ID: 903811336

View in Genome Browser
Species Human (GRCh38)
Location 1:26036530-26036552
Sequence CTCCAGAGGGTGAGGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 547
Summary {0: 1, 1: 0, 2: 4, 3: 53, 4: 489}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903811329_903811336 -6 Left 903811329 1:26036513-26036535 CCTGGGAGCGCGTGCGACTCCAG 0: 1
1: 0
2: 0
3: 4
4: 55
Right 903811336 1:26036530-26036552 CTCCAGAGGGTGAGGGTGGTGGG 0: 1
1: 0
2: 4
3: 53
4: 489

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903811336 Original CRISPR CTCCAGAGGGTGAGGGTGGT GGG Intergenic
900132446 1:1092811-1092833 CTCTGGAAGGTGGGGGTGGTCGG + Intronic
900329621 1:2127507-2127529 TTCCAGAGGCTGAGGGCAGTGGG - Intronic
900347389 1:2216221-2216243 GTTCAGTGGGTGAGGGTGGCAGG + Intergenic
900415519 1:2532750-2532772 CTGCCGGAGGTGAGGGTGGTGGG + Intergenic
901050502 1:6423815-6423837 CTCCAGAGGGGGTGGGTGTTGGG + Intronic
901091112 1:6642128-6642150 CTCCAGGGGGTCAGGATGGCTGG + Intronic
901505291 1:9681343-9681365 CTTGAGAGGGTGAGGCTGGAGGG - Intronic
901625210 1:10620374-10620396 CTCGGGAGGCTGAGGGTGGTGGG + Intronic
902378607 1:16042106-16042128 CTCCGGATGGTGATGGTGTTAGG + Intergenic
903069261 1:20718410-20718432 GTCCAGGGGCTGTGGGTGGTGGG - Intergenic
903441967 1:23394925-23394947 CTCCAGAGGGTGGAGGGAGTGGG - Intronic
903659214 1:24966583-24966605 GTGCTGAGGGTGGGGGTGGTGGG + Intergenic
903811336 1:26036530-26036552 CTCCAGAGGGTGAGGGTGGTGGG + Intergenic
903864677 1:26389566-26389588 CGCCAGGGGTAGAGGGTGGTGGG - Intergenic
904599704 1:31666672-31666694 TTCCAGAGGGAGAGGCTGGGTGG - Intronic
904824410 1:33265303-33265325 GCCCAGAGGTTGAGGGTGTTGGG + Intronic
906666844 1:47628095-47628117 CTCCCGAGGCTGAGGGTACTGGG - Intergenic
906940428 1:50250958-50250980 CTTTAGATGGTGAGGGTGGCAGG + Intergenic
906990309 1:50730075-50730097 CTCTGGAGGGTGAAGGGGGTTGG + Intronic
907011259 1:50965599-50965621 CTCCAGAGGCTGAGGTAGGAGGG + Intronic
907104228 1:51866112-51866134 CTCCAGAGGCTGAGGCAGGAGGG + Intronic
907745419 1:57208194-57208216 CCCCAAAGGGTGAGGGAGTTGGG + Intronic
908238380 1:62168850-62168872 CTCCAGAGGCTGAGGGTGGGAGG + Intergenic
908267036 1:62389757-62389779 CTCCAGAGGTTGAGGCAGGGTGG - Intergenic
908542722 1:65136918-65136940 CTCCAGAGGGTGGGGGCCGGGGG + Intergenic
910173576 1:84403892-84403914 CTCCAGAGGCTGAGGTGGGAGGG - Intronic
910685550 1:89912403-89912425 CACCAAAGGGTGGGGGTGGGGGG - Intronic
911807069 1:102223597-102223619 CTACAAAGGGAGAGAGTGGTAGG + Intergenic
915119215 1:153617917-153617939 CTCCAGAGGGTAAGGGGAGGAGG + Intergenic
915213161 1:154324905-154324927 CCCGAGAGGGTGAAGGTGGGAGG - Exonic
915215815 1:154340248-154340270 CTCCAGAGGGAGAGGGCCCTGGG - Intronic
915340884 1:155176043-155176065 CGCCAGAGTGTGAGTGTGGGAGG + Exonic
915363524 1:155300675-155300697 CTGCATAGGGTGAGGCTGCTGGG - Intronic
915835268 1:159171431-159171453 CTCCCGGGGGAGAGGGTGGAAGG + Intergenic
916326238 1:163562947-163562969 TATCAGAGGGTGAGGGTGGGAGG - Intergenic
916707316 1:167364680-167364702 CTCCAGAGGCTGAGGGAGAATGG - Intronic
916975547 1:170074158-170074180 TTCCAGGGGGAGAGGGAGGTAGG - Intronic
918411522 1:184263045-184263067 TTCCCTAGGGTGAGAGTGGTGGG + Intergenic
919061888 1:192643842-192643864 CTCCAGAGGTTGAGGTGGGAGGG + Intronic
919412270 1:197260043-197260065 CTCCAGAAGCTGAGGTTGGGAGG + Intergenic
920084817 1:203407476-203407498 GTCCAGAGGTTGAGGAGGGTGGG + Intergenic
920175988 1:204102299-204102321 CCCCAGAGGGAGAGGAAGGTGGG - Intronic
920569990 1:207009176-207009198 ATCCAGGGGGAGAGGGTGGGTGG + Intronic
921060482 1:211579870-211579892 CTCCAGGGGTTGATGGTGATAGG - Intergenic
922516313 1:226210722-226210744 CCCCAGAGGGTGATGCCGGTGGG - Intergenic
922768078 1:228166247-228166269 CTGCAGAGGGCGTGGGGGGTGGG + Intronic
922770070 1:228176871-228176893 CTGCAGCGGGTGAGGCTGGACGG - Exonic
922939700 1:229451289-229451311 CTCCAGAGGCTGAGGTAGGAGGG + Intronic
923099560 1:230801501-230801523 CTCCTGAGGCTGAGGCTGGAAGG + Intronic
923207361 1:231772055-231772077 CTCCAGAGGCTGAGGCAGGGAGG - Intronic
923650402 1:235867612-235867634 CTCCAGAGGGTGGGAGCTGTAGG + Intronic
923674840 1:236071456-236071478 CGCCAGAGGCTGAGGGAGGGAGG - Intergenic
924081881 1:240406710-240406732 CTCAAAAGGGTGAATGTGGTTGG + Intronic
1062890758 10:1057455-1057477 CTCCAAAGAGTGGGGATGGTCGG + Intronic
1063024236 10:2162308-2162330 TTCCTGAGGGTGAGGGTCATGGG + Intergenic
1063520457 10:6736253-6736275 CTCCAGGGGGAGTGGGTGGCTGG + Intergenic
1063921186 10:10934710-10934732 TTCGAGAGGGTGAGGGTTGAGGG + Intergenic
1066191744 10:33062238-33062260 TTCCAGCGGGTGGGGGTGGAGGG + Intergenic
1067809809 10:49417921-49417943 CTCCAGGGGGAGAGGGTGCTGGG - Intergenic
1067989022 10:51188690-51188712 TTCTAGAGGGTGACTGTGGTGGG + Intronic
1069853426 10:71425162-71425184 CTGGAGTGGGTGAGGGTGGAAGG + Intronic
1070602970 10:77878588-77878610 CTCCTGAGGGAGATGGTGATGGG - Intronic
