ID: 903807934

View in Genome Browser
Species Human (GRCh38)
Location 1:26018692-26018714
Sequence GAATAGAAGTAGTTGGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 1, 2: 1, 3: 34, 4: 234}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903807934_903807936 -2 Left 903807934 1:26018692-26018714 CCAGAATCCAACTACTTCTATTC 0: 1
1: 1
2: 1
3: 34
4: 234
Right 903807936 1:26018713-26018735 TCATCCCACCCCTGCCATCCTGG 0: 1
1: 0
2: 1
3: 35
4: 480
903807934_903807944 16 Left 903807934 1:26018692-26018714 CCAGAATCCAACTACTTCTATTC 0: 1
1: 1
2: 1
3: 34
4: 234
Right 903807944 1:26018731-26018753 CCTGGTCCCAGCCACCGCAGTGG 0: 1
1: 0
2: 0
3: 26
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903807934 Original CRISPR GAATAGAAGTAGTTGGATTC TGG (reversed) Intergenic
900523715 1:3118467-3118489 AGCTAGAAGTGGTTGGATTCCGG + Intronic
903807934 1:26018692-26018714 GAATAGAAGTAGTTGGATTCTGG - Intergenic
906349562 1:45046348-45046370 GATGAGCAGTAGTTGGATTCTGG + Intronic
906440017 1:45833815-45833837 AAAGAGAAGAAATTGGATTCAGG - Intronic
910252738 1:85215246-85215268 GAATAGTAGAAGGTGGATTGTGG + Intergenic
910782179 1:90951106-90951128 GATGAGAAGTGATTGGATTCTGG - Intronic
911127011 1:94350105-94350127 CAATAGCAGTAGTTAGATACTGG - Intergenic
911216964 1:95205250-95205272 GAAGAGAAATGGATGGATTCAGG + Intronic
911831500 1:102555378-102555400 GGAAAGAACTAGTTGAATTCTGG + Intergenic
912460283 1:109826184-109826206 AAATAGAAATAGTAGGATTACGG + Intergenic
914973962 1:152340778-152340800 GAAAAGAAGTTATTGGATTTGGG + Intergenic
916149663 1:161774378-161774400 AATGAGAAGTAGTTGGATTATGG + Intronic
916560600 1:165931361-165931383 GTTGAGAAGTGGTTGGATTCTGG - Intergenic
918065140 1:181095511-181095533 GGAGAGAAGTAATTGGATTATGG - Intergenic
918371253 1:183863648-183863670 GATGAGAAGTGTTTGGATTCAGG + Intronic
918820301 1:189245707-189245729 GACTAGAAGTGGTTGAATTTGGG - Intergenic
918973633 1:191451079-191451101 GAAGAGAAGTAGTTTGTTTCTGG + Intergenic
921276426 1:213525212-213525234 GGAGAGAAGCACTTGGATTCTGG + Intergenic
922502506 1:226107862-226107884 GAAGAGAAGGGGTGGGATTCTGG - Intergenic
923800142 1:237201005-237201027 GAATAGAAGTAATGAGATTTGGG - Intronic
1064477219 10:15704150-15704172 GGAAAGAAGTAGATGGATTTGGG - Intronic
1064590001 10:16879711-16879733 GAATAGAGGTAGTAGTATGCTGG + Intronic
1064804830 10:19119064-19119086 CATAAGATGTAGTTGGATTCTGG + Intronic
1065715182 10:28559953-28559975 GAATAGAATGACTTGGATTAGGG + Intronic
1065853080 10:29806773-29806795 GAACCCAGGTAGTTGGATTCTGG - Intergenic
1065854304 10:29817094-29817116 GAAAAGGAGGAGTTGGATTTGGG + Intergenic
1067726833 10:48776853-48776875 GAAGAGCAGTAGTTGAATCCTGG - Exonic
1067843837 10:49702837-49702859 TAGTAGAGGTAGTTGGAGTCAGG - Intronic
1068696503 10:59973096-59973118 GATGAGAAGTGGTTAGATTCAGG + Intergenic
