ID: 903812186

View in Genome Browser
Species Human (GRCh38)
Location 1:26040918-26040940
Sequence ATGTTTGTAGAGATGGGGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1113
Summary {0: 1, 1: 6, 2: 38, 3: 258, 4: 810}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903812186_903812197 14 Left 903812186 1:26040918-26040940 CCCCCCCCCATCTCTACAAACAT 0: 1
1: 6
2: 38
3: 258
4: 810
Right 903812197 1:26040955-26040977 GACATGGTGGCATGCGCCTGTGG 0: 10
1: 147
2: 1262
3: 3316
4: 6981
903812186_903812198 28 Left 903812186 1:26040918-26040940 CCCCCCCCCATCTCTACAAACAT 0: 1
1: 6
2: 38
3: 258
4: 810
Right 903812198 1:26040969-26040991 CGCCTGTGGTCCCAGCTACTTGG 0: 1698
1: 50471
2: 116116
3: 175602
4: 127583
903812186_903812194 -2 Left 903812186 1:26040918-26040940 CCCCCCCCCATCTCTACAAACAT 0: 1
1: 6
2: 38
3: 258
4: 810
Right 903812194 1:26040939-26040961 ATTTAAAAGTTAGCCAGACATGG 0: 2
1: 84
2: 1137
3: 6859
4: 38744
903812186_903812195 1 Left 903812186 1:26040918-26040940 CCCCCCCCCATCTCTACAAACAT 0: 1
1: 6
2: 38
3: 258
4: 810
Right 903812195 1:26040942-26040964 TAAAAGTTAGCCAGACATGGTGG 0: 4
1: 348
2: 6305
3: 51540
4: 121519
903812186_903812199 29 Left 903812186 1:26040918-26040940 CCCCCCCCCATCTCTACAAACAT 0: 1
1: 6
2: 38
3: 258
4: 810
Right 903812199 1:26040970-26040992 GCCTGTGGTCCCAGCTACTTGGG 0: 2717
1: 41335
2: 169840
3: 257462
4: 215499

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903812186 Original CRISPR ATGTTTGTAGAGATGGGGGG GGG (reversed) Intronic
900255165 1:1694110-1694132 TTTTTAGTAGAGATGGGGGGGGG - Intronic
900883527 1:5399461-5399483 ATGTTTGGATAGATGGATGGTGG + Intergenic
901403918 1:9033396-9033418 TTTTTTGTAGACATGGTGGGGGG + Intergenic
901503186 1:9666667-9666689 AATTTTGTAGAGATGGGGGAGGG - Intronic
901885506 1:12220135-12220157 TTTTTTGTAGAGATGGGTGGGGG - Intergenic
902098139 1:13963140-13963162 ATGTCTGTGGTGATGGGGAGTGG + Intergenic
902139503 1:14341063-14341085 TTTTTAGTAGAGATTGGGGGGGG + Intergenic
902387638 1:16084816-16084838 TTCTTAGTAGAGATGGGGGGGGG - Intergenic
902590901 1:17473762-17473784 TTTTTTGTAGAGATGGGGTCTGG + Intergenic
903041303 1:20532801-20532823 TTTTTAGTAGAGATGGGGGGGGG - Intergenic
903209176 1:21806654-21806676 TTTTTTGTAGAGATGGGGTTTGG + Intergenic
903250452 1:22049566-22049588 TTTTTTGTAGAGATGGGTGGGGG + Intergenic
903340942 1:22653914-22653936 ATGTTTGTGCAGCTGGGGAGTGG + Intronic
903704618 1:25276518-25276540 TTTTTTTTAGAGATGGGGGGGGG - Intronic
903722614 1:25416803-25416825 TTTTTTTTAGAGATGGCGGGGGG + Intronic
903812186 1:26040918-26040940 ATGTTTGTAGAGATGGGGGGGGG - Intronic
903835441 1:26200625-26200647 ATTTTTAAAGAGGTGGGGGGAGG + Intronic
903953554 1:27010423-27010445 ATGTGTGCAGGGATGGGGGCGGG - Intronic
903975564 1:27147634-27147656 GTTTTTTTAGAGATGGGGGATGG - Intronic
904246126 1:29189378-29189400 ATTTTTGTAGAGATGGGTTGGGG + Intergenic