1072211932 10:93254218-93254240 CTCCTGAGGCAGAGGTTGGTGGG - Intergenic
1072519504 10:96218584-96218606 CTCCAGAGGCTGAGGTGGGAAGG + Intronic
1072612543 10:97028279-97028301 ATACAGAGGGTGAGTGGGGTGGG - Intronic
1072625429 10:97108119-97108141 CTACAGAGGAGGAGGATGGTAGG - Intronic
1073282673 10:102366169-102366191 TTCCAGGGGGTGAGGGTTCTAGG + Intronic
1073466580 10:103697799-103697821 CTGCACAGGGAGAGGCTGGTGGG + Intronic
1074198572 10:111210468-111210490 CTCCAGAGGCTGAGGCGGGTGGG + Intergenic
1074536432 10:114331587-114331609 CTCCGGATGCTGAGGGTGATGGG - Intronic
1074544208 10:114389847-114389869 CTCCATAGGGTGAGGGGTGGTGG + Intronic
1075073277 10:119333286-119333308 ATCCAGATGGTGAGGATGGTGGG - Intronic
1075660740 10:124193833-124193855 CTCCAGTGGGGGAGTGTGTTTGG + Intergenic
1075904931 10:126072826-126072848 CTCCATTGGGAGAGGGTGCTTGG - Intronic
1076300998 10:129426131-129426153 CTGAAGGGGGTGAGGATGGTGGG + Intergenic
1076686424 10:132200302-132200324 CCCCAGGGGGTGCAGGTGGTCGG + Intronic
1077530954 11:3094511-3094533 CCCCACAGGGAGAGGCTGGTGGG + Intronic
1078259291 11:9689731-9689753 CCCCAGAGGGATAGGGTGCTGGG + Intronic
1078731587 11:13979874-13979896 CTCTCTAGGGTGAGGGTGGGTGG - Intronic
1079959566 11:26906446-26906468 CTCGAGAGGCTGAGGCTGGAGGG - Intergenic
1081718602 11:45269044-45269066 CTGGAGAAGGGGAGGGTGGTAGG + Intronic
1082986561 11:59174384-59174406 CATCAGAAGGTGAGGGTGGAGGG + Intronic
1083181314 11:60987642-60987664 CTCCAGAGGATGAGTGGGCTAGG - Intronic
1083408059 11:62472247-62472269 CTACAGAGGGTGAGAGGAGTCGG - Intronic
1083596045 11:63918669-63918691 CTCCAAAGGGTGGAGGTGCTGGG - Intergenic
1083669845 11:64293443-64293465 CTTCAGGGTGTGATGGTGGTGGG + Intronic
1083897014 11:65625046-65625068 CTGCAGTGCGTAAGGGTGGTTGG + Intronic
1084155373 11:67310158-67310180 CGCCAGAACCTGAGGGTGGTGGG + Exonic
1084327799 11:68411757-68411779 CAGCAGAGGGTGAGGCTGCTGGG - Intronic
1084711409 11:70846141-70846163 CTAAAGAGGGTGCCGGTGGTGGG + Intronic
1085396655 11:76210054-76210076 CGACAGAGGGTGTGTGTGGTGGG - Intronic
1086600656 11:88629479-88629501 CTCCAGAGGTAGAGGGTTTTGGG + Intronic
1088750059 11:112835799-112835821 GTCCAGAGGGAGGGGGTTGTGGG - Intergenic
1088821749 11:113462681-113462703 CTCCAGAGGGAGAGGGAAGGTGG - Intronic
1089188673 11:116638239-116638261 CTCCAGAGTGCTTGGGTGGTGGG - Intergenic
1089259117 11:117210825-117210847 CTCAGGAGGTTGAGGGTGGGAGG + Intronic
1089376856 11:118000537-118000559 CCCCAGAGGGTCAGGGTTGGAGG + Exonic
1089606112 11:119642335-119642357 TTCCAGAGGGCTAGGGTGGGAGG + Intronic
1090197478 11:124828982-124829004 CTCCAGGGAGGGAAGGTGGTGGG + Intergenic
1091555046 12:1566738-1566760 CTCCAGAAGGTGAGGGAGAGGGG - Exonic
1091776720 12:3189469-3189491 CTACAGAGGGAGAGGGTGCAGGG + Intronic
1092021609 12:5207240-5207262 TGACAGAGGGTGAGGGTGGGAGG + Intergenic
1092214017 12:6667846-6667868 CCCCCCAGGGTGGGGGTGGTGGG - Exonic
1094141665 12:27188157-27188179 CTTCTGAGGCTGAGGGTGGGGGG - Intergenic
1095732538 12:45521494-45521516 CTCCAGTGGGTGTGTGTGTTCGG - Intergenic
1096683509 12:53272658-53272680 CTCCAGGAGGAGAGGGTGGTGGG + Intronic
1097458805 12:59834378-59834400 CCCCAGATGGTGGGGGTGGGGGG - Intergenic
1098929970 12:76400160-76400182 TTTCAGAGGGTGAGGGTGGGAGG - Intronic
1099148711 12:79081041-79081063 GTGCAGAGGCTGAGGGTGGTGGG + Intronic
1099972280 12:89512646-89512668 CTCCAGAGGCTGAGGGAGGCGGG + Intronic
1100825422 12:98470387-98470409 TTCTAGAGGGTGGGGGTGGGAGG + Intergenic
1101633615 12:106519026-106519048 CTCAAGAGGCTGAGGGTGGGAGG + Intronic
1101661792 12:106773087-106773109 CTCAAGAGGGAGAGACTGGTAGG + Intronic
1102283900 12:111639654-111639676 GGCCAGTGGGTGAGGGTGGGAGG + Intergenic
1103122199 12:118389621-118389643 CTCGAGAGGCTGAGGCAGGTAGG - Intronic
1103554145 12:121755791-121755813 CACCTGAGGGTGAGGGAGCTGGG + Intronic
1103743583 12:123107462-123107484 TTCCAGAAGGTGGGGGTGGCAGG - Intronic
1103905068 12:124322986-124323008 ATACACAGGGTGAGGGTGTTGGG - Intergenic
1103905081 12:124323087-124323109 ATACACAGGGTGAGGGTGTTGGG - Intergenic
1103905093 12:124323185-124323207 ATACACAGGGTGAGGGTGTTGGG - Intergenic
1103905106 12:124323286-124323308 ATACACAGGGTGAGGGTGTTGGG - Intergenic
1103905119 12:124323387-124323409 ATACACAGGGTGAGGGTGTTGGG - Intergenic
1103905134 12:124323488-124323510 ATACACAGGGTGAGGGTGTTGGG - Intergenic
1103905149 12:124323587-124323609 ATACACAGGGTGAGGGTGTTGGG - Intergenic
1103922311 12:124405366-124405388 AACCAGAGGGTGAGGGTGGAAGG - Intronic
1104091513 12:125521611-125521633 GGCCAGAGGGTGAGGGTGGAGGG + Intronic
1104230922 12:126883243-126883265 CTCCAAAGGGAGAGGGTGCCTGG + Intergenic
1104728977 12:131094722-131094744 TTCCAGAAGGAGAGGGTGGTGGG + Intronic
1105033954 12:132904856-132904878 CGCCACAGGGTGAGGGAGCTTGG - Intronic
1105304580 13:19159741-19159763 CTCCAGACTGTAAGGGTGGAGGG - Intergenic