1070891905 10:79947391-79947413 GAAAAGAAGTATGTGGAGTCTGG + Intronic
1073975785 10:109099374-109099396 GAAGGGAAGTAATTGGATTAAGG - Intergenic
1074736337 10:116438098-116438120 AAAGAGAAGGAGTTAGATTCTGG + Intronic
1080048014 11:27829642-27829664 GATGAGAAGTGGTTGGATTCTGG + Intergenic
1081061702 11:38486808-38486830 GAAAATAAGTAGTTGGGTTTAGG + Intergenic
1081140076 11:39487726-39487748 GAATAGAATTCATGGGATTCAGG - Intergenic
1082173419 11:49033633-49033655 GAATAGAAGGAAATGAATTCAGG + Intronic
1083715439 11:64572560-64572582 GAAGGGAAGTAGGTGGATTTGGG - Exonic
1083790387 11:64980978-64981000 GAAAAGAAGTGGTCGGATTCAGG - Intergenic
1085391791 11:76185882-76185904 GTTGAGAAGTGGTTGGATTCTGG - Intergenic
1085937216 11:81162111-81162133 GAATATAAGCAGTCGTATTCAGG - Intergenic
1086692342 11:89802422-89802444 GAATAGAAGGAAATGAATTCAGG - Intronic
1086713458 11:90037237-90037259 GAATAGAAGGAAATGAATTCAGG + Intronic
1089239869 11:117068321-117068343 GAATAGATGAATTTGGATTGGGG - Intronic
1090091678 11:123703535-123703557 GGACAGAAGTAGCAGGATTCGGG + Intergenic
1090742149 11:129674091-129674113 GACAAGAAGTGGTAGGATTCGGG + Intergenic
1090846861 11:130536667-130536689 TGAAAGAAGTGGTTGGATTCTGG + Intergenic
1093073743 12:14735542-14735564 GGTGAGAAGCAGTTGGATTCTGG - Intergenic
1093656381 12:21699248-21699270 GGATAAAAGTAGGTTGATTCTGG + Intronic
1093779912 12:23123030-23123052 AGGTGGAAGTAGTTGGATTCTGG + Intergenic
1095453888 12:42361749-42361771 GAATAGAATTAATTTAATTCTGG + Intronic
1096770224 12:53930961-53930983 GAAGAGAAGGAGTTAGATGCTGG + Intergenic
1097258339 12:57697403-57697425 GATGGGAAGTAGTTGGATTCTGG + Intronic
1098424844 12:70350776-70350798 GAACAGAAGTGTTTGGATTTTGG - Intronic
1098498909 12:71167651-71167673 GAAGAGAAGTGAATGGATTCAGG + Intronic
1099095637 12:78371413-78371435 GAATAGTTGTAGTGGGATTTCGG - Intergenic
1099097863 12:78398078-78398100 GAAGAGAAGTGGATGGATTCAGG - Intergenic
1099338533 12:81396854-81396876 CAATGGAAGTGGTAGGATTCTGG + Intronic
1099652675 12:85448211-85448233 GAGAAGAAGTGGTTAGATTCTGG + Intergenic
1099783627 12:87232761-87232783 GAATAGAAAAATTTGGAATCTGG + Intergenic
1100087075 12:90924400-90924422 GGTGAGAAGTAGTTAGATTCTGG + Intronic
1101139674 12:101782496-101782518 GATAAGAAGTGGTTGGATTCTGG - Intronic
1101707341 12:107232835-107232857 GGTGAGAAGTGGTTGGATTCTGG - Intergenic
1103364410 12:120370826-120370848 GAATAAAAGGTGTTGAATTCAGG - Intergenic
1104000051 12:124854613-124854635 GGTGAGAAGTAGTTGGAATCTGG + Intronic
1107587839 13:41871122-41871144 GATAAGAAGTAGTTGCATTTGGG - Intronic
1107588288 13:41876078-41876100 GATAAGAAGTAGTTGGATTTGGG - Intronic
1107714743 13:43189075-43189097 GATGAGAAGTTATTGGATTCTGG - Intergenic
1107756570 13:43629823-43629845 GAAAAGAAGTAATGGTATTCAGG + Intronic
1107766670 13:43742732-43742754 GGAGAGAAGTGGTTGAATTCTGG + Intronic
