ID: 903803700

View in Genome Browser
Species Human (GRCh38)
Location 1:25989173-25989195
Sequence CTGTCTAAATACATGTCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 211}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903803700_903803709 25 Left 903803700 1:25989173-25989195 CCCAAAGACATGTATTTAGACAG 0: 1
1: 0
2: 2
3: 26
4: 211
Right 903803709 1:25989221-25989243 GGCTAGTAACTTATAAAGTCTGG 0: 1
1: 0
2: 2
3: 14
4: 103
903803700_903803703 4 Left 903803700 1:25989173-25989195 CCCAAAGACATGTATTTAGACAG 0: 1
1: 0
2: 2
3: 26
4: 211
Right 903803703 1:25989200-25989222 AGTAACTTGCCCAAACCCCATGG 0: 1
1: 1
2: 3
3: 26
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903803700 Original CRISPR CTGTCTAAATACATGTCTTT GGG (reversed) Intronic
901335997 1:8449709-8449731 CCTGCTAAATAAATGTCTTTAGG - Intronic
903443315 1:23404487-23404509 CTTTCTAAAAACATGCATTTTGG + Intronic
903803700 1:25989173-25989195 CTGTCTAAATACATGTCTTTGGG - Intronic
905363775 1:37437718-37437740 CTGACTTTGTACATGTCTTTGGG + Intergenic
905927036 1:41758479-41758501 CTGTCTTCAGACAGGTCTTTTGG - Intronic
907694638 1:56710891-56710913 TTTTCTAAATACTTTTCTTTGGG + Exonic
908925295 1:69247325-69247347 ATGTATACATACATGCCTTTAGG + Intergenic
909069450 1:70977013-70977035 CTGTCTAAATTGAAATCTTTGGG - Intronic
909177445 1:72379303-72379325 CAATCTAAATACATGTCTAGTGG - Intergenic
909497607 1:76296395-76296417 CTTTCTAAGGAAATGTCTTTGGG + Intronic
909845216 1:80385340-80385362 CAGTCTACATAAATGTCTATAGG - Intergenic
909954387 1:81760467-81760489 TTTTCTAAATACATTGCTTTTGG + Intronic
910143414 1:84052063-84052085 CTGTCAAAATGCAGTTCTTTGGG + Intergenic
911106213 1:94134003-94134025 CTGACTAGCTACATGTCTTTGGG - Intergenic
912062941 1:105696827-105696849 CTTTCAAAATACATTTCTATAGG + Intergenic
913041492 1:115029674-115029696 TTGTCTAAATACATTTTATTTGG + Intergenic
913456902 1:119041860-119041882 CTTGCTAATTACATGACTTTGGG + Intronic
917308190 1:173649222-173649244 ATTTCTAGATATATGTCTTTGGG - Intronic
918036310 1:180875872-180875894 CTCTTTAAATAAATGTCTTTAGG - Intronic
918707749 1:187689262-187689284 CTGTTTGAACACATTTCTTTAGG - Intergenic
918955968 1:191207910-191207932 CTGTCTAGATAAATGTACTTTGG + Intergenic
921629834 1:217420024-217420046 CTTTTAAAATAAATGTCTTTTGG + Intergenic
922187104 1:223285405-223285427 CTGTCCAAAGTCATGTATTTTGG - Intronic
922526962 1:226311250-226311272 CTGTTTAAATCAATGTTTTTAGG + Intergenic
922613872 1:226949271-226949293 ATGTCTACATACATGTCTACAGG + Intronic
924003995 1:239586933-239586955 CTCCCAAAATACAGGTCTTTTGG + Intronic
1063654668 10:7975997-7976019 CTGTCTATCTCCAAGTCTTTCGG - Intronic
1065090554 10:22229078-22229100 CTGTTGAAATACATGCATTTCGG + Intergenic
1065398977 10:25274194-25274216 CTTTCTAAACATTTGTCTTTAGG + Intronic
1065838374 10:29679731-29679753 CTTTCTAAATACCTTTCTGTTGG + Intronic
1074213331 10:111359376-111359398 CTCTCTATATATATGTATTTTGG - Intergenic
