ID: 903795712

View in Genome Browser
Species Human (GRCh38)
Location 1:25927554-25927576
Sequence GTCTGGGAGTCAGGGGGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903795699_903795712 22 Left 903795699 1:25927509-25927531 CCACGGTCTTGTTTTGTTACCCT No data
Right 903795712 1:25927554-25927576 GTCTGGGAGTCAGGGGGTCAGGG No data
903795701_903795712 3 Left 903795701 1:25927528-25927550 CCCTGGCAACTCACCAGATCCTG No data
Right 903795712 1:25927554-25927576 GTCTGGGAGTCAGGGGGTCAGGG No data
903795705_903795712 -10 Left 903795705 1:25927541-25927563 CCAGATCCTGTGAGTCTGGGAGT No data
Right 903795712 1:25927554-25927576 GTCTGGGAGTCAGGGGGTCAGGG No data
903795702_903795712 2 Left 903795702 1:25927529-25927551 CCTGGCAACTCACCAGATCCTGT No data
Right 903795712 1:25927554-25927576 GTCTGGGAGTCAGGGGGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903795712 Original CRISPR GTCTGGGAGTCAGGGGGTCA GGG Intergenic
No off target data available for this crispr