1105564158 13:21526856-21526878 CTGCAGAGGGTGATGACGGTGGG + Intronic
1106131999 13:26948585-26948607 TTCCAGAGGGTGAGGGGTGAGGG - Intergenic
1107986942 13:45783911-45783933 CTCCTGGTGGTGAAGGTGGTGGG + Exonic
1109127086 13:58530928-58530950 CTTCAGAATGTGGGGGTGGTGGG - Intergenic
1110852740 13:80263261-80263283 CTCCAGTGGGTGTGTGTGTTCGG + Intergenic
1111379797 13:87434413-87434435 CTCCAGAGGCTGAGGCAGGGAGG - Intergenic
1112037866 13:95514393-95514415 CTCCTGAGGGTGGGGTGGGTGGG - Intronic
1112398881 13:99058640-99058662 CTCCACTGGGTGAGGGTGGATGG - Intronic
1113345087 13:109469458-109469480 ATCCATAGGGTGATGGTGTTAGG + Intergenic
1113475332 13:110576475-110576497 CTCCAGAGGCTGAGGCAGGAGGG + Intergenic
1115545930 14:34464724-34464746 CACCAGATGCTGAGGGTAGTTGG - Intergenic
1115556184 14:34546615-34546637 CTGGAGAGGGTGAGGGGGCTGGG + Intergenic
1115557724 14:34556466-34556488 CTGGAGAGGGTGAGGGGGCTGGG - Intergenic
1115996807 14:39203576-39203598 CTCCAGAGGGGGTGTGTGTTCGG - Intergenic
1116597093 14:46864135-46864157 TTCCCTAGGGTGAGAGTGGTGGG + Intronic
1118315456 14:64723132-64723154 CTCCAGAGGGTAGGTGTGGGTGG + Intronic
1119549374 14:75497246-75497268 CTCCAGAGGCCCAGGGTGGCTGG - Intergenic
1119623666 14:76152105-76152127 GGCCGGAGGGTGAGGGTGGTGGG + Intronic
1120164866 14:81186840-81186862 CTCAGGAGGATGAGGGTGGGAGG + Intronic
1121164162 14:91775825-91775847 CCCCAGAGGTTGAGGGGGCTTGG - Intronic
1121698854 14:95936433-95936455 TTCCAGAGGGGGTTGGTGGTGGG - Intergenic
1121702853 14:95969030-95969052 GGCCAGAGGGAGGGGGTGGTGGG - Intergenic
1121759887 14:96435886-96435908 CTCCTGCTGGTGAGGGTGGGTGG + Intronic
1122084749 14:99291782-99291804 TTCCGGAGGGAGAGAGTGGTGGG - Intergenic
1122230616 14:100304921-100304943 CTCCAGCGGGTGGGGGTGAAGGG - Intronic
1123931174 15:25172383-25172405 CTCCATAGTGGGAAGGTGGTGGG - Intergenic
1124637669 15:31375261-31375283 CTCCTGTGGAAGAGGGTGGTGGG + Exonic
1125534658 15:40436302-40436324 CTCCAGAGGGAGAGCGTGGAGGG - Intergenic
1125652803 15:41331474-41331496 CTCCGGAGGGTGAGGTTGGGAGG + Intronic
1125819916 15:42620371-42620393 CTCCAGAGGCTGAGGCAGGAGGG + Intronic
1125824171 15:42661550-42661572 CTCCAGAGGCTGAGGCAGGAGGG - Intronic
1125932314 15:43609282-43609304 TTCCTGAGGGTAAGGTTGGTGGG + Exonic
1125945410 15:43708754-43708776 TTCCTGAGGGTCAGGTTGGTGGG + Intergenic
1127894423 15:63283335-63283357 CTCAGGAGGCTGAGGGTGGGAGG - Intronic
1127974899 15:63990064-63990086 CCACAGAGGGTGAGGGTGGGTGG - Intronic
1128721681 15:69955001-69955023 TCCCAGAGGGTCAGAGTGGTTGG - Intergenic
1129755759 15:78098108-78098130 TTCCCCAGGGTGAGGGTGGCAGG + Intronic
1130404521 15:83586130-83586152 CTCCAGAGGGTTGAGGTGATGGG - Intronic
1130996746 15:88908409-88908431 CTTCAGGGTGTGAGCGTGGTGGG - Intronic
1131611328 15:93967545-93967567 CTCCAGAGGCTGAGGTGGGAGGG - Intergenic
1133092753 16:3417337-3417359 CTGCAGAGGGTTGGGGTGGCAGG + Intronic
1133116372 16:3580048-3580070 CTCCAGAGGGAAAGGGTTGAAGG - Intergenic
1133233566 16:4377517-4377539 CTCCAGAGGGTGAGGGGGCAGGG + Intronic
1133451905 16:5910890-5910912 ATCCAGAGGATGAGGGATGTGGG - Intergenic
1134209771 16:12266439-12266461 CTCCAGAGGGGCTGGTTGGTTGG - Intronic
1134533511 16:15004716-15004738 ATCCATAGGGTGAGGATGGGAGG - Intronic
1135049219 16:19178950-19178972 CTCAAGAGGCTGAGGGCGGGAGG + Intronic
1135637460 16:24090800-24090822 CTCCAGAGCGTGACCATGGTAGG + Intronic
1136223641 16:28844647-28844669 CTGCAGAGGGTGGGGCTGGATGG - Intronic
1136458662 16:30396476-30396498 CTCAAGAAGCTTAGGGTGGTAGG - Intronic
1137432028 16:48426395-48426417 CTCAGGAGGCTGAGGTTGGTTGG - Intronic
1138727372 16:59154556-59154578 CTCCAGGGGGAGAGGGTCATTGG + Intergenic
1139521870 16:67487425-67487447 CTCCAGAGGCTGAGGTGGGGAGG + Intergenic
1139850755 16:69950644-69950666 GTCACGTGGGTGAGGGTGGTGGG + Intergenic
1139862521 16:70036027-70036049 ATCCATAGGGTGAGGATGGGAGG + Intergenic
1140038900 16:71392285-71392307 CTCAGGAGGTTGAGGGTGGGAGG + Intergenic
1140372785 16:74421992-74422014 GTCACGTGGGTGAGGGTGGTGGG - Intergenic
1140827291 16:78718597-78718619 CTCTGGAGGGTGACGGTGGGAGG + Intronic
1141388556 16:83645594-83645616 CACCTGAGGGTGCGGGAGGTTGG - Intronic
1141424864 16:83938320-83938342 GTCCAGAGGGTGAGAGGAGTGGG - Intronic
1141426303 16:83946698-83946720 CTCCAGGGGGTGGGGGTGCAGGG - Intronic
1141956270 16:87373638-87373660 CTCCGGAGGCTGAGGGAGGCTGG - Intronic
1142266205 16:89065056-89065078 CTCCACATGCTGTGGGTGGTGGG - Intergenic
1142348794 16:89570595-89570617 GTCCAGAGGGTTAGCGTGGTGGG + Intergenic
1142368008 16:89660435-89660457 CACCAGAGGGTGGGGGAGGAAGG + Intronic
1143141581 17:4744459-4744481 CTGCAGAGGGTGAGGGCTGAGGG + Exonic
1143370791 17:6437798-6437820 CTGTTTAGGGTGAGGGTGGTGGG - Intergenic
1143481201 17:7228169-7228191 CTAGAGAAGGTGAGGGTGGAAGG + Intronic
1143539076 17:7558794-7558816 CTCCTGAGGCTGAGGGAGGGTGG + Exonic
