ID: 903812013

View in Genome Browser
Species Human (GRCh38)
Location 1:26039823-26039845
Sequence CCAGATATGCAGGCTGTGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 291}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903812003_903812013 24 Left 903812003 1:26039776-26039798 CCAATGGCGATGTGGACAGACAG 0: 1
1: 0
2: 1
3: 3
4: 73
Right 903812013 1:26039823-26039845 CCAGATATGCAGGCTGTGCAGGG 0: 1
1: 0
2: 2
3: 26
4: 291
903812007_903812013 -10 Left 903812007 1:26039810-26039832 CCACCGTCAGTGCCCAGATATGC 0: 1
1: 0
2: 5
3: 26
4: 132
Right 903812013 1:26039823-26039845 CCAGATATGCAGGCTGTGCAGGG 0: 1
1: 0
2: 2
3: 26
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903812013 Original CRISPR CCAGATATGCAGGCTGTGCA GGG Exonic
901572806 1:10175263-10175285 ACAGATATGCAGTCTGTCCATGG - Intronic
901839128 1:11942922-11942944 CCAGAGAGGCAGGCTCTGCGTGG + Intronic
902362280 1:15948463-15948485 CAAGACATGCTGGCTGTGCTGGG + Exonic
902975622 1:20086079-20086101 CCAGGTGTGCCTGCTGTGCAAGG + Exonic
903812013 1:26039823-26039845 CCAGATATGCAGGCTGTGCAGGG + Exonic
904009672 1:27382615-27382637 CCAGATATTCAGGCGGATCAGGG + Exonic
904127490 1:28251726-28251748 CAAGATATGCCGGCCGGGCACGG - Intergenic
905790562 1:40787045-40787067 CCAGAGACGCAGGCTGTGGCAGG + Intronic
906312580 1:44764465-44764487 CCAGATATATAGGCTGGGCATGG - Intronic
907253131 1:53156561-53156583 ACAGTTCTGCAGGCTGTACAGGG - Intergenic
907506584 1:54923489-54923511 CAAGAGATGCTGGCTGGGCAAGG - Intergenic
910208943 1:84774749-84774771 CCAGAGAGGCCGGCTGTGGAGGG + Intergenic
910834493 1:91494590-91494612 CCAGACATGTAGGATATGCATGG + Intergenic
913475325 1:119231442-119231464 GCAAATATGCAGGCTGTGTCAGG - Intergenic
915655281 1:157354172-157354194 CCAGACATGCAGCCTCAGCAAGG + Intergenic
916046624 1:161004868-161004890 ATAGATATGGAGGCTGAGCACGG + Intronic
916105777 1:161430529-161430551 CAAGAAAAGCAGGCTGGGCATGG + Intergenic
917862545 1:179161022-179161044 TTAGAAATGCAGGCTGGGCATGG - Intronic
918831759 1:189406878-189406900 GAAGATATGGAGGCTGGGCACGG - Intergenic
920530337 1:206697406-206697428 ACAGTTCTGCAGGCTGTACAAGG + Intronic
920537776 1:206750757-206750779 CAGGATATGCTGGCTGTGCTGGG + Intergenic
920688473 1:208127966-208127988 CAAGATGGGCAGGCTGTGCTGGG - Intronic
921156619 1:212444111-212444133 TCACACATGCAGGCTGAGCAGGG - Intronic
921621549 1:217331141-217331163 ACAGTTCTGCAGGCTGTACAGGG + Intergenic
921666401 1:217877528-217877550 ATACATATGCAGGATGTGCAGGG - Intergenic
924148328 1:241100799-241100821 CCAGATATCGTGGGTGTGCATGG - Intronic
924515158 1:244759922-244759944 CCTGAGATGCAGGCTGGGCGCGG + Intergenic
1063023958 10:2158932-2158954 ACAGTTCTGCAGGCTGTACATGG - Intergenic
1066288845 10:33995641-33995663 CAAGATATGCTTGGTGTGCAGGG + Intergenic
1066413138 10:35193051-35193073 CCAGATGTGGAGGATGGGCAAGG - Intronic
1067545033 10:47186854-47186876 GCAGTTATGCAGCCTTTGCATGG + Intergenic
