ID: 903810949

View in Genome Browser
Species Human (GRCh38)
Location 1:26034875-26034897
Sequence TCTGAGGACCCTGGCAGATG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 245}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903810941_903810949 -4 Left 903810941 1:26034856-26034878 CCCACTCCCTGCCCAAGGCTCTG 0: 1
1: 1
2: 6
3: 63
4: 546
Right 903810949 1:26034875-26034897 TCTGAGGACCCTGGCAGATGAGG 0: 1
1: 0
2: 1
3: 21
4: 245
903810936_903810949 28 Left 903810936 1:26034824-26034846 CCTCTTGCCCAGGTATTACCACA 0: 1
1: 0
2: 0
3: 10
4: 108
Right 903810949 1:26034875-26034897 TCTGAGGACCCTGGCAGATGAGG 0: 1
1: 0
2: 1
3: 21
4: 245
903810944_903810949 -10 Left 903810944 1:26034862-26034884 CCCTGCCCAAGGCTCTGAGGACC 0: 1
1: 0
2: 5
3: 19
4: 295
Right 903810949 1:26034875-26034897 TCTGAGGACCCTGGCAGATGAGG 0: 1
1: 0
2: 1
3: 21
4: 245
903810938_903810949 20 Left 903810938 1:26034832-26034854 CCAGGTATTACCACACTCTCTTC 0: 1
1: 0
2: 0
3: 15
4: 156
Right 903810949 1:26034875-26034897 TCTGAGGACCCTGGCAGATGAGG 0: 1
1: 0
2: 1
3: 21
4: 245
903810942_903810949 -5 Left 903810942 1:26034857-26034879 CCACTCCCTGCCCAAGGCTCTGA 0: 1
1: 1
2: 4
3: 54
4: 557
Right 903810949 1:26034875-26034897 TCTGAGGACCCTGGCAGATGAGG 0: 1
1: 0
2: 1
3: 21
4: 245
903810937_903810949 21 Left 903810937 1:26034831-26034853 CCCAGGTATTACCACACTCTCTT 0: 1
1: 0
2: 1
3: 16
4: 186
Right 903810949 1:26034875-26034897 TCTGAGGACCCTGGCAGATGAGG 0: 1
1: 0
2: 1
3: 21
4: 245
903810939_903810949 10 Left 903810939 1:26034842-26034864 CCACACTCTCTTCACCCACTCCC 0: 1
1: 0
2: 7
3: 100
4: 1084
Right 903810949 1:26034875-26034897 TCTGAGGACCCTGGCAGATGAGG 0: 1
1: 0
2: 1
3: 21
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903810949 Original CRISPR TCTGAGGACCCTGGCAGATG AGG Exonic
900090773 1:919494-919516 TCTGAGGCCCCTAGCAGGTCGGG - Intergenic
900192052 1:1356018-1356040 TCTGAGGACCCTGGTGGAGGAGG + Intronic
900340406 1:2186093-2186115 TCTGAGCTCCCTGGGAGAGGGGG + Intronic
901664643 1:10819459-10819481 TCTGGGGACCCAGCCAGGTGTGG + Intergenic
902542130 1:17163009-17163031 ACAGAGGCCCCGGGCAGATGGGG - Intergenic
902770608 1:18643467-18643489 TTTGAGGACGCTGGAAAATGCGG + Intronic
903810949 1:26034875-26034897 TCTGAGGACCCTGGCAGATGAGG + Exonic
905220634 1:36444659-36444681 TCTGAGGACAAAGGCAGCTGGGG + Intronic
906314994 1:44780974-44780996 ACTGAGGAACATGGCAGGTGGGG - Intergenic
907045802 1:51299407-51299429 TCGGAGGATCCTGGCAGAGGGGG + Intronic
907073996 1:51562746-51562768 TCTGAGTATCCTGGCAGTTGAGG + Intergenic
910841126 1:91562047-91562069 TCTCAGGACCTTGGCTGAAGGGG - Intergenic