1143583943 17:7842212-7842234 CTCCAGCGGGGGCGGGGGGTAGG + Intronic
1144770990 17:17759471-17759493 CATCAGAGGGTGGGGGTGGTGGG - Intronic
1144801062 17:17927770-17927792 CTCAGGAGGCTGAGGGTGGGAGG - Intronic
1144828776 17:18120751-18120773 CTCCAGTGGGAGAGGGTCCTGGG - Exonic
1144838836 17:18173157-18173179 CTCCTGGGGGTGAGGGAGCTGGG + Intronic
1147402796 17:40191261-40191283 CGCCAGGGGGTGAGGGGAGTGGG - Intronic
1147657430 17:42098660-42098682 CTCCAGGGGGTGCGGGGGGTGGG + Intergenic
1147957805 17:44146801-44146823 TAGCAGAGGGTGGGGGTGGTGGG + Intronic
1148135035 17:45286740-45286762 CTCCAGAGGGTGAGGTTTCCAGG + Exonic
1148191557 17:45681909-45681931 CTGCAGAGCGTGAGGGTATTTGG - Intergenic
1148763559 17:50022320-50022342 CTCCAGAGGGAGAGACTGGTAGG - Intergenic
1149498205 17:57132445-57132467 CTGGAGGGGGTGAGGGTGGGCGG + Intergenic
1149498262 17:57132589-57132611 CTGGAGGGGGTGAGGGTGGGTGG + Intergenic
1151362687 17:73598110-73598132 CTCCCCAGGGGGAGGGTGCTAGG + Intronic
1151654337 17:75488809-75488831 CTCCCCGGGGTGAGGGTGGAGGG - Exonic
1152314617 17:79572870-79572892 CTGCATGGGGTGAGGGTGGGTGG - Intergenic
1152378246 17:79929585-79929607 CGGCTGAGGGTGAGGGTGGAGGG + Intergenic
1152517956 17:80837143-80837165 CTCAAGAGGGACAGTGTGGTCGG + Intronic
1152789436 17:82270948-82270970 TTCCAGAGGTGGAGGGTGGAAGG - Intronic
1153201756 18:2655126-2655148 CCCCAGAGGGTGCGGGGGGCGGG + Intergenic
1154066327 18:11110582-11110604 CTTCAGAGGTGGACGGTGGTGGG + Intronic
1155422820 18:25673756-25673778 CGCCAGAGGCTGGGGGTGATCGG - Intergenic
1156507636 18:37608509-37608531 CTTCAGAGGCTGAGGGAGCTGGG + Intergenic
1157215357 18:45778498-45778520 CTCAAGAGGCTGAGGCGGGTGGG - Intergenic
1157384015 18:47247357-47247379 CTCCAGAAGGTGCGGATGGTGGG + Intronic
1157589047 18:48825192-48825214 AACCAGAGGGAGAGGTTGGTGGG - Intronic
1157615797 18:48987105-48987127 CTCCAGAGGCTGTGGGAGGGCGG - Intergenic
1158427598 18:57353310-57353332 TTCAGGAGGGTGAGGGTGGAGGG + Intronic
1158559221 18:58499560-58499582 CTCCTTAGGGTGAGGGTTATGGG + Intronic
1159732850 18:72053322-72053344 CAAGGGAGGGTGAGGGTGGTGGG + Intergenic
1159908236 18:74118103-74118125 CTTGAGAGGCTGAGGGTGGGAGG - Intronic
1160290543 18:77589434-77589456 CTCCAGGAGCTGAGGGCGGTAGG + Intergenic
1161280554 19:3443312-3443334 CTCGAGAGGCTGAGGTTGGGAGG + Intronic
1161437576 19:4273006-4273028 CTTCAGAGGGTGAGGGTAGGGGG - Intergenic
1161533811 19:4806437-4806459 CTCCAGAGGCTGAGGTGGGAGGG - Intergenic
1161592876 19:5136652-5136674 CTCCAGAGCAGCAGGGTGGTGGG - Intronic
1162180499 19:8865690-8865712 GCCCACAGGGTCAGGGTGGTAGG + Exonic
1162235116 19:9302916-9302938 CTCCGGAGGCTGAGGTGGGTGGG + Intronic
1162834159 19:13305210-13305232 CACCTGAGGGTGAGGGAGCTGGG + Intronic
1162963785 19:14145666-14145688 CGCCAGGGGGTGAGGTTGGAGGG + Intergenic
1163154242 19:15431516-15431538 GTCTCGAGGGTGAGGGTGGGAGG + Intronic
1163284607 19:16338577-16338599 CTCGAGAGGATGCGGGTGGAGGG - Intergenic
1163315832 19:16539927-16539949 CTCAAGAGGCTGAGGCTGGAGGG - Intronic
1164275364 19:23712642-23712664 TATCAGAGGTTGAGGGTGGTGGG - Intergenic
1164526015 19:29014340-29014362 GTCCAGCGGGGGAGGGTGGGTGG - Intergenic
1164846891 19:31439868-31439890 CTCCAGGGCGTGGGGGTGGAGGG + Intergenic
1165103326 19:33453204-33453226 CTCCAGAGGCTGAGGGGGGAAGG + Intronic
1166047216 19:40236554-40236576 GGCCAGAGGGTGAGGAGGGTTGG - Intronic
1166137341 19:40785808-40785830 GTTCAGTGGGTGAGGGTGGAAGG + Intronic
1166315247 19:41985778-41985800 CTCCTGAGTGTGAGGGAGGAGGG + Intronic
1166688637 19:44810164-44810186 GCCCAGAGGGTGAGGGAGGGTGG + Intronic
1166975315 19:46602024-46602046 CTCCCGAGGGTGGGGGAGGGTGG + Intronic
1167264804 19:48478203-48478225 CTCCTGGGGCTGAGGGAGGTGGG + Intronic
1167511128 19:49895870-49895892 CCCCAGAGGGTGATTGTGGTTGG - Exonic
1167638757 19:50668885-50668907 CTCGGGAGGATGAGGGGGGTGGG + Exonic
1167668954 19:50838873-50838895 CTCCTGAGTCTGAGGGAGGTGGG + Intergenic
1167791911 19:51688539-51688561 CCCCAGTGGGTGGGGGTGGGGGG + Intergenic
1167907197 19:52671517-52671539 CACCAGAGGTTGAGGGTGCAAGG - Intronic
1167956707 19:53071253-53071275 CTCAAGAGGCTGAGGGTGCTGGG + Intronic
1168011908 19:53539714-53539736 CTCCTTAGGGTGGTGGTGGTGGG - Intronic
925032137 2:659198-659220 CACCAGAGGTCGAGGGGGGTAGG + Intergenic
925644709 2:6023940-6023962 CACCAGAGGGAGAAGGTGGAAGG + Intergenic
926234994 2:11034372-11034394 ACTCAGAGGGGGAGGGTGGTTGG - Intergenic
926699638 2:15795220-15795242 CTCCTGGGGGTGGGGGTGGGGGG - Intergenic
927576876 2:24207818-24207840 CTGCAAAGGGAGAGGGTGGATGG + Intronic
928445395 2:31329430-31329452 CTCCAGAAGGCGAGGGGGTTGGG - Intergenic
928772640 2:34720238-34720260 CTCCAGTGGGTGTGTGTGTTTGG + Intergenic
928907139 2:36380428-36380450 CTCCAGAGGGTGACCTTGATAGG + Intronic
929054113 2:37861518-37861540 TTCCACAGGATGAGGCTGGTTGG - Intergenic
929167626 2:38899535-38899557 TTCCAGAGGCTGGGGGTGGATGG + Intronic