1068814898 10:61298147-61298169 CCAGAAATGCAGGATGTTTAGGG + Intergenic
1069728528 10:70596563-70596585 ACGGCTGTGCAGGCTGTGCAGGG - Intergenic
1070671092 10:78377644-78377666 CCAGATAACCAGCCTGTGAAAGG - Intergenic
1070696284 10:78565862-78565884 GCAGAGCTGCATGCTGTGCAGGG + Intergenic
1071094601 10:81958610-81958632 ACAGATATACAGGCTGGGCATGG + Intronic
1072620146 10:97074362-97074384 CCAGACAGGCTGGCTGTGCATGG + Intronic
1072956796 10:99894018-99894040 TCAGATATTCAGGCTGGACATGG + Intronic
1073124640 10:101141712-101141734 CCAGCAATGCAGGCTGTGAGTGG - Intergenic
1075217883 10:120554638-120554660 ACAGTTCTGCAGGCTGTACAGGG + Intronic
1075411898 10:122234256-122234278 TCAGACCTGCAGGCTGTGCCTGG - Intronic
1075953348 10:126501224-126501246 CACGTTGTGCAGGCTGTGCAAGG + Intronic
1076482845 10:130796174-130796196 ACAGATATGAAGTCTCTGCAGGG - Intergenic
1076826783 10:132973370-132973392 CCAGCTGGGCAGGCTGGGCAGGG + Intergenic
1077926253 11:6684259-6684281 ACATATATGCAGGCCGGGCACGG + Intergenic
1081402211 11:42656422-42656444 GCAGAGATGGAGGCTATGCAGGG - Intergenic
1081857595 11:46313394-46313416 TTAGAAATGCAGGCTGGGCACGG + Intronic
1084464283 11:69313184-69313206 CCGGATCTGGAGGCTGTTCAGGG - Intronic
1084980367 11:72825613-72825635 CCAGATTTGCAGGATGGGGAGGG + Intronic
1085292092 11:75408360-75408382 CCAGATATGGAGGCTGAGGTGGG + Intronic
1089096142 11:115921683-115921705 CAAGGTATCCAGGATGTGCATGG + Intergenic
1089861050 11:121590234-121590256 CCAGCTATGCAGGATGTGCCTGG + Intronic
1089873217 11:121695283-121695305 CTAGATAAGGGGGCTGTGCATGG - Intergenic
1091100878 11:132872502-132872524 CCAGATATGCAGACTGGGCCAGG - Intronic
1091992979 12:4971873-4971895 ACAGTTCTGCAGGCTGTGCAAGG + Intergenic
1092046213 12:5433174-5433196 CCAGATGTGCGGGCTGCGTACGG - Intronic
1093127489 12:15348307-15348329 CAAGGTATGCAGGCAGTGGAAGG + Intronic
1094394432 12:29990903-29990925 CCAGACCTTGAGGCTGTGCAGGG + Intergenic
1094408205 12:30141706-30141728 ACAAATCTGCAGGCTGTCCAGGG + Intergenic
1098024856 12:66190653-66190675 CCAGATATTCATGCTTTACATGG + Intronic
1098661171 12:73095460-73095482 CCACCTATTCAGGCTGAGCATGG - Intergenic
1100628146 12:96358302-96358324 ACAGATATGCAGATTATGCAGGG + Intronic
1101985039 12:109439367-109439389 CCAGATTTCAAGGCTGGGCATGG - Intronic
1102711817 12:114934557-114934579 CCAGACCTGGGGGCTGTGCAGGG + Intergenic
1103927752 12:124433171-124433193 CCATGCATGCAGGCTGTGCCAGG + Intronic
1104877963 12:132049688-132049710 CCAGGAATGCTGTCTGTGCAAGG - Intronic
1104942224 12:132400525-132400547 ACAGATCTGCAGTCTGGGCAGGG + Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1105706518 13:22970872-22970894 CCACCTAAGGAGGCTGTGCACGG + Intergenic
1106638371 13:31556323-31556345 TCAGACATGCAGACTGAGCAAGG - Intergenic
1106683312 13:32030931-32030953 CCAGAAATGCAGTCTTTTCAAGG - Intergenic
1108255396 13:48604910-48604932 GCAGATATCCAGGCTGGGCGTGG + Intergenic