1075402595 10:122171908-122171930 CTGTCTCCATACATCTCCTTGGG + Intronic
1077745820 11:4903861-4903883 ATATCTGAATACATGTCTATGGG + Intronic
1080166494 11:29243304-29243326 CTCTCAAAACTCATGTCTTTCGG - Intergenic
1083043485 11:59710899-59710921 CTGCCTATATCCATGCCTTTAGG - Intergenic
1085217463 11:74844934-74844956 CTGTCTAAATACCTGTCAAAGGG - Intronic
1086058907 11:82680599-82680621 CTGTCTTGTTTCATGTCTTTGGG - Intergenic
1086154600 11:83651868-83651890 CTGTCAAAGGACATGTCTTCTGG + Intronic
1089252145 11:117172228-117172250 CTATGTAAAAACATGTCATTGGG - Intronic
1089994166 11:122889222-122889244 ATGTCTAAATCCATCTCATTTGG - Intronic
1090438438 11:126706472-126706494 ATGTATAAATATATGTCTCTAGG + Intronic
1090955168 11:131506960-131506982 CTATGTAAATATCTGTCTTTGGG - Intronic
1091801211 12:3325930-3325952 CAGTCCAAACATATGTCTTTTGG - Intergenic
1092630016 12:10366934-10366956 ATGTGTAAATATTTGTCTTTTGG - Intergenic
1092889264 12:12953475-12953497 CTGTCGAAATACATATATTCAGG - Intergenic
1093398471 12:18713107-18713129 CTCTATAAAAACTTGTCTTTGGG + Intronic
1093420374 12:18967794-18967816 CTGTCTATATAAATCTGTTTTGG - Intergenic
1098915862 12:76256256-76256278 CTGAATAAAGACATCTCTTTTGG + Intergenic
1099679847 12:85812700-85812722 CTGTATAAATACAGGTTATTAGG + Intronic
1102676545 12:114663386-114663408 CTGACTAAATAAATGCCTCTGGG - Intergenic
1103410683 12:120709942-120709964 ATGTTTAAATACATATCTTACGG - Intergenic
1106155910 13:27155845-27155867 CTGCCTAAATGTATGACTTTCGG + Intronic
1108368185 13:49739344-49739366 CTCTCAAAATACATGTGTGTTGG - Intronic
1109785510 13:67169471-67169493 ATTTCTGATTACATGTCTTTTGG + Intronic
1111224984 13:85258228-85258250 CAGTCTAAAGAGATGTCCTTAGG + Intergenic
1111316309 13:86565268-86565290 CTGTTTATATACATATATTTGGG + Intergenic
1112210436 13:97371821-97371843 CTGTCTAAATAAATGTCACATGG + Intronic
1112708215 13:102096889-102096911 CTGGCTGAAAACATGTCTTGTGG - Intronic
1115484694 14:33898961-33898983 ATCTCTAGATACATGTATTTTGG - Intergenic
1115511907 14:34146285-34146307 CAGACAAAATACATGTCTTTAGG + Intronic
1115692992 14:35865246-35865268 CAGACTAAATAAATGTTTTTTGG - Intronic
1116056925 14:39875557-39875579 CTGACTACATACATCTCTTTAGG - Intergenic
1116300895 14:43181404-43181426 CTATCCAAATACTAGTCTTTAGG + Intergenic
1118107686 14:62678751-62678773 CTGTGTAACTACAAGTATTTTGG - Intergenic
1118482175 14:66178349-66178371 CTCTCAAAATACGTGCCTTTAGG - Intergenic
1121292483 14:92787703-92787725 CCTTGTAAATAAATGTCTTTGGG + Intergenic
1123507099 15:20953874-20953896 GTGTATAAACACATGGCTTTGGG - Intergenic
1123564326 15:21527617-21527639 GTGTATAAACACATGGCTTTGGG - Intergenic
1123600579 15:21964900-21964922 GTGTATAAACACATGGCTTTGGG - Intergenic
1124648498 15:31457555-31457577 CTTTATAAAAACATCTCTTTGGG + Intergenic
1128028402 15:64459445-64459467 CTGTCTAACAACATGACTATTGG + Intergenic
1129032142 15:72627171-72627193 CTTTTTAAATACATTTATTTAGG - Intergenic
