ID: 903811162

View in Genome Browser
Species Human (GRCh38)
Location 1:26035747-26035769
Sequence GCTTGCGAGCCCCGGGGGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 150}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903811145_903811162 20 Left 903811145 1:26035704-26035726 CCAGTGTTTGCCGCGGTTCCCGC 0: 1
1: 0
2: 0
3: 0
4: 41
Right 903811162 1:26035747-26035769 GCTTGCGAGCCCCGGGGGGCGGG 0: 1
1: 0
2: 2
3: 17
4: 150
903811148_903811162 10 Left 903811148 1:26035714-26035736 CCGCGGTTCCCGCACGGTCAGGC 0: 1
1: 0
2: 0
3: 4
4: 56
Right 903811162 1:26035747-26035769 GCTTGCGAGCCCCGGGGGGCGGG 0: 1
1: 0
2: 2
3: 17
4: 150
903811151_903811162 1 Left 903811151 1:26035723-26035745 CCGCACGGTCAGGCCCCAGGACT 0: 1
1: 0
2: 2
3: 9
4: 164
Right 903811162 1:26035747-26035769 GCTTGCGAGCCCCGGGGGGCGGG 0: 1
1: 0
2: 2
3: 17
4: 150
903811150_903811162 2 Left 903811150 1:26035722-26035744 CCCGCACGGTCAGGCCCCAGGAC 0: 1
1: 0
2: 2
3: 18
4: 191
Right 903811162 1:26035747-26035769 GCTTGCGAGCCCCGGGGGGCGGG 0: 1
1: 0
2: 2
3: 17
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903811162 Original CRISPR GCTTGCGAGCCCCGGGGGGC GGG Exonic
901426111 1:9183073-9183095 GCTCTCGGGTCCCGGGGGGCTGG + Intergenic
901500857 1:9651974-9651996 TCCTGGGAGCCCCGGGGGCCGGG + Intronic
902230801 1:15026212-15026234 GCCTGGGAGCCACGGGGAGCTGG + Intronic
902375084 1:16026794-16026816 GCTTGAGGGACCCAGGGGGCGGG - Intronic
902380053 1:16048600-16048622 GCTTGAGGGACCCAGGGGGCGGG - Intronic
903811162 1:26035747-26035769 GCTTGCGAGCCCCGGGGGGCGGG + Exonic
903855687 1:26336581-26336603 GCGTGCCGGCCGCGGGGGGCGGG - Intronic
904160392 1:28518489-28518511 GCTGGAGCGCCCCGCGGGGCCGG - Intronic
905202461 1:36323557-36323579 GCCTGGGAGCCCAGCGGGGCCGG - Intronic
905451586 1:38060389-38060411 CCTGGGCAGCCCCGGGGGGCAGG - Intergenic
909664830 1:78121307-78121329 GCCTGTGAGCTCGGGGGGGCAGG + Intronic
918260252 1:182789531-182789553 GCTTCCGATCCTCGGGGAGCCGG + Intronic
920312064 1:205054407-205054429 GGTAGCGAGGCCTGGGGGGCTGG - Intronic
922904332 1:229162499-229162521 GCTTGGGAGTCCCGGGGGGTAGG - Intergenic
923547318 1:234932221-234932243 GCATGCGAGCCCTGGAGGGAGGG - Intergenic
1065873219 10:29974024-29974046 GCCTGCGAGCGCTGAGGGGCTGG - Intergenic
1067226763 10:44381705-44381727 GATTGCAAGCCCTGGAGGGCTGG + Intronic
1070833215 10:79432635-79432657 GCTTGCGAGCCTCGGAGGTGAGG + Exonic
1073048623 10:100654235-100654257 GGGTGGGAGCCGCGGGGGGCCGG - Intergenic
1075768857 10:124916968-124916990 ACTGGGGAGCCCCGGGGGGCGGG - Intergenic
1076351185 10:129816162-129816184 GCTTGTGAGCCCCCGGGGGCTGG + Intergenic