912434892 1:109654813-109654835 TCTGAGGAGCCAGGAAGACGGGG - Intergenic
913325757 1:117627103-117627125 CCTGGGGGACCTGGCAGATGGGG + Exonic
915016220 1:152736673-152736695 ACTGAGGACCCTGGCACTGGAGG - Intergenic
917692940 1:177487656-177487678 CCTGAGGAGGCTGGAAGATGGGG - Intergenic
918104175 1:181402295-181402317 TGTGAAGACCCTGGCAGCTGGGG + Intergenic
918450059 1:184649373-184649395 TCTCTGGACCCTGGGAGAAGAGG + Intergenic
919974285 1:202600707-202600729 GCTGAGGATGCTGACAGATGAGG + Intronic
920270504 1:204759662-204759684 TCTGAGGACCCTTCCAGCTCTGG - Intergenic
920274370 1:204793089-204793111 TATGAGGACCCAGGGAGAGGAGG - Intergenic
921217633 1:212950996-212951018 TCTGAGGACCCAGGAATGTGTGG + Intronic
922796844 1:228343659-228343681 TCTGGGGACCCTGGCAGCCCTGG - Intronic
923025508 1:230200699-230200721 TCTGAGGACTCTGGTTGGTGTGG - Intronic
924345449 1:243069082-243069104 TCTCAGGAGCATGGCAGGTGAGG + Intergenic
1063211727 10:3886953-3886975 TCTGAGAACCCTGGTATATGTGG - Intergenic
1065206038 10:23358541-23358563 TCTGAGAACGCTGGCAGTTGGGG + Intergenic
1065756521 10:28935866-28935888 ACTGAGGACCCTTGCAGGGGAGG + Intergenic
1066730892 10:38435730-38435752 TCTCAGGAGCATGGCAGGTGAGG - Intergenic
1067426926 10:46217511-46217533 TCTGAGTACCCTGACAGAGAGGG - Intergenic
1067513179 10:46912032-46912054 TATGAGGGCCTTGGCATATGGGG - Intronic
1067649074 10:48139810-48139832 TATGAGGGCCTTGGCATATGGGG + Intergenic
1067660451 10:48233248-48233270 TCTGAGGACCCTGTGGGAGGGGG + Intronic
1069903023 10:71716736-71716758 GCTAGGGACCCTGGCAGCTGCGG - Intronic
1074813941 10:117130945-117130967 GCTGAGGCCCCTGGGAGAGGAGG + Intronic
1076358591 10:129870502-129870524 TCTCTGGACCCTGGCAGCTCGGG - Intronic
1076840796 10:133044146-133044168 CCTGAGGCCCCTGGGAGTTGGGG + Intergenic
1077543745 11:3159916-3159938 TCTGCTGACCCTGGCACCTGGGG + Intronic
1078370669 11:10742068-10742090 TGCTAGGACCCAGGCAGATGGGG + Intergenic
1078655392 11:13234226-13234248 AATGAGGACCATGGCAGAAGAGG + Intergenic
1080403627 11:31959251-31959273 TCCAGGGACACTGGCAGATGAGG + Intronic
1080404026 11:31962633-31962655 TCTGAGGACAGTGGAAAATGGGG - Intronic
1080433477 11:32219282-32219304 TCAGAGGATGCTGGCAGCTGCGG - Intergenic
1081771490 11:45652856-45652878 TCTGGGGAACCTACCAGATGGGG - Intronic
1082816730 11:57514449-57514471 TCTGGGGACCTGGGCAGATGCGG - Intronic
1083365687 11:62140317-62140339 TCTGAGGGCCCTGGAGGATGTGG + Intronic
1083580712 11:63823481-63823503 TCTGAGGACCTTGCCAGAGGAGG + Intronic
1083635237 11:64117329-64117351 TCTCAGGGCCCTGGCACATGAGG - Exonic