930743734 2:54860171-54860193 CTCCACAGGGAGAGGTTGGGTGG - Intronic
932054311 2:68429497-68429519 CTCCAGAGGTTGGGGGAGGGAGG - Intergenic
933665624 2:84962243-84962265 CTCAGGAGAGTGAGGGTGGGAGG + Intergenic
934508198 2:94913326-94913348 CTACAGAGGGTGAGTGTGAATGG - Intergenic
934654639 2:96110802-96110824 CACCTGGAGGTGAGGGTGGTGGG - Intergenic
934762023 2:96861686-96861708 CTCCAGGGACTCAGGGTGGTTGG - Intronic
935152602 2:100451037-100451059 CTCCTGAGGGTACAGGTGGTAGG + Intergenic
935946400 2:108290196-108290218 CTCCATAGGGTGGGGGTGAGGGG - Intronic
936096741 2:109536036-109536058 CTGCAGTGGGTGGGGGTGGGGGG + Intergenic
936116041 2:109704020-109704042 CTACCTAGGCTGAGGGTGGTGGG + Intergenic
936398168 2:112145377-112145399 CTCCAGAGGCTGAGGCAGGAGGG - Intronic
936867273 2:117088839-117088861 CTCCAGAGGCTGAGGTTGGTGGG - Intergenic
937308725 2:120888152-120888174 CTCCAGAGGGAGAAGGGAGTCGG + Intronic
937982957 2:127625626-127625648 CCCCAGGGGGTGGGGGTTGTGGG - Intronic
938036048 2:128035834-128035856 CTCAGGAGGCTGAGGGTGGTGGG + Intergenic
938562952 2:132490714-132490736 CTGAACAGGGTGAGGGAGGTAGG + Intronic
938685526 2:133734121-133734143 CTCCAGAGGCTTGGGATGGTAGG - Intergenic
939170450 2:138689327-138689349 CCCCAGAGGAGGAGAGTGGTTGG + Intronic
940659076 2:156524140-156524162 CTCCAAAAGGTGGGGGTGGGTGG - Intronic
942135255 2:172919028-172919050 CTGCAGAGGAGGAGGGTGGGAGG + Intronic
943364831 2:186958911-186958933 CTCCAGAAGATGATGGGGGTAGG + Intergenic
943637813 2:190325718-190325740 CTCAAAAGGGTGGGGGTGGGGGG - Intronic
944550673 2:200841828-200841850 CTCCAGAGGCTGAGGCAGGAAGG + Intergenic
944636206 2:201678356-201678378 TTCCAGAGGGCGTGGGTGGGTGG - Intronic
944897258 2:204177812-204177834 CTGGTGAGGGTGAGGGTGGAGGG + Intergenic
945986852 2:216361794-216361816 CTCCAGTGAGAGAGGGTAGTAGG + Intronic
947461617 2:230308645-230308667 TTCCAGAGGGAGAGTGTGATTGG + Intronic
947470699 2:230398846-230398868 TTCCAGAGGGAGAGTGTGATTGG + Intronic
947926326 2:233925544-233925566 GTCCAGAGAGAGAGGGAGGTGGG + Intronic
948021308 2:234735977-234735999 CTGCAGGGGTTGAGGGTTGTAGG - Intergenic
948271154 2:236674201-236674223 CCACAGAGGGTGTGGGAGGTGGG + Intergenic
949034968 2:241812118-241812140 CCCCAGAGGGTGTGCGTGGAGGG + Intronic
1170602980 20:17855797-17855819 CTCCAGAGGCTGAGGTGGGAGGG + Intergenic
1170611940 20:17921631-17921653 CTCCAGAGGCTGAGGTGGGAGGG + Intergenic
1170749588 20:19133687-19133709 ATCCAGAGCCTCAGGGTGGTTGG - Intergenic
1170956097 20:20980741-20980763 CTCAAAAGGGTGAGAGTGGGAGG - Intergenic
1172188099 20:33044085-33044107 CTCCATGGGGTGCAGGTGGTTGG - Intergenic
1172226906 20:33311244-33311266 CCCCAGAGGGTGTGGGTGATGGG - Intergenic
1172305192 20:33875608-33875630 CTCCATGGGGTGAGCGTGGGGGG - Intergenic
1172733566 20:37109074-37109096 CTCAAGAGGCTGAGGGAGGTAGG + Intronic
1172767521 20:37358722-37358744 CTCCAGGGCGTGAGTTTGGTAGG + Intronic
1173671276 20:44800720-44800742 CTGCAGAGTGAGAGGCTGGTGGG - Intronic
1174015674 20:47486192-47486214 CTCAAGAGGCTGAGGCTGGAGGG + Intergenic
1174244240 20:49164406-49164428 CTCCAGAGGCTGAGGCAGGAGGG - Intronic
1174716698 20:52766454-52766476 CGCCAGAGGGAGAGGGTCTTGGG + Intergenic
1174965614 20:55211182-55211204 CTTAAGAGGGGGAGGGTGGAAGG + Intergenic
1175191816 20:57216623-57216645 CTCCTGAGGGTGAGGGGGCTGGG + Intronic
1175943159 20:62547176-62547198 CTGCTGAGGGTGAGGGTGGAGGG - Intergenic
1176032970 20:63022637-63022659 CTGCAGGGGGTGGGGGAGGTGGG + Intergenic
1177905270 21:26966197-26966219 CGCCAGGGGGTGCGGGTGGCCGG + Exonic
1179218909 21:39389402-39389424 CTCCAGAGTGTTAGGGTTGCAGG + Intronic
1179663379 21:42892812-42892834 CGACAGAGGGTGAGGGAGCTGGG + Intronic
1181470761 22:23137943-23137965 GGCAACAGGGTGAGGGTGGTTGG - Intronic
1181476559 22:23171418-23171440 CTCCAGAGGCTGAGGTGGGAGGG - Intergenic
1181580416 22:23824995-23825017 CTCCCGAGGGTGACTGTGCTGGG + Intronic
1181619459 22:24078827-24078849 TTCAAGAGAGTGAGGGAGGTAGG - Intronic
1181619889 22:24083652-24083674 CTCTGGAGGGTGAGGGTAGGAGG + Intronic
1183343258 22:37293739-37293761 CTTCAGGGGGTGCTGGTGGTTGG + Intronic
1183605192 22:38863821-38863843 CCCCATAGGGTGGCGGTGGTGGG + Exonic
1184155134 22:42662369-42662391 CTCCAGAGCGTGGAGGTTGTGGG - Intergenic
1184156044 22:42667879-42667901 ATCAAGAGGGTAAGGGTGGCCGG - Intergenic
1184606122 22:45575829-45575851 CCCTAGAGGGCGGGGGTGGTTGG - Intronic
1185110284 22:48896697-48896719 TTGCAGGGGGTGAGCGTGGTGGG + Intergenic
950965039 3:17140155-17140177 CTGCAGAAGGTGAGGATGCTGGG + Intergenic
951251198 3:20395854-20395876 CACCAGAGGGTGAGGGCAGGTGG - Intergenic
951914188 3:27782111-27782133 CTCAAGAGGCTAAGGGTGGGAGG + Intergenic
952326666 3:32326357-32326379 ATATAGAGGGAGAGGGTGGTTGG - Intronic
952430630 3:33219380-33219402 CACCTTAGAGTGAGGGTGGTAGG - Intergenic
953626194 3:44573795-44573817 CTCTAGAGGGTTAGTGTGGTAGG - Intronic