1109242462 13:59906423-59906445 GAAAAGAGGTAGTGGGATACGGG + Intronic
1110675067 13:78232826-78232848 TCAGAGAAGTACTTGGATTCTGG - Intergenic
1113522193 13:110949075-110949097 GAAGAGGAGGAGTGGGATTCTGG + Intergenic
1115675642 14:35670219-35670241 GAATAGAAGGAGTTCTATTTGGG - Intronic
1115800157 14:36984184-36984206 GAATAGTGGCAATTGGATTCTGG + Intronic
1116913793 14:50500721-50500743 AAAGACAAGTAGATGGATTCAGG + Intronic
1117323705 14:54648938-54648960 GGAGACAAGTGGTTGGATTCTGG + Intronic
1117862777 14:60110171-60110193 GAATTGAAGTGGTTGGAGACAGG + Intronic
1120164557 14:81182524-81182546 GGTGAGAAGTAGTTGGATTTTGG - Intronic
1121391862 14:93582686-93582708 GAATAGAAGCAGTGGGGCTCTGG + Intronic
1121752178 14:96366065-96366087 AGTTAGAAGCAGTTGGATTCTGG + Intronic
1121929649 14:97960828-97960850 GAATAGCAGTAGTCGTCTTCTGG - Intronic
1122250783 14:100437956-100437978 AGAAAGAAGTAGTTGGAGTCTGG + Intronic
1125043079 15:35214529-35214551 GATGAGAAGTGGTTGGATTCTGG - Intergenic
1125064189 15:35462136-35462158 GATGAGAAGTGGTTGGAATCTGG - Intronic
1127474926 15:59324203-59324225 GAATAGAATTAATTGGAGTCTGG - Intronic
1129004296 15:72359216-72359238 GAAGAGGAGTAGCTGGAATCTGG - Intronic
1129636945 15:77330264-77330286 GATGAGAAGTAGTTTGATTCTGG - Intronic
1131159925 15:90099044-90099066 GTGAAGAAGTGGTTGGATTCTGG - Intronic
1131450837 15:92538469-92538491 GATGAGAAGTGATTGGATTCAGG + Intergenic
1132123500 15:99198422-99198444 GAAGAGAAGTAGATGGATATAGG - Intronic
1133038839 16:3049235-3049257 GGCCAGAAGTAGTTGGATTCGGG + Intronic
1133537252 16:6714032-6714054 GAAGAGAAGTCATTGGATTGTGG + Intronic
1133711151 16:8402214-8402236 GGAGAGAAGTTGTTGAATTCTGG + Intergenic
1134130134 16:11643652-11643674 GAAAAGAAGTAGATGAATTGAGG - Intergenic
1134416205 16:14045621-14045643 GAATCCAAGCAATTGGATTCTGG - Intergenic
1134423376 16:14115309-14115331 GACTTGAAGTAGTAGGATTTGGG - Intronic
1134433856 16:14236890-14236912 TAACAGAAGTGGTTGGATTCTGG + Intronic
1134860456 16:17555858-17555880 GAACAGAAGAATGTGGATTCTGG + Intergenic
1135870855 16:26148979-26149001 GATGAGAGGTAGCTGGATTCTGG - Intergenic
1136452755 16:30363237-30363259 GGGGAGAAGTGGTTGGATTCTGG - Intronic
1139745317 16:69069485-69069507 AAACAGAACTAGTCGGATTCTGG + Intronic
1140131698 16:72167570-72167592 GAAGAGTGGTAGTTTGATTCTGG + Intronic
1141055482 16:80809958-80809980 GAAGAGATGTAGTTGGATTGAGG + Intergenic
1144144906 17:12388028-12388050 GATGAGAAGTAGATGGATTCAGG + Intergenic
1146390761 17:32420453-32420475 GGAAAGAAGTAGTTGGAATTAGG - Intergenic
1146621133 17:34398816-34398838 GAATTGAAGTAGATAGAATCTGG + Intergenic
1147340834 17:39752481-39752503 GAAAAGAAGGAGTTAGATCCTGG + Intergenic
1150239254 17:63618910-63618932 GATGAGAAGTGGTTGGATTCAGG + Intergenic
1154122362 18:11662274-11662296 GAATAGATGTACGTGGATACTGG - Intergenic
