ID: 903808297

View in Genome Browser
Species Human (GRCh38)
Location 1:26020895-26020917
Sequence GGATGGGCATAATGTCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 100}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903808297_903808300 -10 Left 903808297 1:26020895-26020917 CCTGGCTGACATTATGCCCATCC 0: 1
1: 0
2: 0
3: 9
4: 100
Right 903808300 1:26020908-26020930 ATGCCCATCCCAGAGATAAGGGG 0: 1
1: 0
2: 2
3: 8
4: 152
903808297_903808303 -3 Left 903808297 1:26020895-26020917 CCTGGCTGACATTATGCCCATCC 0: 1
1: 0
2: 0
3: 9
4: 100
Right 903808303 1:26020915-26020937 TCCCAGAGATAAGGGGACAGAGG 0: 1
1: 0
2: 1
3: 36
4: 324
903808297_903808310 22 Left 903808297 1:26020895-26020917 CCTGGCTGACATTATGCCCATCC 0: 1
1: 0
2: 0
3: 9
4: 100
Right 903808310 1:26020940-26020962 CAACACCCCCGAGGCAGTCAGGG 0: 1
1: 0
2: 2
3: 8
4: 77
903808297_903808306 13 Left 903808297 1:26020895-26020917 CCTGGCTGACATTATGCCCATCC 0: 1
1: 0
2: 0
3: 9
4: 100
Right 903808306 1:26020931-26020953 ACAGAGGCCCAACACCCCCGAGG 0: 1
1: 0
2: 0
3: 7
4: 97
903808297_903808311 23 Left 903808297 1:26020895-26020917 CCTGGCTGACATTATGCCCATCC 0: 1
1: 0
2: 0
3: 9
4: 100
Right 903808311 1:26020941-26020963 AACACCCCCGAGGCAGTCAGGGG 0: 1
1: 0
2: 0
3: 5
4: 97
903808297_903808315 29 Left 903808297 1:26020895-26020917 CCTGGCTGACATTATGCCCATCC 0: 1
1: 0
2: 0
3: 9
4: 100
Right 903808315 1:26020947-26020969 CCCGAGGCAGTCAGGGGAAGAGG 0: 1
1: 0
2: 2
3: 18
4: 313
903808297_903808309 21 Left 903808297 1:26020895-26020917 CCTGGCTGACATTATGCCCATCC 0: 1
1: 0
2: 0
3: 9
4: 100
Right 903808309 1:26020939-26020961 CCAACACCCCCGAGGCAGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903808297 Original CRISPR GGATGGGCATAATGTCAGCC AGG (reversed) Intronic
900849137 1:5128345-5128367 TGATGGGCACAATTGCAGCCAGG - Intergenic
902043443 1:13508963-13508985 GGAAGGGCATCATGGCAGGCAGG - Intronic
903808297 1:26020895-26020917 GGATGGGCATAATGTCAGCCAGG - Intronic
904810607 1:33161254-33161276 GGATGGGCAGGATGTCAGTTGGG + Intronic
907415277 1:54310146-54310168 AGACGGGCATCTTGTCAGCCGGG - Intronic
912544442 1:110440705-110440727 GGATGGGCATCATGGCAGGATGG + Intergenic
913052210 1:115127468-115127490 AGATGGGGAAAAAGTCAGCCAGG + Intergenic
914411459 1:147432560-147432582 GGATGGGCATAAAATAAACCAGG - Intergenic
917041957 1:170814887-170814909 GGAAGGGCATAGTGTTGGCCAGG + Intergenic
920399025 1:205665650-205665672 GGCTGGGCATCCTGTCAGCTTGG - Intronic
920540703 1:206775847-206775869 GGATGGATAGAATGTCAGCCTGG + Intergenic
923038319 1:230301035-230301057 GGCTGGGCATAAAGACAGCCCGG + Intergenic
923679915 1:236111020-236111042 AGTTGGTCATAATGGCAGCCAGG - Intergenic
1065303965 10:24351377-24351399 GCATGGTCATAATGACTGCCAGG - Intronic
1067052112 10:43027699-43027721 GGATGGGCATAATTTGGCCCAGG - Intergenic
1071548405 10:86546445-86546467 GATTGGGCCTACTGTCAGCCTGG - Intergenic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1074910767 10:117906352-117906374 GGAGGGGGATGGTGTCAGCCAGG - Intergenic
1091358697 11:134957719-134957741 GGAAGGGCAGGATGTCAGCTTGG + Intergenic
1094046112 12:26168675-26168697 GGATGGCCATAATGCCACCACGG + Intronic
