ID: 903795701

View in Genome Browser
Species Human (GRCh38)
Location 1:25927528-25927550
Sequence CAGGATCTGGTGAGTTGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903795701_903795709 -4 Left 903795701 1:25927528-25927550 CCCTGGCAACTCACCAGATCCTG No data
Right 903795709 1:25927547-25927569 CCTGTGAGTCTGGGAGTCAGGGG No data
903795701_903795715 6 Left 903795701 1:25927528-25927550 CCCTGGCAACTCACCAGATCCTG No data
Right 903795715 1:25927557-25927579 TGGGAGTCAGGGGGTCAGGGGGG No data
903795701_903795713 4 Left 903795701 1:25927528-25927550 CCCTGGCAACTCACCAGATCCTG No data
Right 903795713 1:25927555-25927577 TCTGGGAGTCAGGGGGTCAGGGG No data
903795701_903795722 22 Left 903795701 1:25927528-25927550 CCCTGGCAACTCACCAGATCCTG No data
Right 903795722 1:25927573-25927595 AGGGGGGTGGGGGGCAAACAGGG No data
903795701_903795712 3 Left 903795701 1:25927528-25927550 CCCTGGCAACTCACCAGATCCTG No data
Right 903795712 1:25927554-25927576 GTCTGGGAGTCAGGGGGTCAGGG No data
903795701_903795718 11 Left 903795701 1:25927528-25927550 CCCTGGCAACTCACCAGATCCTG No data
Right 903795718 1:25927562-25927584 GTCAGGGGGTCAGGGGGGTGGGG No data
903795701_903795711 2 Left 903795701 1:25927528-25927550 CCCTGGCAACTCACCAGATCCTG No data
Right 903795711 1:25927553-25927575 AGTCTGGGAGTCAGGGGGTCAGG No data
903795701_903795721 21 Left 903795701 1:25927528-25927550 CCCTGGCAACTCACCAGATCCTG No data
Right 903795721 1:25927572-25927594 CAGGGGGGTGGGGGGCAAACAGG No data
903795701_903795717 10 Left 903795701 1:25927528-25927550 CCCTGGCAACTCACCAGATCCTG No data
Right 903795717 1:25927561-25927583 AGTCAGGGGGTCAGGGGGGTGGG No data
903795701_903795716 9 Left 903795701 1:25927528-25927550 CCCTGGCAACTCACCAGATCCTG No data
Right 903795716 1:25927560-25927582 GAGTCAGGGGGTCAGGGGGGTGG No data
903795701_903795714 5 Left 903795701 1:25927528-25927550 CCCTGGCAACTCACCAGATCCTG No data
Right 903795714 1:25927556-25927578 CTGGGAGTCAGGGGGTCAGGGGG No data
903795701_903795710 -3 Left 903795701 1:25927528-25927550 CCCTGGCAACTCACCAGATCCTG No data
Right 903795710 1:25927548-25927570 CTGTGAGTCTGGGAGTCAGGGGG No data
903795701_903795706 -6 Left 903795701 1:25927528-25927550 CCCTGGCAACTCACCAGATCCTG No data
Right 903795706 1:25927545-25927567 ATCCTGTGAGTCTGGGAGTCAGG No data
903795701_903795720 13 Left 903795701 1:25927528-25927550 CCCTGGCAACTCACCAGATCCTG No data
Right 903795720 1:25927564-25927586 CAGGGGGTCAGGGGGGTGGGGGG No data
903795701_903795719 12 Left 903795701 1:25927528-25927550 CCCTGGCAACTCACCAGATCCTG No data
Right 903795719 1:25927563-25927585 TCAGGGGGTCAGGGGGGTGGGGG No data
903795701_903795707 -5 Left 903795701 1:25927528-25927550 CCCTGGCAACTCACCAGATCCTG No data
Right 903795707 1:25927546-25927568 TCCTGTGAGTCTGGGAGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903795701 Original CRISPR CAGGATCTGGTGAGTTGCCA GGG (reversed) Intergenic
No off target data available for this crispr