1083661556 11:64253852-64253874 TGTGAGGACCCCGGCAGATGTGG + Intronic
1084704768 11:70809806-70809828 TCTGAGGACATTGAGAGATGGGG + Intronic
1087397640 11:97621874-97621896 TCTCAGGACTTTGGGAGATGAGG - Intergenic
1087528120 11:99344440-99344462 TATGAAGACCCTGTCAGATCAGG - Intronic
1089083326 11:115795996-115796018 GCTGTCGACCCTGGCAGATTTGG - Intergenic
1089303790 11:117514329-117514351 TCTGAGGGCCCTGTCACCTGGGG - Intronic
1091206887 11:133827765-133827787 CCTGAGGGACCTGGCACATGTGG - Intergenic
1091562720 12:1627294-1627316 TCTGAGGAGAGGGGCAGATGTGG + Intronic
1092457319 12:8655559-8655581 CCTGTGGACTCGGGCAGATGAGG + Intronic
1092487483 12:8914761-8914783 ACTGGGGACCCCGGCACATGAGG + Exonic
1096513594 12:52144926-52144948 TCTGAGGACAGTGGGAGCTGGGG - Intergenic
1096714139 12:53480996-53481018 TCTAGGGACACTGGCAGCTGTGG - Intronic
1096870037 12:54587546-54587568 TCAGAGCAGCCTGGCAGAGGGGG - Intronic
1096946689 12:55414880-55414902 ACTGGGGACCCCGGCACATGAGG - Intergenic
1097170553 12:57110460-57110482 TCAGAGGACTCGGGCAGATAGGG - Intronic
1100772002 12:97934070-97934092 TCTGAGGAGCCTGGTGAATGAGG + Intergenic
1101164072 12:102010103-102010125 TCTGTGAATCCTGGCAGCTGAGG - Intronic
1102013294 12:109632120-109632142 TCTGAGGACCCAGAAAGGTGAGG + Intergenic
1102878354 12:116465370-116465392 TGTGAAGACCCAGGCAAATGAGG - Intergenic
1104388278 12:128370059-128370081 GCAGAGGACTCTGGCAGATATGG - Intronic
1104733506 12:131122073-131122095 TCTGAGGGCCCTGGCTGGTTGGG + Intronic
1106105816 13:26732612-26732634 TCAGAGGTCCCTGGCGGAAGGGG + Intergenic
1107923637 13:45236239-45236261 TCTGTGGACTCTTGTAGATGGGG + Intronic
1110531407 13:76602868-76602890 TCTGTGTCCCCTGACAGATGTGG - Intergenic
1111827100 13:93281300-93281322 GATGAAGACACTGGCAGATGCGG + Intronic
1112221739 13:97498136-97498158 TATGAGGACCCTGACAGATTTGG - Intergenic
1112517699 13:100069687-100069709 CCTGAGGACCATGGAAGATAAGG - Intergenic
1113017109 13:105840267-105840289 TCTGAGGACACAGCCAGAGGAGG + Intergenic
1113374921 13:109756148-109756170 TCTGTGGACTCTGTTAGATGAGG - Exonic
1117457277 14:55911047-55911069 GCTGAGGCTCCTGGGAGATGGGG + Intergenic
1119662906 14:76464315-76464337 TCAGAGGGCCCTGGGAGAGGGGG - Intronic
1122902084 14:104786160-104786182 ACTCAGGACCCCTGCAGATGAGG + Intronic
1123065374 14:105616479-105616501 CCTGAGTACCATGCCAGATGGGG + Intergenic
1123069581 14:105635945-105635967 CCTGAGTACCATGCCAGATGGGG + Intergenic
1126409212 15:48354739-48354761 TATGAGGTTCCTGTCAGATGAGG + Intergenic
1127272270 15:57412507-57412529 TCCCAGGAACCTGGCTGATGCGG + Intronic