1076821772 10:132943226-132943248 GGTGGGGAGCCCCGGGGGGCAGG - Intergenic
1077103299 11:831569-831591 GCCTGCGAGGCCAGGCGGGCGGG + Exonic
1077487046 11:2843761-2843783 GTTAGAGAGCCCCGGGCGGCCGG - Intronic
1078057627 11:8019944-8019966 GCTCGCCATCCCCGCGGGGCGGG - Intronic
1079469368 11:20763781-20763803 GCTGGCGAGCCTAGAGGGGCTGG + Intronic
1080889876 11:36400226-36400248 GGTTGCGAGCTCCACGGGGCAGG + Intronic
1083363989 11:62130317-62130339 GCTGGCGAGTCCCGTGGGCCAGG - Exonic
1084526929 11:69703706-69703728 GCTGGAGAGCCCGTGGGGGCCGG + Exonic
1084651634 11:70492728-70492750 GCTTCAGAGCCCTTGGGGGCTGG - Intronic
1091835385 12:3582177-3582199 GCTTGCTGGCCCCGTGAGGCAGG - Intronic
1093655404 12:21688328-21688350 GCATGCTAACCCTGGGGGGCTGG - Intronic
1096254695 12:50055970-50055992 GCCTGCGAGCCGCGGGGAGGTGG + Intergenic
1096559281 12:52424244-52424266 TCTTGCGAGGCCCGGGCAGCTGG - Exonic
1101772140 12:107761199-107761221 GCTTGCGGGCCGCGGCGGGGAGG - Intronic
1103449916 12:121021437-121021459 GCCTGAGAGCCCCAGGTGGCTGG + Intronic
1103721380 12:122977339-122977361 TGTTGCCAGCCCTGGGGGGCCGG - Intronic
1104974737 12:132547489-132547511 GCCTGGGAGCCCCTGGGGTCAGG - Intronic
1107283101 13:38758539-38758561 GAATGCCAGCCCCTGGGGGCAGG + Intronic
1108577778 13:51804167-51804189 GCGGGCGACTCCCGGGGGGCGGG - Intergenic
1110239834 13:73254800-73254822 GCCTGTGAGCCCCAGGAGGCTGG - Intergenic
1112014163 13:95317601-95317623 GCTTGCAAGACCAGGGGGGCAGG - Intergenic
1113907426 13:113826374-113826396 GCCTGCGAGGCCGGGGAGGCTGG - Intronic
1113945423 13:114041253-114041275 GCTTGGGAGGCCCAGGGGGGAGG + Intronic
1113950889 13:114070159-114070181 GGTTGGGAGACTCGGGGGGCCGG + Intronic
1116816213 14:49586119-49586141 GCTTGGGAGTCCCGGGATGCGGG - Intronic
1119003903 14:70907521-70907543 GCTGGCGGGCCGCGGGTGGCGGG + Exonic
1120666250 14:87309865-87309887 GCTGGCCAGCCCTGGAGGGCAGG - Intergenic
1121781488 14:96625019-96625041 GCTTGCGGGCCTGCGGGGGCTGG - Intergenic
1123474909 15:20582548-20582570 GCTTGGGTGCCCAGGCGGGCTGG + Intergenic
1123643102 15:22417809-22417831 GCTTGGGTGCCCAGGCGGGCTGG - Intergenic
1126738086 15:51751711-51751733 GGGTGAGCGCCCCGGGGGGCGGG + Exonic
1126787754 15:52191892-52191914 GCCTGTGAGCCCCAGAGGGCAGG - Intergenic
1128708013 15:69851530-69851552 GCCTGGGAGCTCCTGGGGGCTGG + Intergenic
1129933648 15:79432015-79432037 GCTTGAGCGCCCCGGGCGGGCGG + Intergenic
1130113947 15:80989887-80989909 GCTAGCGAGGGCCGGGAGGCGGG - Intergenic
1130612493 15:85374006-85374028 GCTGGGGAGCCTCTGGGGGCAGG + Intergenic
1132527861 16:426303-426325 GCTTGCGAGCCCCGACGCCCCGG + Exonic