1098992496 12:77078983-77079005 TGAAAGGCAGAATGTCAGCCAGG - Intergenic
1099089851 12:78292743-78292765 GGATGAGCATTATGTAGGCCAGG + Intergenic
1100021395 12:90073683-90073705 AGATTGGCAAAATGTCAGCTTGG + Intergenic
1103221798 12:119252534-119252556 GCATGGGCATAGTGCCATCCTGG + Intergenic
1103483516 12:121266822-121266844 TGCTGGGCAAAATGTCAGCTTGG - Intronic
1103563646 12:121804887-121804909 CGATGGGCAGCATTTCAGCCTGG + Exonic
1103846122 12:123903033-123903055 GGATGGGCATGACCTCTGCCAGG - Exonic
1106644487 13:31617652-31617674 GAATGGGCATAATGTAAGGCAGG - Intergenic
1108806087 13:54158353-54158375 GGTTTGGCATAATGTCCACCTGG + Intergenic
1109269310 13:60236670-60236692 GGATTAGCAAAATGCCAGCCAGG + Intergenic
1112871115 13:103972002-103972024 GGATGGGCATAATGTGGATCGGG + Intergenic
1115075538 14:29385376-29385398 GGATGGGGATGATGTGAGCAGGG - Intergenic
1117657713 14:57973539-57973561 GGAAGGGCATGCTGTCACCCGGG + Intronic
1118117258 14:62794419-62794441 GCATGCACATAATGTCAGACAGG + Intronic
1121642263 14:95493638-95493660 GGATGGGCAAAATGCCTGCCTGG + Intergenic
1124086889 15:26559362-26559384 GCATGGCAATAATGTCTGCCCGG - Intronic
1124600899 15:31132152-31132174 GCATGGGCCTATTGGCAGCCGGG + Intronic
1127351980 15:58162299-58162321 GGAGGGGCATAATGCCCTCCCGG - Intronic
1128931563 15:71709149-71709171 GGATTGGAATAAGGACAGCCAGG + Intronic
1129060140 15:72854410-72854432 GCATGGCCAAAATGTCACCCTGG + Intergenic
1130906066 15:88241611-88241633 GGTTGGGCAGAATGCCAGCTGGG + Intronic
1133390898 16:5409083-5409105 GGGTGGGCATAATTTCTGCAGGG + Intergenic
1135357323 16:21780438-21780460 GGATGGGGAGAAGGTCAGCATGG - Intergenic
1135455827 16:22596554-22596576 GGATGGGGAGAAGGTCAGCATGG - Intergenic
1140093630 16:71856804-71856826 GGATGGGAATGTTGTCATCCAGG + Exonic
1141999127 16:87654093-87654115 AGATGTGCAGAATATCAGCCAGG - Intronic
1148127119 17:45242592-45242614 GGATGGGCATTAAGCCAGACTGG + Intronic
1153312110 18:3686930-3686952 GGGTGGGCCTAATGTCATCATGG + Intronic
1154939884 18:21101387-21101409 GGAGGTGCATAATGTCTGCCTGG - Intronic
1157619935 18:49011213-49011235 GGAGGGGCATTATGTCAGGCAGG + Intergenic
1163298636 19:16429366-16429388 GGATGGGCACACTGCCTGCCAGG + Intronic
925632214 2:5906217-5906239 GGACTGAAATAATGTCAGCCTGG - Intergenic
927011192 2:18906340-18906362 GCATGAGAAAAATGTCAGCCTGG - Intergenic
927955674 2:27205824-27205846 GGATGGGAATGATGTCAACAGGG - Intronic
928375466 2:30769901-30769923 GGATGGGCAGGATTTCAGCAAGG - Intronic
933971639 2:87474441-87474463 GGATGGGCATCATGGCCCCCTGG - Intergenic
936107096 2:109633824-109633846 TGATGTGCAAAAAGTCAGCCTGG + Intergenic
936322091 2:111475758-111475780 GGATGGGCATCATGGCCCCCTGG + Intergenic
937297241 2:120817238-120817260 GGAAGTGCGTAATGTCAGCTTGG + Intronic
948298814 2:236886472-236886494 TGGTGGGCAGAATGGCAGCCGGG + Intergenic
1173571310 20:44078258-44078280 GAATAGGAATAATGTAAGCCTGG - Intergenic
1175665144 20:60852314-60852336 GAATGGACATCATCTCAGCCAGG - Intergenic
1178199791 21:30390689-30390711 GGATGGGGACATTGTGAGCCAGG - Intronic
1180862026 22:19089023-19089045 GGATGGGGATAAGGTCAGAGAGG + Intronic
1181375439 22:22454333-22454355 GGGAGGGCATAATGTGAGCAGGG - Intergenic