1129217756 15:74110063-74110085 CTTTTTAAATACATGTATTTAGG + Intronic
1129406910 15:75325911-75325933 CTTTTTAAATACATTTATTTAGG - Intergenic
1129470111 15:75748775-75748797 CTTTTTAAATACATTTATTTAGG - Intergenic
1129734913 15:77954361-77954383 CTTTTTAAATACATTTATTTAGG + Intergenic
1202972687 15_KI270727v1_random:254725-254747 GTGTATAAACACATGGCTTTGGG - Intergenic
1132459632 16:45035-45057 CTTTGTAAATATTTGTCTTTTGG - Intergenic
1135227952 16:20677795-20677817 CTGTGTAAATATTTGTCTTTTGG - Intronic
1138339014 16:56276358-56276380 CTGTCTAAGTACCTGTCCTTGGG + Intronic
1138597673 16:58037781-58037803 CTTTCTCAATACAAGGCTTTGGG - Intronic
1138903682 16:61304539-61304561 TATTCTCAATACATGTCTTTTGG - Intergenic
1138932113 16:61671575-61671597 CTGTCTAAACATATATCTTTGGG + Intronic
1140781651 16:78302294-78302316 CTGTCAAATTTCATGGCTTTGGG - Intronic
1143800371 17:9374380-9374402 CTGTTTAAAAAAATTTCTTTTGG - Intronic
1149041343 17:52192745-52192767 CTTTCTGAATCCATGCCTTTGGG - Intergenic
1149957882 17:61073639-61073661 GTGTATATATAAATGTCTTTTGG + Intronic
1155086221 18:22460922-22460944 CTGCTCAAATACATGTCTTTGGG + Intergenic
1155522260 18:26680400-26680422 GTGAGTAAATATATGTCTTTAGG + Intergenic
1155668905 18:28345704-28345726 CTTCCTAAATACACTTCTTTTGG - Intergenic
1162052606 19:8043776-8043798 CTGACTAAATACATCTATTCAGG + Intronic
1164054223 19:21608157-21608179 CTGTGTAAATATTTGTCTTTTGG - Intergenic
1165226292 19:34357561-34357583 CTGTCCACATACATGCTTTTGGG - Intergenic
1167868888 19:52350994-52351016 CTGTATAAATATATTTCTTTTGG - Intronic
1167926567 19:52826011-52826033 GTGTCTGAATACATTTCTGTAGG + Intronic
1167946978 19:52995979-52996001 GTGTCTGAATACATTTCTGTAGG + Intergenic
925111081 2:1338216-1338238 CTATTTAAAAAAATGTCTTTGGG + Intronic
928079423 2:28296336-28296358 CAGTCTGAATACATGTCTGTTGG - Intronic
928335018 2:30390514-30390536 CTGTCTCCTTACAAGTCTTTGGG + Intergenic
928421404 2:31139794-31139816 ATTTCTCAGTACATGTCTTTGGG - Intronic
928638574 2:33274076-33274098 TTTGCTAAATACATGTTTTTAGG - Intronic
928690701 2:33795608-33795630 CTATCTAAAAACATGACTTTAGG + Intergenic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
931497361 2:62823283-62823305 CTGTCTGAATAACTGTCTCTGGG - Intronic
931544352 2:63365000-63365022 CTTTGTAAATACAGTTCTTTTGG - Intronic
931572004 2:63679128-63679150 CTGCCTCAATTCATCTCTTTAGG + Intronic
931955233 2:67416950-67416972 CTTTTTAAATAAATGACTTTTGG - Intergenic
933480756 2:82854191-82854213 CTGACTGAAAACATGTTTTTTGG - Intergenic
933565610 2:83946860-83946882 CTGCCTACATTCATCTCTTTTGG + Intergenic
934609605 2:95725027-95725049 CTTTCTAACTGCATGGCTTTGGG - Intergenic
937243436 2:120477130-120477152 CTGGCTACATATATGTATTTCGG + Intergenic
937878140 2:126841285-126841307 CTATATAACTACATGTTTTTTGG - Intergenic
937965341 2:127503284-127503306 CTGCCTAATTGCATGTCTTTGGG - Intronic
939316351 2:140555071-140555093 CTGTCTAAATACAACTCTCCTGG + Intronic
939849858 2:147291489-147291511 CTTTCTAAATATATGTTTTCTGG - Intergenic