953827855 3:46269583-46269605 CACCAGAGGGTGAGGATGGATGG - Intergenic
954109821 3:48427762-48427784 CTCCCCAGGGAGAGGATGGTTGG - Intronic
954306546 3:49728909-49728931 TTCCAGAGGCTGAGGGTGAGAGG - Intronic
954306656 3:49729837-49729859 TTCCAGAGGCTGAGGGTGGGAGG - Intronic
954362293 3:50128466-50128488 AGCCAGAGGGTGAGGGAGGTAGG - Intergenic
954512060 3:51133927-51133949 CCACTGAGGGTGAGGGTGGGAGG - Intronic
954802728 3:53196462-53196484 CTCGGGAGGCTGAGGGTGGGAGG - Intergenic
955473626 3:59313067-59313089 CTCCAGAGGCTGAGGAGGTTGGG - Intergenic
956881108 3:73511435-73511457 TTCCAGGGGGTGAACGTGGTGGG + Intronic
956963402 3:74430498-74430520 CTCCAGAGGCTGAGGTAGGAGGG + Intronic
958505610 3:94973591-94973613 CTCCAGTGGGTGTGTGTGTTCGG - Intergenic
958677707 3:97288232-97288254 CTACAGAGGGTGAGGAAGGAAGG - Intronic
958851973 3:99338328-99338350 TACCAGAGGCTGAGGGTGGGAGG - Intergenic
961369400 3:126420221-126420243 CTCCAGAGGGTGAGTGGGCTCGG + Exonic
961471006 3:127112605-127112627 CTTCAGAAGGTGAGGGTCCTGGG + Intergenic
961599143 3:128045651-128045673 CTGCAGAGGGTGGGGATGCTAGG + Intergenic
961723848 3:128912923-128912945 CTCCAGGGTGTGAGGTGGGTGGG + Exonic
962276528 3:134018756-134018778 ATCCTGAGGGTGGGGGTGGGAGG - Intronic
962492289 3:135906374-135906396 CTCCAGAGGCTGAGGTGGGAGGG - Intergenic
964244712 3:154638204-154638226 CTCCTGGGGGTGGGGGTGGCAGG + Intergenic
966905461 3:184521168-184521190 CTCCAGAGGCTGAGGTGGGAGGG - Intronic
967995486 3:195163298-195163320 CTCAAGAGGGAGAGAGTGGTTGG - Intronic
968036803 3:195554436-195554458 CTCCAGAGGCTGAGGTAGGGAGG + Intergenic
968434698 4:578444-578466 CCCTAAAGGGTGAGGGTGGAAGG + Intergenic
968447719 4:660697-660719 CCCCAGAAGGTGAGGGGGATGGG + Intronic
968789430 4:2649264-2649286 CTCCAGAGAGTGAGTGGGGGAGG + Intronic
969632516 4:8346768-8346790 CTCGGGAGGGTGAGGTAGGTGGG + Intergenic
969695165 4:8730060-8730082 CTGGAGAGGTGGAGGGTGGTAGG + Intergenic
969871166 4:10106088-10106110 CTGCTGGGGGTGAGGGTGGAAGG + Intronic
970015636 4:11509679-11509701 TGCAAGAGGGTCAGGGTGGTTGG + Intergenic
970235649 4:13955681-13955703 CACCAGAAGGTGAGCGGGGTGGG + Intergenic
970405448 4:15758693-15758715 GGCTAGAGGGTGAGGGTGTTAGG - Intergenic
970522374 4:16898754-16898776 CTCCAGAGAGGGAGGGAGGTTGG + Exonic
971406025 4:26321241-26321263 CTCCAGCGCGTGAGGGCGGGCGG + Intronic
971594968 4:28515531-28515553 CTCCGGAGGCTGAGGCTGGCAGG + Intergenic
972204478 4:36755281-36755303 CTCCCAAGGGAGAGGGAGGTGGG + Intergenic
972299169 4:37768935-37768957 CTAAAGAAGGTGAGGGTGGCCGG + Intergenic
973194766 4:47426948-47426970 CTCCAGAGAGTGTGGGAGGAAGG + Intergenic
973299307 4:48561906-48561928 CTCAGGAGGCTGAGGGTGGAGGG + Intronic
975143257 4:70939572-70939594 CTCAAGAGGCTGAGGCTGGGAGG + Intronic
975145198 4:70959315-70959337 CGCTAGAGGCTGAGGGTGGGAGG - Intronic
975621093 4:76297397-76297419 TTACAGAGGGTGGGGGTGGGAGG + Intronic
975879265 4:78883953-78883975 CTCCAGAGGCTGAGCCTGGGAGG + Intronic
977032910 4:91909631-91909653 CTCCAGAAGGTGAGTCTGCTTGG - Intergenic
979028891 4:115613856-115613878 CTCCAGAAGCTGAGGTTGGAAGG + Intergenic
980000872 4:127486237-127486259 CTGCAGAGGGTGAGGGTGCTTGG + Intergenic
980282700 4:130741034-130741056 TACCAGAGGTTGAGGGTGGAGGG - Intergenic
981591338 4:146366094-146366116 TTCCATGGGGTGAGGCTGGTGGG - Intronic
982206458 4:153000696-153000718 CTCAACAGGGTGATGGGGGTGGG + Intergenic
985033969 4:185820191-185820213 GTCCAGACGGTGAGGGCCGTGGG + Intronic
985724429 5:1508350-1508372 CTCCAGAGGGTGACTGTATTTGG + Intronic
985808607 5:2067038-2067060 CTGCAGAAGGTGAGTGAGGTCGG + Intergenic
985881453 5:2641778-2641800 GTCCAGGGGGTAGGGGTGGTGGG - Intergenic
986028221 5:3871018-3871040 TGCAACAGGGTGAGGGTGGTGGG + Intergenic
986556190 5:9011804-9011826 CTTCAGATGGTGGGGATGGTAGG - Intergenic
987372614 5:17207262-17207284 CTCCAGAGGCTGAGGCAGGAGGG + Intronic
990353759 5:54944646-54944668 CTCAACATGGTGAGCGTGGTGGG + Intergenic
990362450 5:55034455-55034477 TGCCAGAGGATGGGGGTGGTGGG - Exonic
991275595 5:64842842-64842864 TTTGAGAGGGTGAGGGTGGGCGG - Intronic
992189783 5:74280481-74280503 CTCTAGAGGGTGCTGGTGGTTGG - Intergenic
992327697 5:75678479-75678501 TTCCAGAGGTTAAGGATGGTTGG - Intronic
992350153 5:75920621-75920643 CTGCATAGGGAGTGGGTGGTGGG + Intergenic
992426984 5:76667985-76668007 CTCAAGAGGCTGAGGTTGGGAGG - Intronic
995219566 5:109632817-109632839 CTCCAGGGTGTGTGTGTGGTTGG - Intergenic
995420701 5:111963272-111963294 CACAAGAGGTTGAGCGTGGTGGG + Intronic
996035466 5:118753771-118753793 CTCAGGTGGGTGAGGGTTGTGGG - Intergenic
996532748 5:124543745-124543767 GTCCAGGGAGTGAGGTTGGTAGG - Intergenic
997045094 5:130306419-130306441 CTGGATAGGGTGAGGGTGTTGGG + Intergenic
997215160 5:132103931-132103953 CTGCAGTGGGTGGGGGGGGTGGG - Intergenic
997322633 5:132991114-132991136 CTCCAGAGGCTGAGGTAGTTAGG + Intergenic