1183538707 22:38417539-38417561 GGGTGGGCAGAGTGGCAGCCTGG - Intergenic
1183977084 22:41518528-41518550 AGTTGGTCATAATGGCAGCCAGG - Exonic
955765851 3:62343298-62343320 GGATGGGCAGAAAGTCAGTATGG - Intergenic
956310293 3:67871185-67871207 GGATGAGCATAGTGGCAACCAGG + Intergenic
960200124 3:114823385-114823407 TCATGGGCATAATATGAGCCAGG + Intronic
962847105 3:139282393-139282415 GGAGGGGCAGAATGTCTTCCAGG + Intronic
964312897 3:155413299-155413321 GGATGGACATTATGACAGGCTGG - Intronic
968717754 4:2174286-2174308 TGATGGGCACCACGTCAGCCAGG - Intronic
969418821 4:7077933-7077955 GGATGGGTGGAGTGTCAGCCAGG + Intergenic
972401720 4:38710626-38710648 GGATGGGCTTAATGACAGAATGG + Intergenic
974134992 4:57804032-57804054 GGGTGGGCAGAATGGCAGCAGGG + Intergenic
974854172 4:67439604-67439626 GGATGGGCTTACTGGCAGACTGG + Intergenic
978641706 4:110878513-110878535 GGAAGGGCATAATGTAAGGATGG + Intergenic
987666520 5:20949001-20949023 TGATGGGCATAATGGCAGACTGG - Intergenic
989140489 5:38196767-38196789 GGAAGGGCATGATTTTAGCCTGG + Intergenic
990697228 5:58433699-58433721 GGATGGGCATTACGGAAGCCTGG + Intergenic
992096333 5:73366369-73366391 GGCTTGGCAAAATGTCAGCTTGG - Intergenic
996453106 5:123649409-123649431 GGATGGGCATAATAACAGAAAGG + Intergenic
1000951785 5:167492947-167492969 AGCTTGGCAAAATGTCAGCCAGG + Intronic
1006214072 6:32423793-32423815 GGATGGGGATGATGTCACCGAGG + Intergenic
1006370524 6:33641197-33641219 GGCTTGGCATAATGACAGCCAGG - Intronic
1006677998 6:35777430-35777452 GGACAGGCAGAATGTCTGCCAGG - Intronic
1010731605 6:79397100-79397122 GGCAGGGCCTAAAGTCAGCCTGG - Intergenic
1015555244 6:134454328-134454350 GGATTGGCAGAACGTGAGCCAGG + Intergenic
1016995146 6:149956312-149956334 GGCTGGGCATAGTGGCAACCAGG - Intergenic
1017003464 6:150013122-150013144 GGCTGGGCATAGTGGCAACCGGG + Intergenic
1020223749 7:6263081-6263103 AGATGGACATACTGTCAGCTTGG - Intronic
1022259469 7:28690428-28690450 GGATGGGGATAATATCAAGCAGG + Intronic
1023495180 7:40787863-40787885 GGATGGGCATCATTACTGCCAGG - Intronic
1033741054 7:144276249-144276271 GGCTGGGGATAATGTGAGCAAGG + Intergenic
1033752852 7:144373365-144373387 GGCTGGGGATAATGTGAGCAAGG - Intronic
1038350805 8:26774707-26774729 GGATGGGAATAATGTCAATAAGG - Intronic
1038399929 8:27276369-27276391 GGATGGTGATAATTTCAGGCAGG - Intergenic
1041346779 8:56907290-56907312 CCCTGGGCATAATGTGAGCCTGG + Intergenic
1049274490 8:141712993-141713015 GGGTGGGGACCATGTCAGCCAGG + Intergenic
1052202005 9:25793833-25793855 AGATGGGGATTATGTCTGCCTGG - Intergenic
1057150289 9:92790708-92790730 GGATGGGTATTATGTCCGACTGG + Intergenic
1057699890 9:97356101-97356123 GCCTGGGCACAATGTCAGCAGGG + Intronic
1060451098 9:123741163-123741185 GGTTTGGCATGATTTCAGCCAGG - Intronic
1185924419 X:4130819-4130841 GGATCAGCAGAATGACAGCCAGG - Intergenic
1187593274 X:20742173-20742195 GGATGGGCATAAAGGAAGCCAGG - Intergenic
1191255241 X:58276824-58276846 GGCTGGGCATGGTGTCTGCCGGG + Intergenic
1191256041 X:58280052-58280074 GGATGGGCACAAAGGCTGCCAGG + Intergenic
1195862612 X:109397863-109397885 AGAAGGGCATAATGTCACCTCGG - Intronic
1197298365 X:124747837-124747859 GGATGGGAATGATGACAACCTGG + Intronic