1108525416 13:51281847-51281869 CCAGATTTGCAGGTGTTGCATGG - Intronic
1108599650 13:51981484-51981506 CCAGATATTCAGGATGTACGTGG - Intronic
1108896589 13:55335754-55335776 ACAGTTCTGCAGGCTGTACAGGG - Intergenic
1111772803 13:92621296-92621318 CCAGATATGGGGGCTGAGGATGG - Intronic
1111911711 13:94320629-94320651 TCAGATTTGCAGGGTGGGCAAGG - Intronic
1112380581 13:98885311-98885333 GTACATATGCAGGCTGGGCATGG + Intronic
1113404797 13:110028684-110028706 TCAGACATACAGACTGTGCAGGG - Intergenic
1113539272 13:111093774-111093796 CCAGATCTGCAGGGGGCGCAGGG - Intergenic
1114344642 14:21781798-21781820 CCAGGTATGCCGGCTGTGGTGGG - Intergenic
1114480464 14:23030621-23030643 TCATATATGCAGGTTCTGCAGGG - Intronic
1117348741 14:54860071-54860093 TCATATATGCAGGTTCTGCAGGG - Intronic
1118022802 14:61736265-61736287 TCAGATATCCAGGCTGGGCGTGG - Intronic
1120024781 14:79570548-79570570 CCTGAGATGCTGACTGTGCAAGG + Intronic
1122174981 14:99910082-99910104 ACAGAAATGCAAGGTGTGCAGGG + Intronic
1122540674 14:102496186-102496208 CCAGAAAAGCAGGCAGTGCCAGG + Intronic
1128144217 15:65323404-65323426 ACAAATATGCAGTCTGGGCAGGG - Intergenic
1128630983 15:69266856-69266878 GAAGATATGTAGGCTTTGCAAGG - Intronic
1128682045 15:69659556-69659578 CCAGACAGGCAGGCTGGGAAGGG - Intergenic
1128761652 15:70220149-70220171 TCATATATGCAGGTTCTGCAGGG - Intergenic
1129270399 15:74416565-74416587 CCAGTTGTGCAGGGTGAGCAGGG - Exonic
1130182326 15:81643178-81643200 CAAGGTCTGCAGGCAGTGCAGGG - Intergenic
1130433174 15:83869554-83869576 CCTGTTATGCAGTCTGTCCAGGG + Intronic
1130960580 15:88656273-88656295 CTAGATGTGCAGGCAGTCCAGGG - Exonic
1131858046 15:96620009-96620031 ACTGATATTCAGGCTGTGCTTGG + Intergenic
1132091493 15:98951163-98951185 CCACATGTGCTAGCTGTGCAAGG - Intronic
1132892303 16:2210323-2210345 CCAGAGCTGGAGGCTGTGCTGGG - Intronic
1132907106 16:2288303-2288325 CCAGAATTGCTGGCAGTGCAGGG + Exonic
1133402014 16:5495083-5495105 ACACTTCTGCAGGCTGTGCATGG + Intergenic
1134064119 16:11216026-11216048 ACAGTTCTGCAGGCTGTACAGGG - Intergenic
1134469241 16:14508237-14508259 ACAAATAGGCAGGCTGGGCATGG + Intronic
1134562559 16:15223284-15223306 CCAGAGATGCAGGCAGAGCCAGG - Intergenic
1134923099 16:18134911-18134933 CCAGAGATGCAGGCAGAGCCAGG - Intergenic
1135074900 16:19384766-19384788 CCAGATCTGCAGGCTGGGACTGG - Intergenic
1135081200 16:19437420-19437442 CGAGAAATGGATGCTGTGCAGGG + Intronic
1138179964 16:54934591-54934613 CCAGATCTGCATTCTGGGCAGGG - Intergenic
1138626642 16:58257305-58257327 TCATATATGCAGGCTGGGCGCGG - Intronic
1139070918 16:63381476-63381498 ACAAATATGAAGGCTGGGCATGG - Intergenic
1141917278 16:87107991-87108013 CCACCAATGCAGCCTGTGCAAGG + Intronic
1142124800 16:88404942-88404964 TCACATAACCAGGCTGTGCAGGG + Intergenic
1142224493 16:88870983-88871005 CTGGGTCTGCAGGCTGTGCAGGG - Intergenic
1144596949 17:16577920-16577942 GCAGGCATGGAGGCTGTGCATGG + Intergenic