1128357499 15:66938333-66938355 TCTGAGAGCCTTGGCAGAGGAGG + Intergenic
1128539644 15:68517699-68517721 TCTGAGGGCCCAGGGAGAGGAGG + Intergenic
1128926523 15:71661173-71661195 TCTGCTGCCCCAGGCAGATGAGG - Intronic
1131484356 15:92808197-92808219 TCTGAGGACGGTGGCGGGTGGGG - Intronic
1132988118 16:2778461-2778483 GCTGAGGACCCTGGGAGCGGGGG - Intergenic
1135274255 16:21097675-21097697 TCCAAGGACCTTGGCAGCTGAGG + Intronic
1135965150 16:27029336-27029358 GCTGGAGACCCAGGCAGATGTGG + Intergenic
1137762268 16:50950285-50950307 TCTCAGCACCCTCCCAGATGGGG - Intergenic
1138332532 16:56226534-56226556 TCTGAGCACCTGGGTAGATGGGG + Intronic
1139513157 16:67438689-67438711 CCTGTGGACACGGGCAGATGTGG + Exonic
1141224770 16:82104670-82104692 CCTGAGGACCCATGAAGATGTGG - Intergenic
1141517781 16:84557772-84557794 TCTGAGGAGGCTGGGGGATGGGG + Intergenic
1141963013 16:87421815-87421837 ACTAAGGGCCCTGGCAGAAGAGG + Intronic
1142594109 17:1021250-1021272 TCTTGGGGCCCTGGCAAATGTGG - Intronic
1143105763 17:4529991-4530013 TCTCAGGCCCCGGGCAGCTGGGG + Intronic
1146125260 17:30226382-30226404 TCTGAGGAGCCGAGCACATGTGG - Intronic
1146638964 17:34526025-34526047 TCTGAGGACCTTGGAAGTTGGGG + Intergenic
1148584706 17:48769156-48769178 TCTGAGGACTCTGCAAGAGGAGG + Exonic
1148870792 17:50657926-50657948 TCAGAGGACTCTGAGAGATGAGG - Intronic
1149329439 17:55566217-55566239 TCAGTGGACCCTGGGTGATGCGG + Intergenic
1149781897 17:59404312-59404334 TGTGAGGGTCCTGGCTGATGTGG - Intergenic
1150333052 17:64309885-64309907 TCTGAGTCCTCTGGCAGCTGAGG + Intergenic
1151353564 17:73545583-73545605 TCTGAGGCCCCAGGCAGTGGTGG - Intronic
1151959872 17:77400174-77400196 ACTGAGCAGCCTGGCTGATGTGG - Intronic
1152540894 17:80974423-80974445 TCTGAGGCCCCTTGAAGTTGAGG - Intergenic
1152744662 17:82033196-82033218 TCTGAGGGCTCTGGCTGCTGGGG + Intronic
1156024192 18:32632692-32632714 TCTGTGGACACTAGCAGATACGG - Intergenic
1157782610 18:50453483-50453505 CCTGAGGATTCTGGGAGATGAGG + Intergenic
1157801466 18:50625028-50625050 TCTGGGGTACCTGGAAGATGAGG + Intronic
1159807978 18:72978570-72978592 TGTGAGGACCCAGCAAGATGTGG - Intergenic
1160106496 18:75983079-75983101 TCTGGTGAACCTGGCAGGTGGGG + Intergenic
1160210579 18:76874799-76874821 TCTGAGGGCGGTGGCAGAAGTGG + Intronic
1160242469 18:77133133-77133155 CCTGAGGACGCGGGGAGATGCGG - Intronic
1160496978 18:79381490-79381512 TCTCAGGACCCAGGTAGAGGTGG - Intergenic
1161110898 19:2469458-2469480 TCTGAGGACAGTGGCAGGGGAGG - Intergenic
1161710259 19:5843700-5843722 GGTGAGGCCCCAGGCAGATGAGG + Exonic
1162792489 19:13070239-13070261 TCTGAGCACCCTGTCAGCTCGGG - Intronic