1132897930 16:2237680-2237702 GCAGGCGCGCCCCGGGGGTCTGG + Intronic
1133232106 16:4371803-4371825 CCTTAAGAGTCCCGGGGGGCGGG - Intronic
1133759023 16:8783287-8783309 GCATGTGAGCCCCCGGGGGCAGG - Exonic
1138269007 16:55681309-55681331 GCCTGTGATCCCCAGGGGGCTGG + Intronic
1139430930 16:66910737-66910759 GGTGGGGAGCCCCGGGAGGCAGG - Intronic
1140078632 16:71723949-71723971 GCCGGCGGGCCGCGGGGGGCGGG - Intronic
1141993943 16:87625381-87625403 GCCTGCGAGCTGCTGGGGGCTGG - Intronic
1142924030 17:3216973-3216995 GCTTGCAAGCCTCTGAGGGCAGG + Intergenic
1144162135 17:12569995-12570017 GCTTGCCAGCTCCTGGAGGCAGG + Intergenic
1144701568 17:17344109-17344131 GCTGGTGCTCCCCGGGGGGCAGG - Intronic
1146339549 17:32007503-32007525 GGTTGGGAGGCCCGAGGGGCTGG - Intergenic
1146911747 17:36652900-36652922 GCTAGCTAGGCCCTGGGGGCCGG - Intergenic
1151333407 17:73424695-73424717 GAGTGCCAGCCCTGGGGGGCAGG + Intronic
1152499307 17:80697503-80697525 CCTTGTGAGCCCCAGGGAGCTGG + Intronic
1152635139 17:81427728-81427750 GCGTGCCAGCCGCGGGGGGCGGG - Intronic
1152942112 17:83178198-83178220 GCTGGCCAGGCCAGGGGGGCCGG - Intergenic
1153319013 18:3753261-3753283 GCATGCCAGCACCGGGGAGCAGG - Intronic
1153805231 18:8705106-8705128 GCTTGCGCTCCCCGGGGGGCGGG - Intergenic
1155284233 18:24271952-24271974 CCCCGCGAGCCCCGGAGGGCGGG - Intronic
1155919198 18:31586157-31586179 GCATGAGAGCTCCGGGGGGAAGG + Intergenic
1157476873 18:48029299-48029321 GCCGGCGAGCCCAGGGAGGCCGG + Exonic
1160329438 18:77978171-77978193 GCCTGCGAGCTCCAGGGTGCAGG - Intergenic
1160514252 18:79469819-79469841 GCCGGGGAGCCCCTGGGGGCTGG - Intronic
1160833882 19:1115762-1115784 CCGAGCGAGACCCGGGGGGCGGG - Intronic
1160904334 19:1445430-1445452 GCTGGGAGGCCCCGGGGGGCAGG - Intergenic
1161062984 19:2224297-2224319 GCTGGAGAGCCCAGGGGGCCGGG - Intronic
1161574305 19:5047406-5047428 ACCTGCGAGCCCTGGGGTGCAGG - Intronic
1161810513 19:6468578-6468600 ACTTCCGAGCCCCCAGGGGCGGG - Exonic
1162145609 19:8610933-8610955 GCTGGGGAACCGCGGGGGGCGGG + Intergenic
1164272137 19:23682537-23682559 GCTTGAGAGCCCTGGGAAGCTGG - Intronic
1165080452 19:33303296-33303318 GCTTGCTAGGCGCGCGGGGCCGG + Intergenic
1165420272 19:35718772-35718794 GGTTGCGAGGCCCGGCGGGGCGG - Intronic
1165461127 19:35944975-35944997 GACTGCGAGCCCTGGGGGCCCGG + Exonic
1166316784 19:41993940-41993962 GCCTGCGAGACCCGGGGAGCCGG - Intronic
1166339603 19:42129650-42129672 GCCTGGGAGCCCCTGTGGGCAGG + Intronic
1166384981 19:42375855-42375877 GATGGTGGGCCCCGGGGGGCTGG + Exonic
1167129153 19:47573082-47573104 GCGCGCGAGCCCCCGGGGGCGGG - Intergenic