1144730148 17:17521352-17521374 CTGGGGATGCAGGCTGTGCAGGG - Intronic
1144983545 17:19185088-19185110 CCAGAAATGTAGGCCGGGCATGG + Intergenic
1144984680 17:19193151-19193173 CCAGAAATGTAGGCCGGGCATGG - Intergenic
1147763230 17:42814776-42814798 CCATATATGCAAGCTGTACTTGG + Intronic
1149076531 17:52602066-52602088 CCTGCTATGCAGCCTGTCCATGG + Intergenic
1149220030 17:54406401-54406423 CCAGAAATCCAAGCTGTGCTTGG + Intergenic
1149337440 17:55650468-55650490 ACAGTTCTGCAGGCTGTACAGGG - Intergenic
1150298564 17:64029103-64029125 CCAGCTGTGCAGGCTCTCCAAGG + Intergenic
1150550430 17:66204634-66204656 CCAGAAATGCTGTCTGGGCAGGG - Intergenic
1151419135 17:73985848-73985870 CTAGCTATGCAGGCTGAGGACGG - Intergenic
1151812364 17:76452311-76452333 CCAGAAATGAAGGCCGTGCCGGG - Intronic
1153697947 18:7663557-7663579 ACAGATCTGCAGTCTGGGCAGGG + Intronic
1155270264 18:24134563-24134585 CCAGATGTCCAGGCCGGGCACGG - Intronic
1156107021 18:33675676-33675698 CAAGATATTCACCCTGTGCAAGG + Intronic
1156947950 18:42857888-42857910 TAACATTTGCAGGCTGTGCACGG + Intronic
1157943301 18:51952884-51952906 TCAGATATGCTAGCAGTGCAAGG - Intergenic
1158235645 18:55310329-55310351 GTAGATATGGAGGCTGGGCACGG - Intronic
1158487668 18:57882013-57882035 ACAGCTATGCAGGCAGTGAAGGG - Intergenic
1159001305 18:62977924-62977946 CCAGCTATGCTTGCTGTGTAAGG + Intronic
1159643266 18:70888121-70888143 CCACAGAAGCAGGCTGTCCAAGG + Intergenic
1160153154 18:76410514-76410536 GCAGGAATGCAGGCTGTGTAGGG - Intronic
1160202118 18:76804630-76804652 CCAAATCTGTAGGCTGTGCCTGG + Intronic
1160855546 19:1215558-1215580 CCAGGGCTGCAGGCTGTGCTGGG - Intronic
1163036803 19:14574403-14574425 GCAGCTGTGCAGGCTGTGCACGG - Intergenic
1163080133 19:14933368-14933390 ACAGATTTCCAGGCTGGGCATGG - Intergenic
1163722947 19:18906886-18906908 CCACATCTCCAGGCTGCGCACGG - Intronic
1165497513 19:36162154-36162176 GCAGAGATGGAGGCTATGCATGG - Intergenic
1165710302 19:38006056-38006078 CCAGATAAACAGGCGGTGAATGG + Intronic
1165715050 19:38039171-38039193 TCAGAAATGCAGGCTAGGCAAGG - Intronic
1166898514 19:46040062-46040084 CCAGATGTGCAGTCTCTGCTGGG - Intronic
1166959142 19:46487564-46487586 CGAGATCTGCAGGCTGGACATGG - Intronic
1167603950 19:50470221-50470243 CCAACTGTGCAGGCTGTGCACGG + Intronic
1168665333 19:58200847-58200869 ACAGTTCTGCAGGCTGTACAAGG + Intronic
925524024 2:4779834-4779856 CCAGGACTGCAGCCTGTGCATGG - Intergenic
925577058 2:5370832-5370854 CCAGAGCTGTAGGCTATGCAAGG + Intergenic
925904945 2:8534816-8534838 CGGGATCTGCAGGCTGTGGAAGG + Intergenic
927706173 2:25297803-25297825 CCAAATGTGCAGGCTGGGCCAGG - Intronic
930787078 2:55281698-55281720 GCAGATAGGCAGGCGGTGCCCGG - Intergenic
932764666 2:74462157-74462179 CCAGGCATGCAGGCGGGGCAAGG + Exonic
932967369 2:76492391-76492413 ACAGACAAGCAGGCTGGGCACGG - Intergenic
934113194 2:88761114-88761136 ACAGATATGCATGCTGTTTATGG - Intergenic