1163111825 19:15165963-15165985 GCTGAGCCCCCTGGCAGATCAGG + Exonic
1164099751 19:22044285-22044307 TGTCAGGACCCGGGCAGAAGAGG + Intergenic
1164531845 19:29054885-29054907 CCTGAAGACCCTTGCAGGTGGGG - Intergenic
1164771348 19:30811797-30811819 TCCAGGGACCCTGGCTGATGGGG - Intergenic
1166063361 19:40341695-40341717 TCTGAGGACCGTGGCAGGGTGGG - Intronic
1166410420 19:42552847-42552869 TCTCAGGAGCGTGGAAGATGGGG - Intronic
1168095873 19:54114684-54114706 TCTCAGGACCATGGCAGCCGTGG - Exonic
925755836 2:7131662-7131684 TCTGAGAGGCCTGGCAGATCAGG - Intergenic
927784003 2:25959812-25959834 TCTGGGGAACCTGGCAGGAGGGG + Intronic
928255655 2:29720094-29720116 TGTGAGGAACCAAGCAGATGGGG + Intronic
929789243 2:45011449-45011471 TCTAAGGACCCTGGGAGACATGG + Intergenic
929868910 2:45741547-45741569 GCTGAGGACCGTGTCAGACGTGG - Intronic
932413789 2:71561923-71561945 TCTGCGTGCCCTGGCAGAGGAGG + Exonic
932489460 2:72111209-72111231 ACTGAGGACCCTGGAAGAACTGG - Intergenic
932888009 2:75564419-75564441 TGTGAGCAGCCTTGCAGATGTGG + Intronic
935293303 2:101627682-101627704 TAGGAGTACCCAGGCAGATGGGG - Intergenic
935356954 2:102210204-102210226 TGTGAAGACCCTGGCACAAGAGG + Intronic
936021834 2:109001080-109001102 TCTGAGCACCCTTGCTGATAAGG - Intergenic
936085360 2:109463869-109463891 TTTGAGGACTCTGCCAGAGGTGG + Intronic
937887916 2:126912697-126912719 TCAGAGGCCACAGGCAGATGGGG + Intergenic
937986554 2:127640658-127640680 TGTGAGGTCCCGGGCACATGGGG - Intronic
938188999 2:129257410-129257432 AAAGAGGACCCTGGCAGAAGTGG + Intergenic
940904944 2:159160725-159160747 TCTGAGAACCCTGGGACATGTGG + Intronic
941169120 2:162116297-162116319 TCTGAGGACACAGCCAAATGTGG + Intergenic
942499121 2:176569755-176569777 TCTGCGGTCCCTGCCAGCTGCGG + Intergenic
945159084 2:206870661-206870683 TAGGAGGGACCTGGCAGATGTGG - Intergenic
946374144 2:219298010-219298032 TCTGGTGGCCCTGGCAGGTGTGG - Exonic
946688144 2:222291713-222291735 TCTTAGCGCCCTGGCAGAGGGGG - Intronic
948461949 2:238134111-238134133 TCTGAGGGCCCTGACAGAGGAGG + Intergenic
948569071 2:238906098-238906120 TCTGAGGACCTGGGCTGCTGGGG + Intronic
948868151 2:240785602-240785624 CCTGAGGTCCCTGGCAGGTCAGG - Intronic
1169800326 20:9507045-9507067 TCTGGGGACTCGTGCAGATGGGG - Intergenic
1171207768 20:23294496-23294518 ACTGAGAGCCCTGGCAGGTGAGG - Intergenic
1171869171 20:30512464-30512486 TCTGAGGACAGTGCCAGGTGGGG - Intergenic
1174299238 20:49569469-49569491 TGTCAGGACCCTGGCTGATAAGG - Intergenic
1175792103 20:61746229-61746251 CCTGAGGACCCTGTCCCATGGGG + Intronic
1175823938 20:61926433-61926455 TCTGTGGACCCTGGCAGGGGAGG - Intronic