904377139 1:30088843-30088865 ATGTTTGATCTGATGGGGGGAGG - Intergenic
904740504 1:32671714-32671736 ATTTGTGTAGAGATGGGGTTAGG - Intronic
905073394 1:35247704-35247726 TTTTTTGTAGAGATGGGTTGGGG + Intergenic
905446164 1:38029722-38029744 CTGTTTGTAGAGTAGGGGGCTGG + Intergenic
905733410 1:40311397-40311419 GTGTCTGGAGAGATGGGGAGGGG - Intronic
905786481 1:40761928-40761950 GTGGTGGTAGTGATGGGGGGTGG - Intronic
905878400 1:41448141-41448163 ATGCTTGAAGGGATGGTGGGTGG + Intergenic
906045547 1:42828102-42828124 ATGTTAGAAGAGATGGAGGAAGG + Intronic
906260018 1:44379919-44379941 ATGTTTTTGGACATGGGGGTGGG - Intergenic
906340305 1:44973862-44973884 AAGGTTATAGAGATGGAGGGTGG + Intronic
908184083 1:61634884-61634906 TTTTTTGTAGAAATGGGGGTTGG - Intergenic
908292948 1:62686947-62686969 TTTTTTGCAGAGATGGGGTGGGG + Intronic
908825338 1:68127600-68127622 ATGTTTGTGGAGAGGGGTGCTGG + Intronic
909018478 1:70405160-70405182 TTCTTTGCAGAGATGGGTGGAGG - Intergenic
909444028 1:75728044-75728066 ATGGTTGGAGAGTTGGGGTGGGG - Intronic
909535457 1:76730930-76730952 AAGATTGCAGAGCTGGGGGGAGG + Intergenic
909629241 1:77753414-77753436 TTTTTTGTAAAGATGGGGGGTGG - Intronic
909643496 1:77891903-77891925 TTTTTTGTAGAGATGGGGGTGGG - Intronic
909652510 1:77991574-77991596 GTGTGTGTAGAGATGGTGGGAGG - Intronic
909672282 1:78202953-78202975 TTTTTTGTAGAGATGGGGTCTGG + Intergenic
910457657 1:87414459-87414481 TTTTTAGTAGAGATGGGGTGAGG + Intergenic
911741428 1:101390160-101390182 ATGTTTGTACACATGGAGGAGGG + Intergenic
911750622 1:101492923-101492945 ATTTTTGTAGAGATGGCGGGTGG + Intergenic
912399536 1:109378057-109378079 CTTTTTGTAGCGATGGGGGCGGG - Intronic
914779806 1:150774921-150774943 TTTTAAGTAGAGATGGGGGGGGG + Intergenic
914860939 1:151385649-151385671 TTTTTTGTAGAGATGGTGGCTGG + Intergenic
915136551 1:153735898-153735920 GTTTTTGTAGAGATGGGGTTGGG + Intronic
915187028 1:154114765-154114787 TTTTTTTAAGAGATGGGGGGGGG + Intronic
915248601 1:154572770-154572792 ATATTTATGGAGATGGGGGTGGG + Intronic
915395840 1:155583360-155583382 ATTTTTATAGAGATGGGGTCTGG - Intergenic
915423730 1:155806459-155806481 TTTTTTGTAGAGATGGGGGTGGG + Intronic
915924607 1:160006267-160006289 ATTTTTGTAGAGATGGAGTCTGG + Intergenic
915959316 1:160251641-160251663 TTTTTTGTAGAGATGGTGGTGGG + Intronic
916277456 1:163010188-163010210 AAGTTGGTAGAAATGGGAGGTGG - Intergenic
916667694 1:166981483-166981505 ATGTGTGTAGAGAGGGAGGGAGG + Intronic
917031695 1:170699911-170699933 TTTTTAGTAGAGATGGGGCGAGG + Intronic
917429957 1:174955902-174955924 ACTTTTGTAGAGATGGGGTCTGG - Intronic
917465005 1:175268279-175268301 CTGTGTGTAGGGGTGGGGGGAGG + Intergenic
917687021 1:177426908-177426930 ATGTTTATAGAAATGGGCGTGGG - Intergenic
917819931 1:178752325-178752347 TTTTTTGTAGAGATTGGTGGCGG + Intronic
918403201 1:184185107-184185129 AATTTTGTAGAGATGGTTGGGGG + Intergenic