934864036 2:97789855-97789877 CCAGAAATGCCGCCTGTTCATGG - Intronic
934980058 2:98832240-98832262 TAAGATCTCCAGGCTGTGCATGG - Intronic
935146387 2:100398336-100398358 CCCGATCGGCAGGCTGGGCAAGG + Intronic
935662397 2:105478345-105478367 CCAGAAAAGCAGGCCGGGCATGG - Intergenic
935841011 2:107110511-107110533 ACAGTTCTGCAGGCTGTACAGGG + Intergenic
936351073 2:111713051-111713073 CCTGCCATGGAGGCTGTGCAGGG + Intergenic
937785078 2:125886884-125886906 GCAGAGATGGAGGCTATGCATGG - Intergenic
938121978 2:128640416-128640438 CCAGGAAGTCAGGCTGTGCATGG + Intergenic
938187573 2:129245507-129245529 CCAGACATGCAGGATGTAAATGG + Intergenic
938450130 2:131411143-131411165 ACAAATGTGCAGGATGTGCAGGG - Intergenic
938561041 2:132472127-132472149 CCAGGAATGGAGGCTGTGCATGG - Intronic
938906234 2:135838681-135838703 CCTTATATACAGGCTGGGCATGG + Intergenic
939510940 2:143103744-143103766 CCAGAAAAGTAGGCTGGGCATGG - Intronic
940834129 2:158501482-158501504 TCAGGTAGGGAGGCTGTGCAGGG - Intronic
943374692 2:187061762-187061784 CCAGATATGCAGGCCCACCAAGG + Intergenic
946263834 2:218521172-218521194 ACAGTTCTGCAGGCTGTACAGGG - Intronic
946410671 2:219513717-219513739 ACAGATATGCAAGCTGGCCAGGG + Intergenic
947388630 2:229617661-229617683 TCAGAAATTCAGGCTGGGCATGG + Intronic
947524206 2:230868635-230868657 CCAGGTATGCAGGCTGGGGAGGG - Intronic
947642485 2:231714726-231714748 GCAGATACCCAGGCTGTGCAGGG - Intergenic
948652478 2:239457098-239457120 ACATAAATCCAGGCTGTGCAGGG - Intergenic
948731449 2:239966317-239966339 CCAGACATGGAGGATGAGCAGGG + Intronic
1168780826 20:488293-488315 ACTGATGTGCAGGCTGGGCACGG - Intronic
1169020931 20:2330362-2330384 CCAGAGCTGAAGGCAGTGCACGG - Intronic
1169108045 20:3014002-3014024 CCAGGTGTTCAGGCTGTTCAGGG + Intronic
1169720624 20:8672578-8672600 CCAGATATGCATACCGAGCAGGG + Intronic
1171196403 20:23202993-23203015 CCAAGAATGCAGGCTTTGCATGG - Intergenic
1172020666 20:31911548-31911570 CCAGAGATGCAGGATGGGCCAGG - Intronic
1174075174 20:47930123-47930145 CTAGGTATGGAGGGTGTGCAGGG + Intergenic
1174361652 20:50032632-50032654 CCCTATATGCATGGTGTGCATGG - Intergenic
1174548902 20:51346770-51346792 ACAAATATGCAGTCTGGGCAAGG + Intergenic
1174665177 20:52251427-52251449 CCAGATATGAAGGATGAGAAAGG - Intergenic
1175980041 20:62734131-62734153 CCAGAGAAGGAGGCTGCGCAGGG - Intronic
1179594959 21:42437334-42437356 CCATACTTGGAGGCTGTGCAGGG + Intronic
1180145131 21:45914573-45914595 CCAGATCTGCAGACTGGGTATGG - Intronic
1180867603 22:19128358-19128380 GCAGATATGCAGCCAGGGCACGG + Intergenic
1182621664 22:31621772-31621794 CCAGATGTACAGGCTGTAGACGG + Exonic
1184218892 22:43086454-43086476 CCTGATATCCAGGGTGTTCATGG - Intronic
1184897853 22:47422500-47422522 CCAGTTTTGCAGGCTGCGTATGG + Intergenic
1185176760 22:49332062-49332084 CCAGCCATGCAGCCTGTGCACGG + Intergenic
949333395 3:2946998-2947020 ACAGAAATGCAGGCTGGCCAGGG - Intronic
950462576 3:13134226-13134248 CCAGATATGCAGGGGCTGCAGGG + Intergenic