1176289921 21:5038296-5038318 CCTGAGGTCCCTGGCTGCTGTGG - Intronic
1177735762 21:25086702-25086724 TCTGAGGACACAGGAAGAAGAGG + Intergenic
1178626684 21:34224379-34224401 TCTGGGGTCAGTGGCAGATGAGG + Intergenic
1179867331 21:44225343-44225365 CCTGAGGTCCCTGGCTGCTGTGG + Intronic
1181603024 22:23963559-23963581 TGTGAGGACCCAGGGAGAAGGGG + Intergenic
1181605490 22:23977748-23977770 TGTGAGGACCCAGGGAGAAGGGG - Intronic
1182857472 22:33530649-33530671 TCTGAGGACCATGTCCCATGAGG + Intronic
1183126328 22:35784896-35784918 TTTGAGGACCGTGACAGAGGTGG + Intronic
1184042028 22:41949942-41949964 TCTGATGACCCTGCCAGCTTGGG - Intergenic
1184330103 22:43821804-43821826 TCTGAGGGCCCTGGCTGGGGTGG + Intergenic
950869165 3:16213845-16213867 CCTGAGGACCAGGGCAGAAGGGG - Intronic
956367866 3:68524594-68524616 GCTCAGGATCCTGGGAGATGGGG - Intronic
961058377 3:123808060-123808082 GCTGATGACCCTGGCAGGTTTGG - Intronic
962702212 3:138010533-138010555 GGTGAGGACCCTGGCAGCTCTGG + Intronic
964573288 3:158135828-158135850 TCTAAGGACCCTTGAACATGTGG + Intronic
964805453 3:160605122-160605144 TCTGAGTACCTAGGCAGACGTGG + Intergenic
965358739 3:167710429-167710451 TCTGTGGTCACTGGCACATGGGG - Intronic
965814419 3:172622035-172622057 CCTGAGGACCCTGGCAGTCAAGG - Intergenic
967216978 3:187219257-187219279 TTTGAGGACCCTTTGAGATGAGG + Intronic
967307389 3:188072239-188072261 TGTGATGTCCCTGGCTGATGCGG - Intergenic
967406727 3:189124392-189124414 TGTGACAACCCTGGGAGATGGGG + Intronic
968338668 3:197935863-197935885 TCTGATGACCTGGGCAGAGGAGG - Intronic
968628152 4:1637349-1637371 TCTGAAGACCCGGGGAGGTGGGG - Intronic
968928956 4:3565948-3565970 TCAGAGAATCCTCGCAGATGGGG - Intergenic
969634220 4:8356972-8356994 TAAGATGACCCTGGCAGATGAGG + Intergenic
972912008 4:43829012-43829034 TCTGACCACCTTGGCACATGTGG + Intergenic
973830428 4:54753849-54753871 TCTGAGAACTCTTTCAGATGTGG - Intergenic
977362311 4:96021865-96021887 TCAGATGAACATGGCAGATGAGG - Intergenic
977642082 4:99368320-99368342 TCTGTGGACCCTTGCCAATGGGG + Intergenic
979257268 4:118618596-118618618 TCTCAGGAGCATGGCAGGTGAGG - Intergenic
979331082 4:119421952-119421974 TCTCAGGAGCATGGCAGGTGAGG + Intergenic
980077753 4:128311316-128311338 TCTGATAAACCTTGCAGATGAGG - Intergenic
981806167 4:148717951-148717973 TCTAGAGACCCTGGCAGGTGGGG + Intergenic
984926521 4:184811981-184812003 CCTGAGGACCCTGGAAGGTTGGG - Intronic
986621517 5:9680673-9680695 TCTGATGACCTTGGCAGTTTTGG - Intronic
997229044 5:132229419-132229441 GCTCAGGGCCCTGGCAGATGAGG - Intronic
997630009 5:135360291-135360313 AGGGAGGACCCTGGCAGCTGGGG - Intronic