1155569632 18:27177966-27177988 AAATTGAAGTTGTTGGATTGGGG - Intronic
1156235717 18:35202153-35202175 GGATAGAAGTGGATGAATTCAGG + Intergenic
1156954390 18:42943911-42943933 AGAAAAAAGTAGTTGGATTCTGG - Intronic
1157391812 18:47309402-47309424 GATGAGAAGCAGTTGGGTTCTGG + Intergenic
1157971863 18:52279651-52279673 AAATAAAAGTAGTTGGGTTGTGG + Intergenic
1158150660 18:54365519-54365541 GATAAGAAGGGGTTGGATTCTGG + Intronic
1158191361 18:54832218-54832240 CAAGAGAAGTAGATAGATTCAGG + Intronic
1158255517 18:55543700-55543722 GAATAAAAGCAGTTAGTTTCTGG - Intronic
1158366284 18:56740722-56740744 GAAGATAAGAAGTAGGATTCAGG - Intronic
1158825437 18:61213291-61213313 AAATAGAACTGTTTGGATTCAGG + Intergenic
1160151117 18:76395002-76395024 GAGCAGAAGGAGTTGGAATCGGG - Intronic
1165202638 19:34157793-34157815 GAATAAAAATACTTGGATTTAGG + Intergenic
1166651889 19:44581185-44581207 GGTGAGAAGTGGTTGGATTCTGG - Intergenic
1167780420 19:51595247-51595269 GGAGAGAAGTGGTTAGATTCTGG - Intergenic
926594537 2:14776005-14776027 AAATATAAGTAGTTGGGATCAGG + Intergenic
926773917 2:16403479-16403501 GAAGAGAAGTAGAAGGATTGGGG - Intergenic
927827673 2:26320194-26320216 GAATAGAAATAGTTTGATAATGG + Intronic
928985166 2:37173747-37173769 GATGAGAAGAGGTTGGATTCTGG - Intronic
929418227 2:41765698-41765720 GGATAGAGGTAGCTGGAGTCAGG + Intergenic
929461943 2:42108810-42108832 GGCAAGAAGTGGTTGGATTCTGG - Intergenic
929834789 2:45385573-45385595 GATGAGAAGTGGTGGGATTCTGG - Intergenic
930809255 2:55523493-55523515 TAATAGAAATAGTTGAAGTCAGG - Intronic
932879369 2:75486581-75486603 GGAGAGAAGTGGTTGGATTATGG + Intronic
936986554 2:118316367-118316389 TAATAGAAGTGGTTTGCTTCAGG - Intergenic
938178336 2:129156771-129156793 GAAAAAAAGTATATGGATTCTGG + Intergenic
939382720 2:141457122-141457144 GGACAGAAGTAGGTGAATTCTGG + Intronic
940165297 2:150764233-150764255 GGAGAGAAGTAGTTGAATTTGGG - Intergenic
941623324 2:167803508-167803530 GAAAACATGTTGTTGGATTCTGG + Intergenic
941663883 2:168223966-168223988 TAATAGAAGTAATTTGACTCTGG - Intronic
942090799 2:172488901-172488923 GAAAAGAAGTCTTTGGGTTCTGG + Intronic
944019356 2:195083203-195083225 TAATAGAAGTATTTGGACTAAGG + Intergenic
946001323 2:216485044-216485066 GATGAGAAGTGGTTGGGTTCTGG + Intergenic
1171120156 20:22561591-22561613 GAATAGAGGTTGCTGGACTCAGG - Intergenic
1172407288 20:34699344-34699366 GAATAGAAGTTCTTGGAATATGG + Intronic
1172554241 20:35827064-35827086 GCATAGAAGTATTTTGCTTCTGG + Intronic
1172681291 20:36717734-36717756 GCATAGAAGTAGATGGCTTGAGG - Intronic
1172796806 20:37545649-37545671 GGTGAGATGTAGTTGGATTCTGG - Intergenic
1172954978 20:38749734-38749756 CATTAGAAGCAGTTGGATTCTGG + Intronic
1177629028 21:23702605-23702627 GATTAGAAGTAGTTGTATCATGG - Intergenic
1177944214 21:27447029-27447051 TGATAGAAGTAGTTGGATAATGG - Intergenic
1178211727 21:30542250-30542272 GAAGAGAAGTCCTTGGGTTCTGG - Intronic