950913732 3:16621478-16621500 GCAGATCTGCAGACTGTCCAGGG - Intronic
951308430 3:21095556-21095578 GCAGATTTGCAGGCTTTGTAAGG + Intergenic
952382871 3:32818107-32818129 CCAGATCTGCTTGCTGTGCAAGG + Exonic
952446690 3:33387776-33387798 TCAGGTTTGCAGGCTGGGCACGG + Exonic
953050095 3:39333116-39333138 CAAGATGTGCATACTGTGCAAGG - Exonic
953151224 3:40327066-40327088 CAAAATCTGCAGGCTGCGCAAGG - Intergenic
953277316 3:41514962-41514984 ACAGATATGCTGGCTGTGCATGG + Intronic
953340543 3:42130877-42130899 CCACATACCCTGGCTGTGCAAGG - Intronic
953907448 3:46875412-46875434 CCAGGTATGCAGCCTCAGCAAGG + Intronic
953921567 3:46955482-46955504 CCAGGTGGGCAGGCTGTCCAGGG + Intronic
954607385 3:51923434-51923456 CTACATAAGCAGGCTGGGCACGG + Intergenic
956651177 3:71505965-71505987 CCAGAGAGGCAGACTGTGCCTGG - Intronic
957395644 3:79633474-79633496 ACAAATATGTAGGCTGGGCATGG - Intronic
958067741 3:88565986-88566008 AAAGATATACAGGCTGCGCACGG + Intergenic
959557175 3:107733894-107733916 CTACAAATGCAGACTGTGCATGG - Intronic
960445716 3:117746414-117746436 CCAGTTTTTCAGGCTGTGCTTGG - Intergenic
962547411 3:136451471-136451493 AAAGGTATGCAGGCTGGGCATGG + Intronic
967021141 3:185524010-185524032 GCATATTTGGAGGCTGTGCATGG - Intronic
969175281 4:5394090-5394112 CCTGCTTTGCAGTCTGTGCATGG + Intronic
969713190 4:8856076-8856098 CCAGCTGTGCAGGTTGTTCATGG + Intronic
970671562 4:18402325-18402347 CCTGATATGCAGGCTTTTGAGGG + Intergenic
970971899 4:21994615-21994637 CCAGTTCTGCAGGCTGTACAAGG + Intergenic
972852700 4:43070707-43070729 CCAGGTATCCAGGCTTGGCAGGG - Intergenic
974013434 4:56627532-56627554 CCAGCTAAGGAGGCTCTGCAGGG + Intergenic
974125076 4:57686111-57686133 CCAGATAAGCAGATAGTGCAGGG - Intergenic
976599652 4:86926517-86926539 CCTGGAATGCAGGCTGTACAGGG - Intronic
981048628 4:140289754-140289776 ACAGAGATGGAGGCTGTGTATGG - Intronic
982285852 4:153733678-153733700 GGAGAAATGCAGACTGTGCAAGG - Intronic
983825376 4:172251495-172251517 CCTGATATGCAGGCTTTCCCTGG - Intronic
984821357 4:183885517-183885539 CCATCTGTGGAGGCTGTGCAGGG + Intronic
987397733 5:17441465-17441487 CCAGATATACAGGGAGTCCACGG + Intergenic
988778529 5:34498604-34498626 CCAGAAATGAAGACTGTGCTCGG + Intergenic
989238955 5:39181567-39181589 TCAAATAAGCAGGCAGTGCAAGG - Intronic
993907382 5:93638520-93638542 ATAGAAATGCAGGCTGGGCACGG + Intronic
994283843 5:97939275-97939297 ACAGTTATGTAGGCTGTACAAGG - Intergenic
994830251 5:104773119-104773141 GCAGAGATGGAGGCTATGCATGG - Intergenic
995506491 5:112866010-112866032 TCAAACATGCAGGCTGGGCATGG - Intronic
997528736 5:134569565-134569587 GCTGACAAGCAGGCTGTGCAGGG + Intronic
998648950 5:144095670-144095692 GCAGTTCTGCAGGCTGTACAAGG - Intergenic
999343585 5:150795481-150795503 CCAGATATCCAGGATGTGCTTGG - Exonic
999914180 5:156239107-156239129 TCAGATTTGGAGGCTGGGCATGG + Intronic
999949570 5:156634391-156634413 ATACATATGCAGGATGTGCAAGG - Intronic