997734025 5:136200366-136200388 TCAGTGGACCCAGGCAGAAGGGG + Intergenic
997998182 5:138603325-138603347 TGTGATGATGCTGGCAGATGAGG + Intergenic
999255970 5:150210203-150210225 GCTGAGGGCCCTGGAGGATGGGG + Exonic
999692641 5:154162015-154162037 TCTGAGGTTCCTGGGGGATGAGG - Intronic
999942656 5:156561271-156561293 TCTGAGGACCCTTCCAGGTCTGG + Intronic
1001693253 5:173648523-173648545 TCTGGGGACCCAGGAGGATGGGG - Intergenic
1002038387 5:176491386-176491408 CCACAGTACCCTGGCAGATGTGG - Intronic
1005893714 6:30160789-30160811 TCAGGGTACCCTGACAGATGGGG + Exonic
1006042140 6:31265368-31265390 TTTGAGCACCCTGGCTGAGGAGG + Intergenic
1007189033 6:39997873-39997895 TCTGAGGTCCCTGGCATAATTGG + Intergenic
1008286479 6:49658783-49658805 TCTTAGGGACCTAGCAGATGTGG + Intergenic
1008647282 6:53527567-53527589 TGTGAAGAGCCAGGCAGATGTGG + Intronic
1008731181 6:54484421-54484443 TTTGAGAACCTTGACAGATGGGG - Intergenic
1009052878 6:58299323-58299345 TCTGGGGAACATGGCACATGAGG + Intergenic
1009238232 6:61151263-61151285 TCTGGGGAACATGGCACATGAGG - Intergenic
1011680813 6:89781583-89781605 TCTGAAGAACCTGACAGAGGGGG + Exonic
1013762905 6:113538830-113538852 TCTGAGGAAGCTGGGAGATTTGG + Intergenic
1015198961 6:130557228-130557250 TCTGATGACAGTGGCACATGTGG - Intergenic
1018432187 6:163731010-163731032 GCTGAGGACCCTGACAGAGCCGG + Intergenic
1019124896 6:169831521-169831543 TATGAGGACACTGGCAGAAACGG + Intergenic
1019332025 7:464943-464965 GCAGAGGAGACTGGCAGATGTGG + Intergenic
1019924438 7:4182807-4182829 CTTTAGGGCCCTGGCAGATGGGG + Intronic
1021329084 7:19312617-19312639 CAGGAGGTCCCTGGCAGATGAGG + Intergenic
1021486368 7:21172821-21172843 TCTAAGGTCCCTAGCAGATTGGG - Intergenic
1023015899 7:35968565-35968587 TCTAAAGTCCCTGGCAGCTGTGG - Intergenic
1023399240 7:39779865-39779887 TCTCAGGAGCATGGCAGGTGAGG - Intergenic
1024072189 7:45795678-45795700 TCTCAGGAGCATGGCAGGTGAGG - Intergenic
1024301995 7:47893922-47893944 TCTGAGGACAATGGGGGATGAGG + Exonic
1025055340 7:55760424-55760446 TCTCAGGAGCATGGCAGGTGAGG + Intergenic
1025133411 7:56390653-56390675 TCTCAGGAGCATGGCAGGTGAGG + Intergenic
1025508453 7:61472424-61472446 TTTGAGGACCATTGCAGATAAGG + Intergenic
1026829565 7:73602727-73602749 ACTGTGGACCCTGGGAGATGGGG - Intronic
1026980044 7:74521089-74521111 TTGGATGTCCCTGGCAGATGAGG + Intronic
1030065017 7:105652773-105652795 TCTGAGCACGCTGAAAGATGAGG + Intronic
1030886499 7:114944880-114944902 TCTGAGCACCGTGGAAGAAGCGG + Intronic
1032049577 7:128639370-128639392 TCTCAGGAGCATGGCAGGTGAGG - Intergenic