1178987782 21:37323297-37323319 GAATGGAAGTAGCAGGCTTCTGG + Intergenic
1183075416 22:35423569-35423591 GAGCAGAGGTGGTTGGATTCTGG + Intronic
1183240718 22:36656443-36656465 GATGAGAAGTGGTTGGATTCGGG - Intronic
949388192 3:3529137-3529159 GAACAGAAGCAGATAGATTCTGG - Intergenic
950586919 3:13899265-13899287 GAATAAAAGTGGTTGAATTTTGG + Intergenic
951449825 3:22824920-22824942 CCATGGAAGTGGTTGGATTCTGG - Intergenic
951727546 3:25776802-25776824 GGAGAGAAGTAGATGGATCCAGG - Intronic
951730750 3:25808010-25808032 TAAAAGAAGTGGATGGATTCCGG - Intergenic
952722846 3:36551205-36551227 GTATAGAAAAAGATGGATTCAGG - Intergenic
953003060 3:38952322-38952344 GAAAAGAAGCAGTAGTATTCAGG + Intergenic
954994401 3:54868097-54868119 GAAAAGAGGTAGGTGGATTTAGG + Intronic
955827680 3:62965443-62965465 GAACAGAAGAAGTTGACTTCAGG - Intergenic
956138234 3:66119887-66119909 TGATAGAAGCGGTTGGATTCTGG + Intergenic
958631622 3:96690745-96690767 GAAAATAAGTAGTTTGGTTCTGG + Intergenic
959268613 3:104175162-104175184 GAATATATGTAGTTTTATTCTGG - Intergenic
960979577 3:123210290-123210312 GAATAGAAGTAGTTAGATTGGGG + Intronic
963044240 3:141090910-141090932 GGTGAGAAGTAGTTGGATGCTGG + Intronic
963730405 3:148965813-148965835 GAATAGAAGTAGATGGGATAGGG - Intergenic
963831782 3:150016421-150016443 GAAGAGGAGTGGGTGGATTCAGG + Intronic
964386848 3:156156513-156156535 GGTGAGAAGTAGTTGGATTCTGG + Intronic
964432096 3:156617907-156617929 GGTGAGAAGTAGCTGGATTCTGG + Intergenic
964513866 3:157484493-157484515 GAAAACAAGAACTTGGATTCAGG + Intronic
967354714 3:188555495-188555517 GATAAGAAGTAGTGGGATTCTGG + Intronic
967661551 3:192116713-192116735 GATGGAAAGTAGTTGGATTCTGG - Intergenic
967856206 3:194119362-194119384 GGAAAGAGGTAGTTGGATTTTGG - Intergenic
968014522 3:195317441-195317463 TATGAGTAGTAGTTGGATTCTGG - Intronic
974090757 4:57308430-57308452 TAAAAGAAGTAGATGGCTTCTGG + Intergenic
974175176 4:58313128-58313150 GAATAGAAGTAAATATATTCAGG - Intergenic
974664765 4:64945613-64945635 GAAGAGAAGTAGTTGCTGTCAGG - Intergenic
975258319 4:72266510-72266532 TAATCGAAGCAGTTTGATTCAGG + Intergenic
976092034 4:81469116-81469138 TATTAGTAGTAGTTGAATTCAGG - Intronic
978532162 4:109726451-109726473 AATGAGAAGTAGTTGGATTTTGG - Intronic
978880410 4:113695634-113695656 GGTGAGAAGTAGTTGTATTCTGG - Intronic
979320361 4:119316084-119316106 GATGGGAAGTGGTTGGATTCTGG + Intergenic
979567890 4:122177296-122177318 GGGGAGAAGTAGTTGGATTCTGG - Intronic
980401455 4:132291580-132291602 GAAGAGAAGTGGTCGGATTCTGG - Intergenic
980690539 4:136290778-136290800 GGTGAGAAGTGGTTGGATTCTGG + Intergenic
984504388 4:180598674-180598696 GATGAGAAGTGTTTGGATTCTGG - Intergenic
987555163 5:19437073-19437095 AAAAAGAGGTAGTTGGGTTCTGG - Intergenic
988655481 5:33206824-33206846 GAAAAGAAGTAGTTTTATCCAGG + Intergenic