999983129 5:156976890-156976912 ATAGATATGAAGGCTGGGCATGG - Intergenic
1000742605 5:164988133-164988155 CAAGATAATCAGGCTGGGCATGG + Intergenic
1001751872 5:174137463-174137485 TCAGATGTGCGGGCTGTGCTGGG + Intronic
1002120570 5:177000788-177000810 GAAGACATGCAGGCTGGGCACGG - Intronic
1002523336 5:179803229-179803251 CCAGAGAGGCAGGGTGTGGAGGG - Intronic
1002988130 6:2211069-2211091 ACAGTTATGCAGGCTGTACAGGG - Intronic
1006401490 6:33820532-33820554 CCACATATGGTTGCTGTGCATGG + Intergenic
1006412338 6:33881584-33881606 CCAGAGGGGCAGGCTCTGCAGGG - Intergenic
1007148932 6:39668131-39668153 ACAGTTCTGCAGGCTGTACAGGG - Intronic
1009184880 6:60563478-60563500 GCAGAGATGGAGGTTGTGCATGG + Intergenic
1009421067 6:63465470-63465492 ATAGATGTGCAGGCTGAGCATGG - Intergenic
1011383804 6:86771919-86771941 GCACAGATGCAGGCTGGGCACGG + Intergenic
1012814880 6:104010677-104010699 CAAGAAATGCAGGCAGTGCAAGG + Intergenic
1015506471 6:133993877-133993899 GGAGATTAGCAGGCTGTGCAGGG + Intronic
1015880894 6:137868834-137868856 GCAGTTTTACAGGCTGTGCAAGG + Intronic
1018300808 6:162400795-162400817 CCTGATATGCAGTCTCTTCAAGG - Intronic
1018881878 6:167891715-167891737 GCACATATGTATGCTGTGCATGG + Intronic
1019037340 6:169072649-169072671 CCACAGACGCACGCTGTGCATGG - Intergenic
1019888941 7:3929850-3929872 ACAGTCATGCAGGCTGTTCATGG + Intronic
1020213335 7:6171148-6171170 CCAGAGCTGGAGGCTGTGCCTGG + Intronic
1020373824 7:7462566-7462588 ACAGAAATGCAGGCTGAGCACGG + Intronic
1020489003 7:8756024-8756046 CCAGATGTGATGGCTGTGGAAGG + Intergenic
1020502865 7:8944948-8944970 ACAGTTCTGCAGGCTGTACAAGG + Intergenic
1020600248 7:10266361-10266383 CCAAATAGGCATGATGTGCATGG - Intergenic
1023042370 7:36182974-36182996 CCAGAGCTACAGGGTGTGCATGG - Intronic
1023763536 7:43489163-43489185 CCAGATCTGCTGGCTGAGCTCGG - Intronic
1024154151 7:46603223-46603245 CCACATTTGCAGCCTCTGCAAGG + Intergenic
1027998962 7:85466774-85466796 CCAGCTGTGCAGGAGGTGCAAGG + Intergenic
1031877950 7:127163168-127163190 TCAGTTCTGCAGGCTGTACAGGG + Intronic
1032264042 7:130358287-130358309 ACACATATGCAGGTTGGGCATGG - Intronic
1032423205 7:131799866-131799888 CCAGATGTCCAGGCTGGGCCTGG + Intergenic
1032582843 7:133118983-133119005 CCAGATTTTCAGGCTGTACCTGG + Intergenic
1033140931 7:138825894-138825916 ACAGATTTTCAGGCTGGGCATGG + Intronic
1033323409 7:140360441-140360463 TCAGATATGGAGGCTGGGCACGG + Intronic
1034059854 7:148077015-148077037 CCATATATACAGGCGGGGCATGG + Intronic
1034699475 7:153083838-153083860 CCAGTTCTGCAGGCTGTGCAGGG + Intergenic
1035293183 7:157853076-157853098 CCAGATCAGCAGGCAGTGGATGG + Intronic
1035706914 8:1682762-1682784 CTAGATATCCTGGCTGGGCATGG - Intronic
1035715537 8:1751458-1751480 AGAAATATGCTGGCTGTGCATGG + Intergenic
1035789469 8:2290525-2290547 CCAGATATTCAGGTTGAGCTGGG - Intergenic
1035803336 8:2431180-2431202 CCAGATATTCAGGTTGAGCTGGG + Intergenic