940934748 2:159478821-159478843 ATTTCTAAATACATGTTCTTTGG + Intronic
941626042 2:167831416-167831438 CTCTCAAAATTCATATCTTTGGG + Intergenic
941764913 2:169286079-169286101 CTCTTTAAATACATGACGTTAGG - Intronic
941894972 2:170620003-170620025 CTGTTTAATTACCTCTCTTTGGG - Intronic
943668886 2:190639301-190639323 CTGTATAACTACATGTCTTGAGG - Intergenic
943809481 2:192166476-192166498 CTGTCTTAATGCAAATCTTTTGG - Intronic
943862320 2:192883312-192883334 CTGGTTAAATACATGTCCTTTGG + Intergenic
947224592 2:227827603-227827625 TTTTCTAAATACATGTTTTCAGG + Intergenic
1169403477 20:5303633-5303655 GTGTCTAAATAGGTGTCATTAGG - Intronic
1169640925 20:7751348-7751370 CTGTCTGAATGCAGGTCTTCTGG + Intergenic
1169809763 20:9597566-9597588 CTGTCTGTATGCATGTCCTTTGG + Intronic
1170915466 20:20620107-20620129 TTGTTTAAATAAATATCTTTTGG - Intronic
1170958796 20:21006559-21006581 CTCTCTATATACATGCCTTTTGG - Intergenic
1173933763 20:46843892-46843914 CTGTCTGAGTAAATGTGTTTGGG + Intergenic
1175480823 20:59309476-59309498 TTTTCTAAATAGATGTCTGTGGG - Intronic
1176346531 21:5753398-5753420 CTGTATAAATATTGGTCTTTTGG + Intergenic
1176353345 21:5873982-5874004 CTGTATAAATATTGGTCTTTTGG + Intergenic
1176498296 21:7571057-7571079 CTGTATAAATATTGGTCTTTTGG - Intergenic
1176540852 21:8151468-8151490 CTGTATAAATATTGGTCTTTTGG + Intergenic
1176559803 21:8334513-8334535 CTGTATAAATATTGGTCTTTTGG + Intergenic
1180253946 21:46609656-46609678 CTCTCTCAATCCATGTCTATGGG + Intergenic
1184934281 22:47707597-47707619 CTTTTTTAATACATGGCTTTGGG - Intergenic
1203245792 22_KI270733v1_random:67887-67909 CTGTATAAATATTGGTCTTTTGG + Intergenic
949667312 3:6354877-6354899 CTGTGTGAATACCTGACTTTGGG + Intergenic
950381835 3:12622535-12622557 CTCTCTAAAGAGATGTCTCTTGG - Intronic
952401693 3:32969279-32969301 CTGTGTAAATATTTGTCTTTTGG - Intergenic
952535789 3:34307542-34307564 CTGTCTCAATAAGTGTCTCTGGG + Intergenic
952644953 3:35644866-35644888 CTGCCAAAAGACATTTCTTTGGG - Intronic
953051537 3:39348725-39348747 CTGTGTAAATATTTGTCTTTTGG - Intergenic
953108005 3:39904552-39904574 CATTCTAAATACATGCTTTTGGG - Intronic
953179519 3:40582931-40582953 AGGTCTAAATACTTGCCTTTGGG - Intergenic
956488978 3:69751707-69751729 CTGGCTATATATGTGTCTTTGGG + Intronic
956800978 3:72758067-72758089 CAGGCTACATACATGTGTTTTGG - Intronic
959401444 3:105906948-105906970 CTGTCTAAAAATATGTATTTGGG - Intergenic
960353018 3:116616781-116616803 CTCTCTACATGCATTTCTTTGGG - Intronic
961608720 3:128119032-128119054 CTGTGGAAATACATTTCTGTTGG - Intronic
962088405 3:132216858-132216880 CTTTCTAAATTCTTGACTTTTGG - Intronic
963235827 3:142954921-142954943 CTAGCTAAATACAGTTCTTTAGG + Intronic
963346900 3:144105690-144105712 CTGTTTAACTAGATGCCTTTTGG + Intergenic
965130362 3:164691472-164691494 ATGATTAAATACATTTCTTTAGG - Intergenic
966070965 3:175877499-175877521 CTGTATAAATACATTTCTTTAGG - Intergenic
