ID: 903795699

View in Genome Browser
Species Human (GRCh38)
Location 1:25927509-25927531
Sequence AGGGTAACAAAACAAGACCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903795699_903795711 21 Left 903795699 1:25927509-25927531 CCACGGTCTTGTTTTGTTACCCT No data
Right 903795711 1:25927553-25927575 AGTCTGGGAGTCAGGGGGTCAGG No data
903795699_903795704 6 Left 903795699 1:25927509-25927531 CCACGGTCTTGTTTTGTTACCCT No data
Right 903795704 1:25927538-25927560 TCACCAGATCCTGTGAGTCTGGG No data
903795699_903795716 28 Left 903795699 1:25927509-25927531 CCACGGTCTTGTTTTGTTACCCT No data
Right 903795716 1:25927560-25927582 GAGTCAGGGGGTCAGGGGGGTGG No data
903795699_903795710 16 Left 903795699 1:25927509-25927531 CCACGGTCTTGTTTTGTTACCCT No data
Right 903795710 1:25927548-25927570 CTGTGAGTCTGGGAGTCAGGGGG No data
903795699_903795703 5 Left 903795699 1:25927509-25927531 CCACGGTCTTGTTTTGTTACCCT No data
Right 903795703 1:25927537-25927559 CTCACCAGATCCTGTGAGTCTGG No data
903795699_903795709 15 Left 903795699 1:25927509-25927531 CCACGGTCTTGTTTTGTTACCCT No data
Right 903795709 1:25927547-25927569 CCTGTGAGTCTGGGAGTCAGGGG No data
903795699_903795706 13 Left 903795699 1:25927509-25927531 CCACGGTCTTGTTTTGTTACCCT No data
Right 903795706 1:25927545-25927567 ATCCTGTGAGTCTGGGAGTCAGG No data
903795699_903795712 22 Left 903795699 1:25927509-25927531 CCACGGTCTTGTTTTGTTACCCT No data
Right 903795712 1:25927554-25927576 GTCTGGGAGTCAGGGGGTCAGGG No data
903795699_903795714 24 Left 903795699 1:25927509-25927531 CCACGGTCTTGTTTTGTTACCCT No data
Right 903795714 1:25927556-25927578 CTGGGAGTCAGGGGGTCAGGGGG No data
903795699_903795707 14 Left 903795699 1:25927509-25927531 CCACGGTCTTGTTTTGTTACCCT No data
Right 903795707 1:25927546-25927568 TCCTGTGAGTCTGGGAGTCAGGG No data
903795699_903795715 25 Left 903795699 1:25927509-25927531 CCACGGTCTTGTTTTGTTACCCT No data
Right 903795715 1:25927557-25927579 TGGGAGTCAGGGGGTCAGGGGGG No data
903795699_903795718 30 Left 903795699 1:25927509-25927531 CCACGGTCTTGTTTTGTTACCCT No data
Right 903795718 1:25927562-25927584 GTCAGGGGGTCAGGGGGGTGGGG No data
903795699_903795713 23 Left 903795699 1:25927509-25927531 CCACGGTCTTGTTTTGTTACCCT No data
Right 903795713 1:25927555-25927577 TCTGGGAGTCAGGGGGTCAGGGG No data
903795699_903795717 29 Left 903795699 1:25927509-25927531 CCACGGTCTTGTTTTGTTACCCT No data
Right 903795717 1:25927561-25927583 AGTCAGGGGGTCAGGGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903795699 Original CRISPR AGGGTAACAAAACAAGACCG TGG (reversed) Intergenic
No off target data available for this crispr