGGGGGAAAAGG + Intronic
1158859490 18:61578577-61578599 ATGCTGTTTAAGGGACTCAATGG + Intergenic
1160037219 18:75312712-75312734 ATGTTATTTTATGGGCAATAAGG + Intergenic
1162696102 19:12477108-12477130 ATATTGGTATAGGGGCTTAATGG + Intronic
1164716413 19:30393865-30393887 ATGTTGTTTAAGGGGCAATGTGG + Intronic
927523714 2:23719003-23719025 ATGTTGTTTTATGTGGTAAAGGG - Intergenic
930214845 2:48684262-48684284 TGGTTGTTTTAGGGCCTTAAAGG + Intronic
930504489 2:52264887-52264909 AGATTGTTTTAGGAGCTCAATGG + Intergenic
930739605 2:54817364-54817386 ATGTAGTCTTAGGGGATGAAGGG + Intronic
931743936 2:65275101-65275123 CTCCTGTTTTAGGGGCTAAGAGG + Intergenic
932082819 2:68731180-68731202 ATGTTGATTTAGGGACCCAAGGG - Intronic
934177984 2:89594160-89594182 ATTTTGTTTTAGCGGCTCAAAGG + Intergenic
934288282 2:91668451-91668473 ATTTTGTTTTAGCGGCTCAAAGG + Intergenic
937297621 2:120819073-120819095 ATGTAGGTTTAGGGGCTCAGGGG + Intronic
939143725 2:138387845-138387867 ATGAAGTTTGAGGGGCTAAAGGG - Intergenic
941054737 2:160774425-160774447 ATTTTGTTTTAGGAGCACAAAGG - Intergenic
941849769 2:170168129-170168151 TTGTTGTTGTAAGGGTTAAAGGG - Intergenic
943263203 2:185692881-185692903 ATGTTGTAAGAGGGGCCAAATGG + Intergenic
944124124 2:196274289-196274311 GCCTTGTTTTAGTGGCTAAATGG + Intronic
944991307 2:205239247-205239269 AAGGTGTTCTAGGTGCTAAAAGG + Intronic
945167483 2:206961534-206961556 AGGTTGTTGTAGGGATTAAATGG + Intronic
945519348 2:210804386-210804408 ATGATGTTTTATAGGCAAAAGGG + Intergenic
946461770 2:219875310-219875332 GAGGTGTTTTAGGTGCTAAAAGG + Intergenic
1170695367 20:18652908-18652930 ATGTCTGTTTAGGGACTAAATGG + Intronic
1175948205 20:62568484-62568506 ATCTTGCCTTAGGGGCTCAAGGG + Intronic
1176951380 21:15051111-15051133 GTGTTGGTCTAGGGGCCAAAGGG - Intronic
1177768712 21:25490339-25490361 GTCTTGCTTTAGGGGGTAAAGGG - Intergenic
1179171697 21:38977874-38977896 ATGTTCTTTTAAGGGCTAAAGGG - Intergenic
949737714 3:7193172-7193194 ATGTTTCTTTAAGGGATAAATGG + Intronic
951926915 3:27917449-27917471 ATGTTGCTTTAAGGATTAAATGG + Intergenic
953215872 3:40917543-40917565 GTGTTGGTGTTGGGGCTAAAGGG - Intergenic
953830421 3:46293377-46293399 ATGTTGTTGTAGGGGGTAGAGGG - Intergenic
960831250 3:121851144-121851166 ATGTTATTTGAGGGAATAAAAGG - Intronic
961267784 3:125660086-125660108 ATGTTCTTTTAAGGTCTCAATGG + Intergenic
963721064 3:148862516-148862538 ATGTTAATTTGGGGGCAAAAAGG + Intergenic
965487469 3:169295567-169295589 ATGTTGTTTTAAAGGCATAATGG - Intronic
966274163 3:178144340-178144362 ATGTTCTTTTAGGGCATACATGG - Intergenic
966571123 3:181444713-181444735 ATGTTGTTTAAGTGGCCAAAAGG - Intergenic
966645722 3:182244638-182244660 ATGTTGATTTGGGCGCTACAGGG - Intergenic
969831264 4:9799231-9799253 ATTTTGTTTTAGCAGCTCAAAGG - Intronic
971173956 4:24262734-24262756 ATGTGGTTTTAGTGGATGAAAGG + Intergenic
971174173 4:24264823-24264845 CTGTTGTTTTTGTGGCCAAATGG + Intergenic
972853740 4:43081304-43081326 ATGTTTTTTAAGGAGCTCAATGG - Intergenic
976646484 4:87392513-87392535 ACGTTGTTATAGGGGATGAAGGG + Intergenic
980014374 4:127631803-127631825 ATGTTATTTTATGATCTAAAAGG - Intronic
980654422 4:135764120-135764142 ACTTTGTTTCAGGGGCTACATGG + Intergenic
980774916 4:137425269-137425291 ATGTTGGTTTAGGGGATAAAGGG - Intergenic
984040285 4:174724815-174724837 ATATTTTTTTAGGTGCTGAAAGG - Intronic
987133054 5:14876625-14876647 ATGCTATTTTGGGGGCAAAAAGG + Intergenic
990542503 5:56788249-56788271 ATAATGTTTTAGAGGCTGAAAGG - Intergenic
991453014 5:66772684-66772706 CTGCTGTTTTAGGGTGTAAATGG + Intronic
993629469 5:90267646-90267668 ATTTTATTTTAGAGACTAAAAGG - Intergenic
995794969 5:115931372-115931394 GTGTTGTTTTATATGCTAAAAGG - Intergenic
998364039 5:141617472-141617494 ATGTTGTTTTATGACCTAGAGGG - Intronic