972318399 4:37949291-37949313 CTGCCTAATTACTTGTGTTTAGG + Intronic
973283093 4:48381708-48381730 GTGTGTGAATACATGACTTTAGG + Intronic
974253410 4:59419666-59419688 CTATCTAAAGATATGTCTTGTGG + Intergenic
975047487 4:69823714-69823736 CTGTGTAAATATTTGCCTTTCGG + Intronic
978217521 4:106223230-106223252 CTTTCTAAATACATAACTTTTGG + Intronic
978359488 4:107914220-107914242 CTGTATAAAAACTTATCTTTGGG - Exonic
978852982 4:113360222-113360244 CTGTATGCATATATGTCTTTTGG - Intronic
981282766 4:142978291-142978313 CTGATTAAATACATAGCTTTTGG - Intergenic
982399461 4:154950680-154950702 TTGTCTAAATAAATGACTTATGG - Intergenic
982600967 4:157448216-157448238 CTTTCTAAATTCATGCCTCTGGG + Intergenic
983092083 4:163515785-163515807 CTCTCTACTTGCATGTCTTTTGG + Intronic
983409865 4:167382627-167382649 CTCTCAAAATATATTTCTTTTGG + Intergenic
984417745 4:179482763-179482785 CTGAATAAATACATGTGGTTTGG + Intergenic
985203893 4:187512458-187512480 CTGTTTAAATACATTTCTACAGG + Intergenic
985331213 4:188837621-188837643 CTGTCGAATTACATATCTATAGG - Intergenic
986186341 5:5444702-5444724 CTATCTAAATACATGTTTCTTGG - Intronic
986678735 5:10214304-10214326 ATGTGTCAAAACATGTCTTTTGG - Intergenic
986946058 5:13022123-13022145 CTGTGTAAAAACTTCTCTTTTGG - Intergenic
987184884 5:15407218-15407240 CCATCTAAAGACATGTCTATAGG + Intergenic
989076648 5:37570717-37570739 TTGTCTGAAGAAATGTCTTTTGG + Intronic
989691420 5:44149451-44149473 CTTTCTAAATACATGTCAGATGG + Intergenic
990439545 5:55831167-55831189 CTGTGTGCATACATATCTTTTGG + Intergenic
990603539 5:57384894-57384916 CTGTCTTAAAAAATGTCTTCTGG + Intergenic
992208155 5:74451437-74451459 CTGTCTAATTCCTAGTCTTTTGG - Intergenic
992529651 5:77641972-77641994 CTGTCTAAATAAATTTTATTAGG - Intergenic
993607498 5:90011410-90011432 CTGTCTCAATGCATCCCTTTAGG + Intergenic
994777489 5:104052584-104052606 CTTTATAAAGACATGTCTTTGGG + Intergenic
997166905 5:131670649-131670671 ATTACTAAATAAATGTCTTTTGG - Intronic
998477659 5:142435172-142435194 TTGTTTAAAAACATGTATTTGGG - Intergenic
998784375 5:145692694-145692716 TTTTTTAAATACTTGTCTTTTGG - Intronic
998891494 5:146751046-146751068 CTGTGTAAATCCACTTCTTTGGG - Intronic
1003327261 6:5101259-5101281 CTATTTACATACATGTCTTAAGG + Intergenic
1006561222 6:34914268-34914290 ATGTCTACATAAATTTCTTTGGG - Intronic
1006810223 6:36815584-36815606 CTGTGTAAATAAATTTCTGTTGG + Intronic
1008004332 6:46393983-46394005 CTGTGGAAATTCATGTCCTTAGG + Intronic
1008178316 6:48295330-48295352 CTACCTATATACATGTGTTTTGG + Intergenic
1009843159 6:69102501-69102523 CTGTTTAAATACATGGCATTAGG + Intronic
1010067599 6:71703133-71703155 CTTTCTAAATAGGTGTCTTGTGG + Intergenic
1011882418 6:92046035-92046057 CTGCCTCAATATATGTCATTCGG + Intergenic
1013254775 6:108373495-108373517 ATGTGCAAATGCATGTCTTTTGG + Intronic
1013937556 6:115616515-115616537 CTGTCTAAATACTTCTCTCTTGG - Intergenic
1015881094 6:137870595-137870617 CTTTATAAATACTTCTCTTTGGG + Intronic