1167551376 19:50163138-50163160 GCTTGGGCGCCCCCGGAGGCTGG - Exonic
926216996 2:10912044-10912066 GCCTGCGCGCCCCGGGGCGGAGG + Exonic
927964794 2:27262291-27262313 TCTTGCGGGCCCCTGGGGGGCGG - Intronic
932567884 2:72920907-72920929 AGTTGCGGGTCCCGGGGGGCTGG - Intronic
933847542 2:86337703-86337725 CCCGCCGAGCCCCGGGGGGCTGG - Intronic
935642885 2:105307614-105307636 GCTGGCGGGCCCCGGAGGGCTGG - Exonic
940640667 2:156342101-156342123 CTTTGTGAGCCCCGGGGAGCGGG - Intronic
944121410 2:196244552-196244574 GCTTGCGGGGCTTGGGGGGCAGG - Intronic
945251953 2:207771270-207771292 ACTTGCGCGCCGCGGGGGGTCGG + Intergenic
945770481 2:214035648-214035670 ACTTCTGAGCCCCTGGGGGCGGG + Intronic
946432390 2:219632589-219632611 GCCCGTGAGCCCCGAGGGGCAGG + Intronic
948116024 2:235494618-235494640 GCCCGCGGGCCCCGGGGCGCGGG + Exonic
1168980783 20:2002086-2002108 GCTTGTGATCCCCAGAGGGCAGG - Intergenic
1170783694 20:19449387-19449409 GCTTGGGCGCCACGTGGGGCAGG - Intronic
1174562692 20:51442881-51442903 GTTTGGGGGCCCCGGAGGGCTGG - Intronic
1175162878 20:57021869-57021891 TCATGAGAGCCCCGTGGGGCTGG + Intergenic
1175810787 20:61856382-61856404 TCTTGTGAATCCCGGGGGGCTGG - Intronic
1176423950 21:6536260-6536282 GTCTGGGAGCCCCAGGGGGCTGG - Intergenic
1179699443 21:43144575-43144597 GTCTGGGAGCCCCAGGGGGCTGG - Intergenic
1179890137 21:44331140-44331162 GCTGGGGAGCCCCAGGGTGCCGG - Intronic
1182354158 22:29714767-29714789 GCTTGTGCCCCCTGGGGGGCAGG + Intergenic
1183903530 22:41022841-41022863 GCTTGCGCTCCCAGCGGGGCAGG - Intergenic
951543685 3:23806233-23806255 GCTGGGGAGCCCCAGGGGTCCGG + Intronic
953863776 3:46566171-46566193 GCTTACCTGCCCCGAGGGGCGGG + Exonic
961013216 3:123449191-123449213 GCTCCGGAGCCCCGGGGGGGAGG + Exonic
961390327 3:126548785-126548807 GCTTCCCAGGCCCTGGGGGCAGG - Intronic
964138317 3:153369830-153369852 GTGTGGGAGCCCAGGGGGGCCGG + Intergenic
968353528 3:198081428-198081450 GCTTGGGTGCCCAGGCGGGCTGG + Intergenic
970194928 4:13543837-13543859 GCCTCCGAGCCCCAGGGCGCAGG + Intronic
973317695 4:48779529-48779551 GCTGGCGGGCCCCGGCGGGCAGG - Intronic
975666902 4:76741541-76741563 GCCTTCGAGCGCCGCGGGGCCGG - Exonic
994083231 5:95731226-95731248 ACGTGCCAGCCCCGGGGGTCGGG - Exonic
995787183 5:115842221-115842243 GCTGGCGAGCGCCAGGCGGCCGG - Intronic
997471127 5:134117514-134117536 GCTGTGGAGCCCCGGGAGGCTGG - Intronic
997521053 5:134524995-134525017 GCGCTGGAGCCCCGGGGGGCGGG + Intronic
999341698 5:150778800-150778822 TCCTCCGAGCCCCGGGAGGCGGG - Exonic
1002776853 6:335778-335800 GCTTGAGAACCCCAGGAGGCTGG + Intronic
1006785073 6:36660911-36660933 GCTAGCGCGCCGCGGGAGGCGGG - Intergenic