1036160988 8:6388374-6388396 CCAGATATTCAGTCTCTGCAGGG + Intergenic
1037287274 8:17314798-17314820 CCTGATATGCAGTCGGTGAAGGG + Intronic
1037365370 8:18116324-18116346 ACAAATATGCAGGCTGGGCGCGG - Intergenic
1037484907 8:19338009-19338031 TCAGAAATCAAGGCTGTGCAGGG - Intronic
1040627070 8:49161168-49161190 GCAGAGGTGCAGGCTGTGCTGGG - Intergenic
1040871761 8:52107054-52107076 ACAGCTCTGCAGGCTGTACATGG + Intergenic
1041098387 8:54372438-54372460 ACAGACATGCAGGCTGGGCGTGG + Intergenic
1042009994 8:64233475-64233497 CCAGACATGCAGGATTTCCAGGG + Intergenic
1042484021 8:69331937-69331959 CCAGACCAGGAGGCTGTGCATGG - Intergenic
1043557922 8:81455176-81455198 CCAGAGATGCATGCCGTGAATGG - Intergenic
1043823934 8:84902152-84902174 ACAGTTCTGCAGGCTGTACAGGG + Intronic
1045842254 8:106593917-106593939 TGAGATATGGTGGCTGTGCAGGG - Intronic
1046320797 8:112571576-112571598 GCAGAAATGCAGGCTGGGCATGG + Intronic
1047511665 8:125520500-125520522 CCAAATCTGCAGGCTGAGCTGGG + Intergenic
1047647771 8:126886806-126886828 CCAGTTCTGCAGGCTCTACAGGG - Intergenic
1048569469 8:135639672-135639694 ACAGTTCTGCAGGCTGTACAGGG + Intronic
1049489806 8:142889826-142889848 ACAGTTCTGCAGGCTGTACAGGG + Intronic
1049688935 8:143950345-143950367 CCCCACGTGCAGGCTGTGCAGGG - Exonic
1050851050 9:10286887-10286909 ACAAACATGTAGGCTGTGCACGG - Intronic
1050937325 9:11414400-11414422 CCAGGCATGCTGGCTGTGCAGGG - Intergenic
1052043346 9:23766614-23766636 CTAGATAGGAAGGCTGTGTATGG + Intronic
1053242993 9:36511717-36511739 ATAGAAATGCAGGCTGGGCATGG - Intergenic
1056077836 9:83059775-83059797 GCAGATATGAAGGGTCTGCAAGG - Intronic
1058261824 9:102842921-102842943 ACCGATTTGCAGTCTGTGCATGG + Intergenic
1058936470 9:109773873-109773895 CAATATATGGAGGGTGTGCAAGG + Intronic
1060936927 9:127521483-127521505 CCAGGAATGCAGGATGTGAAGGG + Intronic
1061625303 9:131837766-131837788 CAAGATGTGCAGGCTGTTCCCGG - Intergenic
1062076143 9:134590956-134590978 CCAGAGAAGAAGGCTTTGCAGGG + Intergenic
1062082062 9:134629490-134629512 CCAGAAATGCGAGCTGGGCAGGG - Intergenic
1062168284 9:135119877-135119899 CCAGGTCTGCAGGGTCTGCAGGG - Exonic
1187074004 X:15915987-15916009 CCAAATATGCAGGGTATGCAAGG - Intergenic
1190859257 X:54328377-54328399 TCAAATATGCAGGCTGGGCACGG + Intronic
1192468340 X:71374363-71374385 CAAGATATGATGGCTGGGCATGG - Intronic
1192926530 X:75759949-75759971 TGGAATATGCAGGCTGTGCAGGG - Intergenic
1193911600 X:87313494-87313516 ACAGTTCTGCAGGCTGTACAGGG + Intergenic
1195741055 X:108064734-108064756 CCAGATGTTGAGGCTGTGAAGGG + Intronic
1195766679 X:108303528-108303550 ACAGATATGCAGAGTGAGCATGG + Intronic
1199235369 X:145486887-145486909 ACAGTTTTGCAGGCTGTACAAGG + Intergenic
1199733417 X:150660689-150660711 ACAGTTCTGCAGGCTGTACAAGG + Intronic
1200207318 X:154326263-154326285 CCTGACAGGCAGGCTGAGCAGGG - Intronic
1201897329 Y:19005769-19005791 GCAGGTATCCAGGCTCTGCAAGG + Intergenic