1016810339 6:148254984-148255006 TTGTATAAATACATCTCATTTGG - Intergenic
1017885397 6:158595471-158595493 ATATCTAAATACAAGTCTTTTGG - Intronic
1020859986 7:13479854-13479876 CTGTTTAAATGCATATATTTTGG - Intergenic
1022860463 7:34361720-34361742 GTGTCTACATGCATGTGTTTGGG + Intergenic
1023359793 7:39403808-39403830 CTTTATACATACATATCTTTTGG - Intronic
1024497717 7:50067405-50067427 CTGTGTAAATATTTGTCCTTTGG + Intronic
1026798177 7:73379043-73379065 CTATCTAAATATATATATTTAGG + Intergenic
1027377485 7:77566717-77566739 CTGTCTCAATAAAGATCTTTAGG + Intronic
1027797924 7:82716761-82716783 CTCTCTAAATACATGTCTGTAGG - Intergenic
1031356691 7:120796067-120796089 CTTTGTAAATACATTTTTTTTGG - Intronic
1032425124 7:131816443-131816465 CTGTGTAAACACATGTGTATGGG + Intergenic
1032930721 7:136666137-136666159 CTTACTAACTACATGACTTTGGG + Intergenic
1033140096 7:138818321-138818343 CTTACTATATACATGACTTTGGG - Intronic
1035737627 8:1900208-1900230 CTGTCTAAAAGAATGTATTTCGG - Intronic
1040802373 8:51357429-51357451 CTGTATAATTACTTATCTTTGGG - Intronic
1043124818 8:76377867-76377889 CTATCTATATACATTTCATTAGG + Intergenic
1043947687 8:86273027-86273049 GTCTCTAAATACATGCCCTTTGG + Intronic
1046039197 8:108881401-108881423 GTGTCTAAATACATTCTTTTTGG + Intergenic
1046226783 8:111292140-111292162 ATGTCTAAAAATATGTCTCTGGG + Intergenic
1046795584 8:118368047-118368069 CCCTCAAAAAACATGTCTTTTGG + Intronic
1047123053 8:121927910-121927932 CTGTGTAGTCACATGTCTTTGGG - Intergenic
1048815943 8:138333697-138333719 CTTTCTCAATTCATGTCTTGAGG - Intronic
1048876910 8:138843738-138843760 CTGAATAAATAAATGTGTTTTGG - Intronic
1057523828 9:95782632-95782654 ATGTCTAAATGCAAGGCTTTTGG + Intergenic
1058753320 9:108060613-108060635 TTGCCTAAATACAAGGCTTTTGG + Intergenic
1203462129 Un_GL000220v1:50960-50982 CTGTATAAATATTGGTCTTTTGG + Intergenic
1187124767 X:16444885-16444907 CTGTCTGTATCCATGCCTTTGGG - Intergenic
1187231459 X:17427358-17427380 CTGCCAAAATACGTGTCTCTGGG + Intronic
1187288283 X:17927330-17927352 CAGTCTAAATATATGTCAATGGG - Intergenic
1187899537 X:24014656-24014678 CTGTCTTTACATATGTCTTTGGG - Intronic
1193385208 X:80862202-80862224 CAGTCTATGTACATGTTTTTAGG + Intergenic
1193954964 X:87848650-87848672 CTGTCTAAATAGATGTGATAAGG + Intergenic
1194138327 X:90176076-90176098 TTGGCTAAATAAATGACTTTTGG - Intergenic
1194291347 X:92075856-92075878 CTTACTAAATGCATGTCTTGGGG - Intronic
1194880552 X:99245784-99245806 CTGACTAGATACTTTTCTTTTGG - Intergenic
1195614583 X:106902421-106902443 TTGTCTATTTACTTGTCTTTGGG + Intronic
1196089983 X:111730032-111730054 CTGATTAACTACATGACTTTAGG - Intronic
1197126616 X:122954496-122954518 CTGTGTCAAGAGATGTCTTTTGG - Intergenic
1199150714 X:144482315-144482337 CTTTCTAAATACATGATTATTGG + Intergenic
1199838643 X:151620538-151620560 TTGTCTAAATAAATGATTTTTGG + Intronic
1200484125 Y:3746315-3746337 TTGGCTAAATAAATGACTTTTGG - Intergenic
1200608862 Y:5300441-5300463 CTTACTAAATGCATGTCTTGGGG - Intronic