ID: 903795698

View in Genome Browser
Species Human (GRCh38)
Location 1:25927500-25927522
Sequence AAACAAGACCGTGGCAGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903795698_903795707 23 Left 903795698 1:25927500-25927522 CCAGTACTGCCACGGTCTTGTTT No data
Right 903795707 1:25927546-25927568 TCCTGTGAGTCTGGGAGTCAGGG No data
903795698_903795709 24 Left 903795698 1:25927500-25927522 CCAGTACTGCCACGGTCTTGTTT No data
Right 903795709 1:25927547-25927569 CCTGTGAGTCTGGGAGTCAGGGG No data
903795698_903795710 25 Left 903795698 1:25927500-25927522 CCAGTACTGCCACGGTCTTGTTT No data
Right 903795710 1:25927548-25927570 CTGTGAGTCTGGGAGTCAGGGGG No data
903795698_903795703 14 Left 903795698 1:25927500-25927522 CCAGTACTGCCACGGTCTTGTTT No data
Right 903795703 1:25927537-25927559 CTCACCAGATCCTGTGAGTCTGG No data
903795698_903795706 22 Left 903795698 1:25927500-25927522 CCAGTACTGCCACGGTCTTGTTT No data
Right 903795706 1:25927545-25927567 ATCCTGTGAGTCTGGGAGTCAGG No data
903795698_903795704 15 Left 903795698 1:25927500-25927522 CCAGTACTGCCACGGTCTTGTTT No data
Right 903795704 1:25927538-25927560 TCACCAGATCCTGTGAGTCTGGG No data
903795698_903795711 30 Left 903795698 1:25927500-25927522 CCAGTACTGCCACGGTCTTGTTT No data
Right 903795711 1:25927553-25927575 AGTCTGGGAGTCAGGGGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903795698 Original CRISPR AAACAAGACCGTGGCAGTAC TGG (reversed) Intergenic
No off target data available for this crispr