ID: 903795706

View in Genome Browser
Species Human (GRCh38)
Location 1:25927545-25927567
Sequence ATCCTGTGAGTCTGGGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903795702_903795706 -7 Left 903795702 1:25927529-25927551 CCTGGCAACTCACCAGATCCTGT No data
Right 903795706 1:25927545-25927567 ATCCTGTGAGTCTGGGAGTCAGG No data
903795699_903795706 13 Left 903795699 1:25927509-25927531 CCACGGTCTTGTTTTGTTACCCT No data
Right 903795706 1:25927545-25927567 ATCCTGTGAGTCTGGGAGTCAGG No data
903795698_903795706 22 Left 903795698 1:25927500-25927522 CCAGTACTGCCACGGTCTTGTTT No data
Right 903795706 1:25927545-25927567 ATCCTGTGAGTCTGGGAGTCAGG No data
903795701_903795706 -6 Left 903795701 1:25927528-25927550 CCCTGGCAACTCACCAGATCCTG No data
Right 903795706 1:25927545-25927567 ATCCTGTGAGTCTGGGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903795706 Original CRISPR ATCCTGTGAGTCTGGGAGTC AGG Intergenic
No off target data available for this crispr