997382568 5:133448332-133448354 CTTCAGACGGTGTGGGTGCTGGG - Intronic
998128172 5:139637988-139638010 CTCAGGAGGGTGAGGGTGGGGGG - Intergenic
999082868 5:148860767-148860789 CTCCAGTGGGTGAGTCAGGTTGG + Intergenic
999370239 5:151050772-151050794 CTCAAGAGGGTGGGGGTGTGTGG - Intronic
999690695 5:154143639-154143661 CTCCAGTGGGGGTGGGTGTTGGG + Intronic
999747306 5:154602177-154602199 CTCCAGAGGCTGAGGAGGGAGGG + Intergenic
999972919 5:156883024-156883046 CTCCAGAGGTGGATGGTGGGAGG + Intergenic
1000128992 5:158276599-158276621 CTCCAGAGGATGAGGATAGACGG - Intergenic
1000346228 5:160316328-160316350 CTTCAGAGGTTGAGGGTGGAGGG - Intronic
1001091997 5:168748447-168748469 CCAGAGAGGGTGAGGGTTGTGGG + Intronic
1001894559 5:175367161-175367183 CTCTGAAGGGTGAGGGTGATAGG + Intergenic
1002439153 5:179255419-179255441 CTCTAGAGGGTGAGGATTGGGGG + Intronic
1003298506 6:4855396-4855418 CTCCAGAGGATGAGGTGGGAGGG - Intronic
1003536999 6:6983948-6983970 CTCGGGAGGCTGAGGGTGGGAGG + Intergenic
1004339792 6:14798323-14798345 CTCTACAGGGGGAGGGAGGTGGG - Intergenic
1005048843 6:21665833-21665855 CTCCAGAGGGACAGCGTGGGTGG + Intergenic
1005855927 6:29863413-29863435 ATCCAGAATGTGAGGGTGGGTGG + Intergenic
1006047517 6:31309476-31309498 TTCCAGAATGTGAGGGTGGGCGG - Intronic
1006271948 6:32971861-32971883 CTCCAGGGAAAGAGGGTGGTTGG - Exonic
1006305325 6:33215114-33215136 CTGCAGTGGGTGAGGGAGATGGG + Intergenic
1006886245 6:37384560-37384582 CTCCAGAGGTTGGGGGTGTCTGG + Intronic
1007628083 6:43257789-43257811 CTGCAGGGGGTGAGGGTGATGGG - Intronic
1011745634 6:90405328-90405350 CTCCAGAGGCTGAGGCGGGAGGG - Intergenic
1011818694 6:91224518-91224540 CTCCAGAGGCTGAGGTGGGAGGG - Intergenic
1012382320 6:98634791-98634813 CTCCACAGGGTGAGGTGTGTAGG - Intergenic
1013193299 6:107822329-107822351 CTCCTGGGGGTGAGGGTGAAAGG - Intronic
1013468426 6:110438432-110438454 CTCAAGAGGCTGAGGGTAGGAGG - Intronic
1014930698 6:127332558-127332580 CTTCTGTGGGGGAGGGTGGTGGG + Intronic
1015520471 6:134125590-134125612 CTCCAGAGGCTGAGGTTAGGAGG - Intergenic
1016599192 6:145837742-145837764 GCCAAGAGTGTGAGGGTGGTAGG + Intergenic
1016740588 6:147524634-147524656 CTCCACAGGGAGAAGGAGGTAGG - Intronic
1017716504 6:157217264-157217286 TTCAAGGGTGTGAGGGTGGTGGG + Intergenic
1018880011 6:167868301-167868323 CTCAAGAGGCTGAGGTTGGAGGG + Intronic
1018961842 6:168454981-168455003 CTCCAGAGGGTCTTGGTGGCCGG + Intronic
1018995869 6:168710059-168710081 CTCCAGTGGGTGCGGGTGAAGGG + Intergenic
1018998650 6:168729198-168729220 CACCAGAGGCTGAGCGTGGCAGG - Intergenic
1019340036 7:504602-504624 CTGCAGAGGCTGGGGGTGGGTGG - Intronic
1019460288 7:1154555-1154577 CTCCAGAGGCTGAGGGTCCCAGG + Intronic
1019526147 7:1481361-1481383 CTCCAGAGTCTGGGGGTCGTGGG + Exonic
1019538645 7:1541569-1541591 CTCCAGAGGGCGCGGCGGGTGGG + Exonic
1019779239 7:2929857-2929879 CTGCAGGGGGAGAGGGTGGTGGG + Intronic
1019843088 7:3468900-3468922 CTTCAGAGGGTGAAGGGGGTAGG + Intronic
1020596573 7:10213923-10213945 CCCCAGAGGATGACGGGGGTGGG + Intergenic
1020864026 7:13533596-13533618 CTTCAGAGGCTGAGGATGGGAGG - Intergenic
1021668587 7:23013373-23013395 CTCCAGGGGGCGAGGGCGGGGGG + Intronic
1021939662 7:25667340-25667362 ATCCAGTGGATGGGGGTGGTGGG + Intergenic
1022045123 7:26616717-26616739 CTCCAGATGGAGCGAGTGGTTGG + Intergenic
1023254980 7:38304442-38304464 CTCCAGAGTGTGCAGGGGGTGGG + Intergenic
1023506453 7:40904036-40904058 CCAGAGAGGCTGAGGGTGGTTGG - Intergenic
1023530175 7:41145073-41145095 CTCTAGATTGTGAGGGTGTTAGG + Intergenic
1023849592 7:44142798-44142820 CTCCAGAGGCTGAGGCAGGAAGG - Intergenic
1024324955 7:48102215-48102237 CTACACAGTGTGAGGGTGGCAGG + Intronic
1024983862 7:55179502-55179524 CTCCCGTGGGTAAGGGTGGAGGG + Intronic
1025607103 7:63047354-63047376 CTGAAGATGGTGAGGGAGGTTGG - Intergenic
1026138750 7:67686546-67686568 CTCCAGAGGCTGAGTGAGGCAGG + Intergenic
1027131515 7:75594435-75594457 CTGCAGAGGGTGGGTGTGTTTGG - Intronic
1030316467 7:108119970-108119992 ATCCAGAGGTTGATGGGGGTTGG - Intronic
1033582692 7:142751564-142751586 CTCCAGAGGTTGGTGGTAGTGGG - Intronic
1033662389 7:143411033-143411055 CTCCAGAGGGTGGGGGGTGGGGG + Intergenic
1034489003 7:151382911-151382933 CACCTGAGGGTAAGGGTGCTGGG + Intronic
1035970732 8:4245331-4245353 CTGCAGAGGGTTGGGGTGGGAGG + Intronic
1037848198 8:22303501-22303523 CTCCAGAGACTGAGGGAGGTGGG - Intronic
1038367323 8:26949019-26949041 CTCCAGTGGGTGTGTGTGTTCGG + Intergenic
1038844680 8:31217436-31217458 CTCCAGTGGCTGAGGGTGAGAGG - Intergenic
1039310968 8:36317342-36317364 CTCCTGATGGTGGGGGTGGAGGG + Intergenic
1039568500 8:38567583-38567605 CTCAAGGAGGTGAGGCTGGTCGG - Intergenic
1041207318 8:55511938-55511960 CTCCAGAGGGGGAGTGGAGTGGG + Intronic
1041538426 8:58955200-58955222 TTCCAGAGGGTGCTGGGGGTCGG + Intronic
1042079676 8:65037559-65037581 CTCCAGAGTGTGTGTGGGGTGGG - Intergenic
1043694211 8:83200555-83200577 CTCCAGAGAATGTGTGTGGTAGG - Intergenic