999350959 5:150871290-150871312 ATTTTGTTTTAAGAGCTCAATGG + Intronic
1000448553 5:161356032-161356054 ATGTGGTTTTAGGAAATAAAAGG + Intronic
1004619971 6:17323590-17323612 ATGTTGTGTGAGGGGCTTAGGGG + Intergenic
1007255135 6:40523102-40523124 CTGTTGCTTCAGGGGCTCAAGGG + Intronic
1010370147 6:75097888-75097910 ATTGTTTTTTTGGGGCTAAAGGG - Intronic
1010922488 6:81701293-81701315 ATGTTTATTTAGCAGCTAAAAGG + Intronic
1012313366 6:97755704-97755726 ATATTCTTTTAAGGGCTAAAGGG + Intergenic
1013659704 6:112282593-112282615 ATGCTGTTTTAGAGGTTAATGGG + Intergenic
1013812625 6:114061956-114061978 ATTTTTTTTTAAGGGCAAAAAGG + Intronic
1013857375 6:114590577-114590599 ATGGTGTTTGAGGGAGTAAAAGG + Intergenic
1013949542 6:115763252-115763274 ATGTTGTTTTACATGCCAAAAGG - Intergenic
1014000229 6:116357225-116357247 AACTTGTTTTTGTGGCTAAAGGG - Intronic
1015053094 6:128865613-128865635 AAGTTCTTTTAGGGGAGAAATGG - Intergenic
1015307522 6:131726351-131726373 AGGTTGTTATAGGTGCTACACGG + Intronic
1015364399 6:132380900-132380922 ATGTGCGTGTAGGGGCTAAAAGG - Intronic
1016544428 6:145204622-145204644 ATGCTGTTGTAAGGGCTGAAAGG + Intergenic
1019070017 6:169337797-169337819 ATATTTTTTTAGGAGCTCAATGG - Intergenic
1020563889 7:9771774-9771796 ATGTTGTTATGAGGGCTAATGGG + Intergenic
1025761380 7:64398416-64398438 ATTTTCTTATAGGGGCTCAATGG + Intergenic
1027158667 7:75786489-75786511 ATACTGTTTTATGGGCTGAAAGG + Intronic
1028277680 7:88877481-88877503 CTCTTATTTTAGGGGTTAAATGG + Intronic
1028412262 7:90542538-90542560 ATCTTTTTTGAGGGGCGAAATGG - Intronic
1030518482 7:110566938-110566960 ATGGTGTTTTAGGGGAGAATGGG + Intergenic
1030926195 7:115458019-115458041 ATGTAGTTTTAAGTGCTAGAAGG + Intergenic
1032923477 7:136576160-136576182 ATGTTGTAGGAGGGGCCAAATGG + Intergenic
1033232310 7:139609875-139609897 ATGTTCTTTTAATGGCTACATGG + Intronic
1036396025 8:8371947-8371969 ATGTGGTTTCAGTGTCTAAATGG - Intronic
1036781036 8:11647740-11647762 TTGTTGTATTTGGGGTTAAACGG + Intergenic
1036910314 8:12753725-12753747 AGGTGGTTTTAGGCGCTGAAAGG - Intronic
1037472512 8:19224565-19224587 ATCTTATATTATGGGCTAAAAGG - Intergenic
1037716275 8:21403593-21403615 ATAATGTTTTGGGGGTTAAAAGG + Intergenic
1038482044 8:27908626-27908648 ATGTTGTATTAGGAGGGAAAAGG - Intronic
1038512682 8:28154257-28154279 AAGATGTTTTAGGGGCTCACAGG + Intronic
1040417307 8:47206751-47206773 ATGTTGTTTTTGGCCCCAAAGGG + Intergenic
1041917204 8:63149638-63149660 ATGCTGTTTTATGGGCTGAAAGG - Intergenic
1044937100 8:97303670-97303692 AGGTCGTTTTATGGGCTAAATGG - Intergenic
1045837847 8:106544424-106544446 ATCTTGCTTTAGAAGCTAAAAGG + Intronic
1046594356 8:116243359-116243381 GTATTGTTTTAGGTGCCAAATGG - Intergenic
1048698355 8:137055038-137055060 AAGTTGTTTTAGGTGATCAAAGG + Intergenic
1053239058 9:36481690-36481712 ATGCTGTTCTGGGGGCTCAAGGG - Intronic
1053433157 9:38057446-38057468 ATTTTGTTATAAGGGGTAAAAGG + Intronic
1053507656 9:38657470-38657492 ATGTTGTTTTTGGGGAAGAATGG + Intergenic
1060561821 9:124551712-124551734 AGGATGTTTTGGGGGTTAAAGGG - Intronic
1185943459 X:4347506-4347528 ATGTTTTTTTCGAGGTTAAATGG + Intergenic
1188546850 X:31317303-31317325 ATGTTGTCTTAGCTGCTAAAAGG + Intronic
1193797507 X:85894134-85894156 GTGTTTGTTTAGGGGGTAAAGGG - Intronic
1195638705 X:107149859-107149881 CTGTTGTCTTAGCAGCTAAATGG - Intronic
1195793367 X:108615495-108615517 CTGCTATTTTAGGGGCAAAAAGG - Intronic
1196515007 X:116600087-116600109 CAGATGTTTTATGGGCTAAAAGG + Intergenic
1196848403 X:119915054-119915076 ATGTTGTTCTAGAAGCCAAATGG - Intronic
1198637830 X:138718927-138718949 ATGTTGTTGTAAGGATTAAAGGG - Intronic
1199737862 X:150701676-150701698 AGGTTGTTTTAAGGCTTAAATGG - Intronic
1200273267 X:154708261-154708283 ATTTTCTTCTAGGGGCTAAATGG - Intronic