989671383 5:43920924-43920946 GAATTGAAGTCTTTGGGTTCTGG + Intergenic
990929903 5:61076846-61076868 GGAAAGAAGAAGTTGCATTCCGG + Intronic
991188900 5:63845409-63845431 GAGAAGAAGTAGTGGGATTCTGG - Intergenic
991345713 5:65665064-65665086 AAAAAGAAGCAGTTGGACTCGGG + Intronic
991399743 5:66240226-66240248 GGAAAGATGTGGTTGGATTCTGG + Intergenic
991472544 5:66984682-66984704 GGAGAGAAGTAGATGGATTCAGG + Intronic
991772122 5:70050132-70050154 GAGTGAAAGTATTTGGATTCTGG + Intronic
991851415 5:70925550-70925572 GAGTGAAAGTATTTGGATTCTGG + Intronic
992250784 5:74874033-74874055 GAAGAGAAGTAAATAGATTCTGG + Intergenic
992358270 5:76008590-76008612 GATGAGCAATAGTTGGATTCTGG - Intergenic
992877801 5:81075171-81075193 CAGTATAAGTAGTTGGATTCTGG + Intronic
993714273 5:91259500-91259522 GGAGAGAAGAATTTGGATTCTGG - Intergenic
995009144 5:107238618-107238640 GATGAGAAGCAGTTGGATTAGGG + Intergenic
995373036 5:111441387-111441409 GAAAAGAAATAGTAGGAGTCAGG - Intronic
995772720 5:115689659-115689681 GAATAGAAGTGGTTGAAAGCAGG + Intergenic
996411275 5:123161973-123161995 GGTGAGAAGTAGTTGGATTCTGG + Intronic
998188647 5:140002865-140002887 GATGAGAACTAGTTGGATTCTGG + Intronic
999055185 5:148567267-148567289 GATGAGAAGTGGTTAGATTCAGG - Intronic
999817436 5:155191740-155191762 GAAAGGAAGTGGTTGGATTATGG - Intergenic
1000261769 5:159595272-159595294 GAATGGAAGTAGTTGGAATGAGG + Intergenic
1000882889 5:166717562-166717584 AATAAGAAGTAGTTGGGTTCAGG + Intergenic
1000972816 5:167733480-167733502 GAATAGAGGTAGTAGTATGCTGG - Intronic
1002618352 5:180469192-180469214 GAAGAGAAGTGGATGGATTTGGG + Intergenic
1003290064 6:4772856-4772878 GAATAGTAGTAGCTAGATTTTGG + Intronic
1003623116 6:7719748-7719770 ACAGAAAAGTAGTTGGATTCTGG - Intergenic
1004311187 6:14546668-14546690 TATTAGAAGTACTTGGGTTCTGG - Intergenic
1006381444 6:33700157-33700179 AAATGGAAGTAGTTGAAATCAGG - Intronic
1006382768 6:33710147-33710169 AGATGGAAGTGGTTGGATTCAGG - Intronic
1006503633 6:34474285-34474307 GACAAGAAGTGGGTGGATTCTGG - Intronic
1008102376 6:47405782-47405804 GAAAAGAATTAGATGAATTCTGG + Intergenic
1008756648 6:54803713-54803735 TAATAGAAGTGGATGAATTCAGG + Intergenic
1009194203 6:60665025-60665047 GAAAAGAAGTCAATGGATTCAGG - Intergenic
1012071334 6:94621200-94621222 GAATACAAGCAGTGGGATGCTGG + Intergenic
1012652771 6:101777642-101777664 GAATAGAAGTTTATGAATTCTGG - Intronic
1013053670 6:106562291-106562313 GAACAGAAGTAGTTGTAATATGG + Intronic
1014300523 6:119675944-119675966 AGAGGGAAGTAGTTGGATTCTGG + Intergenic
1014635212 6:123837490-123837512 AGTGAGAAGTAGTTGGATTCTGG - Intronic
1015300210 6:131644437-131644459 GGTAAGAAGTATTTGGATTCTGG + Intronic
1016651888 6:146471209-146471231 AAATAAATGTAGTTGGATCCTGG - Intergenic
1018514632 6:164565254-164565276 GAACAGAAGTAATGTGATTCTGG + Intergenic
1019691050 7:2412443-2412465 GAAAAGAAGTAGGTAGTTTCTGG + Intronic