918428313 1:184433161-184433183 ATGATTGTAGGGATGTGGTGGGG + Intronic
918860464 1:189819604-189819626 ATGTGTGTGGAGATTGGGGTAGG + Intergenic
919096825 1:193047295-193047317 AGGTTAGTAGAGATGGGTGTGGG + Intronic
920081391 1:203376026-203376048 AATTTTGTAGAGATGGGGTCTGG + Intergenic
920578613 1:207083363-207083385 ATTTTTGTAGAGATGGGTGGGGG - Intronic
921458032 1:215395284-215395306 TTTTTAGTAGAGATGGGGGACGG + Intergenic
921650792 1:217675152-217675174 AGGTTTGTAGAGAAGGAGGATGG + Intronic
921906683 1:220502597-220502619 AAGTCTGTAGGGATGGGGTGGGG + Intergenic
922026768 1:221757073-221757095 GTGTTTGTGGTGATGGGGGAGGG - Intergenic
922324206 1:224513328-224513350 ATTTTTGTAGAGTTGGGGGTGGG + Intronic
922656895 1:227392956-227392978 GTTTTTGGAGAGATGGGGTGGGG - Intergenic
923164492 1:231346763-231346785 ATTTTAGTAGAGATGGGGTTTGG - Intronic
923366299 1:233265065-233265087 AATTTTGTAGAGATCGGAGGGGG - Intronic
923647580 1:235839627-235839649 TTTTTAGTAGAGATGGGGCGTGG - Intronic
923712302 1:236396961-236396983 ATGATTGCAGGGGTGGGGGGTGG + Intronic
923883656 1:238131253-238131275 TTTTTTGTAGAGATGGGGGGGGG + Intergenic
923986811 1:239390957-239390979 CTTTTTGTAGAGATGGGGTCTGG - Intronic
924233835 1:241984240-241984262 GTATTTTTAGAGATGGGGGCTGG - Intergenic
924240350 1:242034067-242034089 GTTTTTGTAGAGATGGGGGGGGG - Intergenic
924272269 1:242346016-242346038 ATGGTTGTATATATGGGGGGGGG - Intronic
924349462 1:243101138-243101160 TTTTTTCTAGAGATGGGGTGGGG - Intergenic
924464036 1:244284339-244284361 TTTTTTGTGGAGATGGGGGGGGG + Intergenic
924484605 1:244468739-244468761 TTATTTGTAGAGATGGGGTCTGG - Intronic
924524303 1:244833134-244833156 TTATTTGTAGAGACGGGAGGTGG - Intergenic
924529674 1:244882593-244882615 TTTTTAGTAGAAATGGGGGGGGG - Intergenic
924704166 1:246485609-246485631 TTTTTTGTAGAGATGTGGGGGGG - Intronic
1062875728 10:941489-941511 TTTTTGGTAGAGATGGGCGGGGG + Intergenic
1063646223 10:7886099-7886121 TTTTTTGTAGAGATGTGGGGGGG + Intronic
1063780875 10:9322354-9322376 ATTTCAGTAGAGATGGGGGAGGG + Intergenic
1064416311 10:15153250-15153272 ATTTTTTTAGAGATGGCGGAGGG - Intronic
1064582467 10:16808304-16808326 ATTTTAGTAGAGATGGGGATGGG - Intronic
1064623390 10:17238247-17238269 TTTTTTGTAGAGATGGGGTCTGG + Intergenic
1064623696 10:17240920-17240942 GTGTGTGTAGTGATGGGGGAGGG + Intergenic
1064627295 10:17274150-17274172 TTTTTTGTAGCGATGGGGGGAGG + Intergenic
1064631780 10:17321923-17321945 TTTTTTATAGAGATGTGGGGCGG - Intronic
1064889703 10:20156652-20156674 ATGATTGTGGAGATGGGGGCAGG + Intronic
1065093513 10:22259131-22259153 TTTTTTGTAGAGATGGTGGGCGG + Intergenic
1065094208 10:22264551-22264573 ATTTTTGTAGAGATGGTGGTCGG - Intergenic
1065422962 10:25567574-25567596 GTGTTTGTATAGGTGGGAGGAGG + Intronic
1065500189 10:26373501-26373523 AAGTTTGTAGAGTTTGGGGCTGG - Intergenic
1065875545 10:29994469-29994491 TTTTTTGTAGAGATGGGGTCTGG + Intergenic