1007070767 6:39036741-39036763 TCTTGCAAGCCCCGGAGGGCTGG - Intergenic
1007448758 6:41927206-41927228 GATTGCAAGCCCCTGGGGACAGG + Intronic
1020238505 7:6374628-6374650 GCTTGCGGGCGGCGGGGCGCTGG - Exonic
1021103869 7:16615278-16615300 CCCTGAGAGCCCCGGGGGCCTGG - Intronic
1022207796 7:28180323-28180345 GCGTGCGAGCCCCGAGGTGGGGG - Intronic
1022675413 7:32495265-32495287 GCTTACGTGACCCGGGCGGCTGG - Intronic
1034878816 7:154748565-154748587 CCCTGCGAGCCCTGCGGGGCGGG + Intronic
1034880025 7:154756350-154756372 GCATGCCAGCCTCGGGGGCCTGG - Intronic
1035266441 7:157692434-157692456 GGGGGCGAGCCCCAGGGGGCAGG + Intronic
1035980111 8:4360788-4360810 GATTACGAACCCCGAGGGGCCGG - Intronic
1036705451 8:11043022-11043044 TCTTGCCAGCCCTGGGGGGCTGG + Intronic
1040077004 8:43246781-43246803 GCTTGGGTGCCCAGGCGGGCTGG - Intergenic
1041304776 8:56447388-56447410 ACTTGGGAGCCCCGGGGAGCTGG - Intergenic
1041829948 8:62143191-62143213 GCCCGCGAGCCCCGGGGGCTGGG - Intergenic
1048292239 8:133190012-133190034 GCTTGCTATCCCTGGGGGGTTGG - Intergenic
1049663346 8:143830362-143830384 GCCTGCCAGCCCCGGTGGGTAGG - Intergenic
1049790318 8:144469389-144469411 GCTTGGGAGCCTAGCGGGGCAGG + Intronic
1053503523 9:38621341-38621363 GCTTGGGTGCCCAGGCGGGCTGG + Intergenic
1053752350 9:41269323-41269345 GCTTGGGAGCCCAGGCTGGCTGG + Intergenic
1053752801 9:41273580-41273602 GCTTGGGTGCCCAGGCGGGCTGG + Intergenic
1054257878 9:62833655-62833677 GCTTGGGAGCCCAGGCGGGCTGG + Intergenic
1054258325 9:62837932-62837954 GCTTGGGTGCCCAGGCGGGCTGG + Intergenic
1054333444 9:63782109-63782131 GCTTGGGAGCCCAGGCGGGCTGG - Intergenic
1057684837 9:97222295-97222317 GCTTGGGTGCCCAGGCGGGCTGG + Intergenic
1057758091 9:97853125-97853147 GCGCCCGGGCCCCGGGGGGCGGG + Intergenic
1060109248 9:120894722-120894744 GCTGGGGAGCCGCGGGCGGCCGG - Intronic
1061000457 9:127899519-127899541 GCTCGGGGGCCGCGGGGGGCCGG - Exonic
1061080156 9:128365127-128365149 CCTCGCGCGCCCCGGGAGGCTGG - Intergenic
1061248500 9:129413620-129413642 GCTTGGGGGACCCGGGGTGCAGG + Intergenic
1061487692 9:130928672-130928694 GCTTGGGCGCCCGTGGGGGCAGG + Intronic
1062414190 9:136439602-136439624 GTCTGGGAGCCCCGAGGGGCTGG - Exonic
1202800895 9_KI270719v1_random:174725-174747 GCTTGGGAGCCCAGGCGGGCTGG - Intergenic
1192362110 X:70446610-70446632 GCTTGGGAGCCCCTGGGTGCTGG + Intronic
1195668414 X:107450112-107450134 GCTTGGGCGCCCCCGGGAGCCGG + Intergenic
1196723989 X:118879246-118879268 GCATGCGGGCCTCGGGTGGCAGG + Intergenic
1198519894 X:137441921-137441943 GCTTGCGGGCGGCGGGGCGCTGG + Intergenic
1199567472 X:149230454-149230476 ACTTGAGAACCACGGGGGGCAGG - Intergenic