ID: 903795716

View in Genome Browser
Species Human (GRCh38)
Location 1:25927560-25927582
Sequence GAGTCAGGGGGTCAGGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903795705_903795716 -4 Left 903795705 1:25927541-25927563 CCAGATCCTGTGAGTCTGGGAGT No data
Right 903795716 1:25927560-25927582 GAGTCAGGGGGTCAGGGGGGTGG No data
903795699_903795716 28 Left 903795699 1:25927509-25927531 CCACGGTCTTGTTTTGTTACCCT No data
Right 903795716 1:25927560-25927582 GAGTCAGGGGGTCAGGGGGGTGG No data
903795701_903795716 9 Left 903795701 1:25927528-25927550 CCCTGGCAACTCACCAGATCCTG No data
Right 903795716 1:25927560-25927582 GAGTCAGGGGGTCAGGGGGGTGG No data
903795708_903795716 -10 Left 903795708 1:25927547-25927569 CCTGTGAGTCTGGGAGTCAGGGG No data
Right 903795716 1:25927560-25927582 GAGTCAGGGGGTCAGGGGGGTGG No data
903795702_903795716 8 Left 903795702 1:25927529-25927551 CCTGGCAACTCACCAGATCCTGT No data
Right 903795716 1:25927560-25927582 GAGTCAGGGGGTCAGGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903795716 Original CRISPR GAGTCAGGGGGTCAGGGGGG TGG Intergenic
No off target data available for this crispr