1021526640 7:21595430-21595452 GATTAGAAGTAGTTGGATTCTGG + Intronic
1022759104 7:33327749-33327771 GGTGAGAAGTGGTTGGATTCTGG + Intronic
1022891668 7:34707378-34707400 TAATAGAAATAGCTGGCTTCTGG + Intronic
1025034359 7:55584054-55584076 GGAGAGAAGTAGTTAGATTCTGG + Intergenic
1027876068 7:83770348-83770370 GAAAAGAACTAGTTTTATTCTGG - Intergenic
1028441629 7:90869690-90869712 GAAGAGAAATGGTTGGATTCTGG + Intronic
1030485750 7:110165101-110165123 GAAGAAAAGTAGGTGGATTTTGG - Intergenic
1031117406 7:117683148-117683170 GCATAGAAGTAGGTGGTTTCTGG - Intronic
1032669544 7:134070410-134070432 GAATAGGATTAGTTGTTTTCAGG - Intergenic
1033001910 7:137514738-137514760 GGAGAGAATCAGTTGGATTCTGG - Intronic
1034138803 7:148797485-148797507 GACTAGAAGTGTTTGGATTTCGG - Intronic
1034357944 7:150468123-150468145 GGAGAGAAGCAGGTGGATTCTGG - Intronic
1042075828 8:64993660-64993682 AAATAAAAGTGGTTAGATTCAGG - Intergenic
1045910748 8:107406532-107406554 TAATTGATGTAGTTTGATTCTGG - Intronic
1045954169 8:107887681-107887703 GGAAAGAAGTGGTTGGATTCAGG - Intergenic
1047851638 8:128863626-128863648 GAAAAGAATCAGTTGGAATCAGG + Intergenic
1048766023 8:137845600-137845622 GAATTGAAGGACTTGGATGCAGG + Intergenic
1049238569 8:141525148-141525170 GTAGAGAAGTGGGTGGATTCGGG + Intergenic
1049973956 9:844262-844284 GACTAGAAGTAGTTGTTTTATGG - Intronic
1050253719 9:3772445-3772467 GGAAAGAAGTGGTTGAATTCTGG - Intergenic
1051598246 9:18846763-18846785 GGACAGAAGTAGATGAATTCAGG + Intronic
1052757875 9:32559282-32559304 GATGAGAACCAGTTGGATTCAGG - Intronic
1054887521 9:70214733-70214755 GAAGAGAAGTGACTGGATTCTGG + Intronic
1055080483 9:72263927-72263949 GGAAGGAAGTGGTTGGATTCTGG + Intergenic
1057692857 9:97301863-97301885 CAATAGGAGTATTTGGATTTTGG - Intergenic
1057987199 9:99729491-99729513 GTTGAGAAGTGGTTGGATTCTGG - Intergenic
1058660838 9:107267170-107267192 GGATACAAGTTATTGGATTCAGG + Intergenic
1187687085 X:21826485-21826507 GGTGAGAAGTAGTTGGATTTGGG - Intergenic
1189537955 X:41955969-41955991 GAGAAGAAGTAGCTGGATTCTGG - Intergenic
1190018250 X:46848131-46848153 GAATAGAAGTAAAAAGATTCAGG - Intronic
1192360779 X:70437727-70437749 GATGATAAGTGGTTGGATTCTGG - Intergenic
1196856254 X:119988011-119988033 GAAGAAAAGTGGTTGAATTCAGG - Intergenic
1197143861 X:123148776-123148798 GAATAGAAGTGGTTGGAAGAGGG - Intergenic
1197315933 X:124966100-124966122 GAAGAGATCTGGTTGGATTCTGG - Intergenic
1197859238 X:130951483-130951505 AGAGAGAAGCAGTTGGATTCTGG - Intergenic
1198108234 X:133480903-133480925 GATGAGAAGTAGTCAGATTCTGG + Intergenic
1198651875 X:138872099-138872121 GGGAAGAAGTAGTTAGATTCTGG + Intronic
1199138219 X:144278525-144278547 GGAGAGAAGTGGTAGGATTCTGG + Intergenic
1199496186 X:148455084-148455106 AAAGAGAAGTAGATGGATTCAGG + Intergenic
1202138230 Y:21689449-21689471 AAACTGAAGTAGTTGGAGTCTGG - Intergenic