1044668606 8:94655947-94655969 CTCCAGAGGCTGAAGCTGGAGGG + Intronic
1045011997 8:97966447-97966469 CTCCAGAGGCTGAGGTGGGAGGG + Intronic
1045465668 8:102467632-102467654 CTCCAGAGGCTCAGGCTGGAGGG - Intergenic
1045964419 8:108007830-108007852 CTCCAGAGGCTGAGGCAGGAGGG + Intronic
1046889196 8:119402494-119402516 CTCAAGAGGGTGAATGAGGTTGG - Intergenic
1047310366 8:123686748-123686770 CTCCAGAGGCTGGATGTGGTGGG + Intronic
1047697218 8:127415907-127415929 CTCCAGGCGGTGGGGGTGATGGG + Exonic
1047952627 8:129947695-129947717 GTCCACATGGTGTGGGTGGTTGG - Intronic
1049138493 8:140928768-140928790 TTCCAGAGGATGAGGCTGGAAGG + Intronic
1049304463 8:141893569-141893591 AGCCAGATGGTGAGGGTGGCTGG - Intergenic
1051255603 9:15209954-15209976 TTCCAGAGGGTGAGTATGATAGG + Intronic
1051308494 9:15742880-15742902 CTCAAGAGGGTGAAGGTGGGAGG - Intronic
1051407007 9:16748403-16748425 CTCCAGAGGCTGAGGTGGGAGGG + Intronic
1052769133 9:32671508-32671530 CTGCAGATGGTGAGGGTGCCAGG - Intergenic
1053055295 9:34990132-34990154 CTCGGGCGGGGGAGGGTGGTCGG - Intronic
1053315172 9:37045028-37045050 CTCCTGAGGGTGGGGGTTGGTGG - Intergenic
1053327644 9:37169953-37169975 CTCAAGAGGCTGAGGCTGGAGGG + Intronic
1055171619 9:73266031-73266053 CTTCAGAGGATGCAGGTGGTAGG + Intergenic
1055480584 9:76705524-76705546 CTCCAGAAGGTGACGGTTCTTGG - Exonic
1056943254 9:90973183-90973205 CTCGAGAGGGTGAGGTGGGAGGG - Intergenic
1057280603 9:93708534-93708556 CTCCAGAGGGTGCTGCTGGGAGG + Intergenic
1057892738 9:98881550-98881572 CCCCAGTGGGTGAGGATGGGAGG + Intergenic
1058421243 9:104835356-104835378 CTGCAGTGGAGGAGGGTGGTTGG - Intronic
1058718499 9:107742679-107742701 CTCCAGAGGAGCAGGGTGGCAGG + Intergenic
1059424077 9:114209974-114209996 CGTGAGAGGGTGAGAGTGGTGGG + Intronic
1060027302 9:120183960-120183982 CTCCAGAGGGTGGAGGAGGGGGG + Intergenic
1060581069 9:124747300-124747322 CTCGAGAGGCTGAGGCGGGTTGG - Intronic
1060970732 9:127736165-127736187 CTCCAGTGGGTGGGGGAGGTGGG - Intergenic
1061023553 9:128032768-128032790 CTCCTGAGGCTGAGGGGGGAGGG - Intergenic
1061048559 9:128180707-128180729 CACCAGAAGGTGAGGGAGGGAGG - Exonic
1061130139 9:128703801-128703823 CTCCAGAGGAAGGGGGTGGGAGG - Intronic
1061287481 9:129632334-129632356 CTCCGGAGGGTGAGGTGGGAGGG + Intronic
1185736282 X:2499339-2499361 GTTCAGAGGGTCAGTGTGGTGGG - Intronic
1186096600 X:6109156-6109178 CTCCAGAGGCTGAGGGTGGAGGG + Intronic
1187098121 X:16167869-16167891 CTCCCGCGGCTGAGGGAGGTGGG - Intronic
1187766433 X:22647688-22647710 CTGCAGAGGGTGAGGGGAGCAGG + Intergenic
1188797153 X:34481258-34481280 CTGCTGTGGGTGAAGGTGGTGGG + Intergenic
1189808158 X:44755572-44755594 CACAAGGGGGTGAGGGTTGTTGG - Intergenic
1190056706 X:47185419-47185441 CTGTAGAGGGTGAGGGTGGGCGG - Intronic
1190180080 X:48184680-48184702 CACCAGAGGGAGAGGGTGCCAGG - Intergenic
1190184034 X:48219391-48219413 CACCAGAGGGAGAGGGTGCCAGG + Intronic
1190189961 X:48268840-48268862 CACCAGAGGGAGAGGGTGCCAGG + Intronic
1190193097 X:48293900-48293922 CACCAGAGGGAGAGGGTGCCAGG - Intergenic
1190197188 X:48329533-48329555 CACCAGAGGGAGAGGGTGCCAGG + Intergenic
1190199070 X:48344879-48344901 CACCAGAGGGAGAGGGTGCCTGG - Intergenic
1190204895 X:48394778-48394800 CACCAGAGGGAGAGGGTGCCTGG + Intergenic
1190205641 X:48400625-48400647 CACCAGAGGGAGAGGGTGCCTGG - Intergenic
1190214195 X:48469123-48469145 CTCCGGAGGGTGCTGGTGGTGGG - Intronic
1190502507 X:51093548-51093570 CTACAGAGGGTCAGGGGGCTGGG + Intergenic
1190659602 X:52642513-52642535 CACCAGAGGGAGAGGGTGCCAGG - Intergenic
1190663925 X:52679911-52679933 CACCAGAGGGAGAGGGTGCCAGG + Intronic
1190665829 X:52695349-52695371 CACCAGAGGGAGAGGGTGCCTGG - Intronic
1190673589 X:52763061-52763083 CACCAGAGGGAGAGGGTGCCTGG + Intronic
1190675497 X:52778511-52778533 CACCAGAGGGAGAGGGTGCCAGG - Intronic
1190725790 X:53189805-53189827 CTCCAGAGCTTGGGGGTGGGAGG + Intergenic
1192800825 X:74463111-74463133 CTGCAGAGGGAGAGGATGGATGG + Intronic
1192941795 X:75920534-75920556 CTCCAGAGCCTGAGGGCAGTAGG - Intergenic
1193319842 X:80108355-80108377 GTCCTGAGGGTGAGAGTGGGTGG + Intergenic
1193861386 X:86672569-86672591 CTCCAGAGGGTGAAAGTTGTTGG + Intronic
1194249172 X:91552267-91552289 CTCCATAGGGGGAGGGGGGAGGG + Intergenic
1194425656 X:93734319-93734341 CTCCAGAGGCTGAGGTGGGAGGG - Intergenic
1195805326 X:108759215-108759237 CTCCAGAGGCTAAGGTGGGTTGG - Intergenic
1196086840 X:111692894-111692916 CTCCAGAGGCTGAGGTGGGAGGG - Intronic
1197263965 X:124346806-124346828 CTGCTGAGGGTGTGGGCGGTGGG + Intronic
1198367038 X:135951490-135951512 CCCCAGAGGCTGTGGCTGGTTGG + Intergenic
1198780489 X:140229908-140229930 CTCAGGAGGCTGAGGGTGGGAGG - Intergenic
1200568128 Y:4793495-4793517 CTCCATAGGGGGAGGGGGGAGGG + Intergenic
1201553236 Y:15240559-15240581 CTCCAGAGGCTGAGGGGGGAGGG + Intergenic
1201940672 Y:19455782-19455804 CTCCAGAGGCTGATTGTGGGAGG + Intergenic