1032288152 7:130559336-130559358 TCTCCGGCCCCTGGCAGCTGGGG - Intronic
1033643627 7:143285246-143285268 GAGGAGGGCCCTGGCAGATGTGG + Exonic
1034994944 7:155571344-155571366 TAAAATGACCCTGGCAGATGAGG - Intergenic
1035065834 7:156104699-156104721 TCTGAGGAGCGTGGCAGAGGAGG - Intergenic
1036130943 8:6109432-6109454 TCTGAGTACCCTGGAGGAGGAGG + Intergenic
1036778571 8:11630189-11630211 CCTGAGGACCATGGCAGGGGTGG - Intergenic
1036841710 8:12128466-12128488 GATGAGGACCTTGGCAGAAGTGG + Intergenic
1036842254 8:12133179-12133201 AATGAGGACCTTGGCAGAAGTGG + Intergenic
1039119437 8:34129424-34129446 TCTGATTTCCCTGGTAGATGTGG - Intergenic
1039588669 8:38728650-38728672 TCTGGGGACCCTCGCCGAAGAGG + Intronic
1042446486 8:68890771-68890793 TCTGTGGACCCTTGCCAATGAGG + Intergenic
1045695607 8:104805821-104805843 CCCCAGGACCCTGGCAGCTGTGG - Intronic
1047915684 8:129581818-129581840 TCTGATGTCCCAGGCAGATGTGG + Intergenic
1048199587 8:132360597-132360619 TCTGAGGTCTCTGCCAGAAGGGG - Intronic
1050732331 9:8723219-8723241 TCAGAGCATCCAGGCAGATGGGG - Intronic
1051301706 9:15658480-15658502 TCTGAGGATAAGGGCAGATGTGG - Intronic
1051581881 9:18685356-18685378 TCTGAAGACACTGGCAAATCTGG - Intronic
1054979423 9:71187389-71187411 GCTGAGCACCCAGGAAGATGTGG - Intronic
1056036669 9:82613698-82613720 GCTGAAGACCTTGTCAGATGTGG - Intergenic
1057215038 9:93223342-93223364 TCTGAGGTCCCTGGAGGAAGTGG - Intronic
1060271183 9:122143130-122143152 TGTGAGGCACCAGGCAGATGAGG - Intergenic
1062104591 9:134746680-134746702 TCTGAAGGCCCTGGCACAGGAGG - Intronic
1062346136 9:136116141-136116163 TCTAAAGTCCCTGGCAGCTGTGG + Exonic
1062395761 9:136351975-136351997 CCTGAGGACCCCAGCAGAGGGGG - Intronic
1062633432 9:137477841-137477863 CCTGCAGACCCTGGCACATGCGG - Intronic
1185651296 X:1649845-1649867 TCTGTGGACCCCGGGGGATGAGG - Intergenic
1185736202 X:2498724-2498746 TGTGTGGGCCCTGGCAGAAGAGG - Intronic
1186301760 X:8206938-8206960 TCTGGGGACAGTGGCAGAAGAGG + Intergenic
1186453229 X:9690568-9690590 TCTGAGGCCCCTGGAAATTGGGG + Intronic
1186770604 X:12814422-12814444 TCTGAGGAGACTGTCAGTTGGGG - Intronic
1188610929 X:32096683-32096705 GCTGAGGACCCAGGTAGGTGAGG + Intronic
1191743870 X:64464847-64464869 CCAGAGAACACTGGCAGATGTGG + Intergenic
1192853382 X:74981183-74981205 ACTGTGGACACTGGCGGATGGGG - Intergenic
1196197540 X:112851796-112851818 TCTGGGGACCCTGGGAGTTCTGG - Intergenic
1200011620 X:153124733-153124755 TCTCAGGGCCCCTGCAGATGGGG + Intergenic
1200027981 X:153275186-153275208 TCTCAGGGCCCCTGCAGATGGGG - Intergenic
1200056299 X:153463173-153463195 CCTGGGCACCCTGGCAGATGTGG - Intronic