1065939878 10:30554881-30554903 ATTTTTGTAGAGACGGGAGGGGG + Intergenic
1066080028 10:31921473-31921495 AAGTTTGTAGAGGTCGGGCGCGG + Intronic
1066447239 10:35494237-35494259 TTTTTTGTAGAAATGGGGGGGGG - Intronic
1067544149 10:47179842-47179864 AATTTTGTAGAGATGGGGGTGGG - Intergenic
1067911002 10:50346875-50346897 ATATCTGTAGAGATTGGGGTGGG + Intronic
1068283027 10:54901139-54901161 TTTTTTGTAGAGATGGTGGAGGG - Intronic
1068377439 10:56199726-56199748 ATCCTTGTAGAGATAGTGGGAGG + Intergenic
1068795612 10:61076358-61076380 ATTTTTGTATAGATCGGGGTGGG + Intergenic
1069022647 10:63505825-63505847 ATGTGTGTGTTGATGGGGGGTGG - Intergenic
1070126218 10:73624375-73624397 TTTTTAGTAGAGACGGGGGGGGG + Intronic
1071338978 10:84625221-84625243 GTGTGTGTAGGGGTGGGGGGTGG + Intergenic
1071688750 10:87792609-87792631 ATTTTTTTAGAGGTGGGGGTGGG - Intronic
1071953898 10:90735836-90735858 ATTTTTGTAGAGATGGGGGGTGG - Intergenic
1072292366 10:93975884-93975906 GTTTTTGTAGAGATGTGGGGGGG - Intergenic
1072683665 10:97524271-97524293 GTTTTTGTAGGGATGCGGGGGGG + Intronic
1073106582 10:101035834-101035856 GTGTTTGTATAAATGGGGGTGGG + Intronic
1073307241 10:102512889-102512911 TTTTCTGTAGAGATGGGGGAGGG - Intronic
1073751922 10:106538717-106538739 TTTTTAGTAGAGATGGGGGGAGG + Intergenic
1073768267 10:106707366-106707388 CTTTTAGTAGAGATGGTGGGGGG + Intronic
1074133464 10:110606327-110606349 ATATTTTAAGAGATGGTGGGGGG + Intergenic
1074284028 10:112081009-112081031 TTTTTTGTAGAGACGGGGGTGGG - Intergenic
1074589393 10:114798558-114798580 ATTTTTGTAGACATGGGGGGGGG - Intergenic
1074663435 10:115690266-115690288 ATTTTTCTACAGATGGGGGTGGG + Intronic
1074840862 10:117349623-117349645 TTTTTTGTAGAAATGGGGTGTGG - Intronic
1074886120 10:117695157-117695179 AAATTTGTAGAGATCGGTGGGGG + Intergenic
1075037632 10:119082288-119082310 ACTTTAGTAGAGACGGGGGGGGG - Intergenic
1075093753 10:119457863-119457885 TTTTTTGTAGAGATGGGGGGGGG + Intronic
1075290410 10:121225163-121225185 TTTTTTGTAGAGATGGGGGGGGG + Intergenic
1075724044 10:124602768-124602790 ATGTGTGAAGAGCTGGGGTGGGG - Intronic
1076275906 10:129198272-129198294 ATGTTAATAGAGTTGGGGGAGGG - Intergenic
1077006253 11:358799-358821 CTGTTGGTGGAGCTGGGGGGCGG + Intergenic
1077030775 11:465755-465777 TTTTTAGTAGAGATGGGGGGGGG - Intronic
1077583186 11:3430722-3430744 ATTTTTGTAGAGATGGCAGGTGG + Intergenic
1078149133 11:8743918-8743940 TTTTTTGTAGAGATGGGGGCGGG + Intronic
1078252446 11:9627451-9627473 TTTTTTGTAGAGATTGGGGGGGG + Intergenic
1078502298 11:11892631-11892653 ATTTTTGTAGAGATGGTGTCTGG - Intronic
1078826785 11:14937546-14937568 CTGACTGTAGAGATGGGGGAGGG - Intronic
1079228094 11:18625742-18625764 TTTTTTGTAGAGATTGGGGGGGG + Intronic
1079290148 11:19180757-19180779 TAGTGGGTAGAGATGGGGGGAGG + Intergenic
1079531395 11:21458819-21458841 ATATTTGTAGATATGGGGAAAGG + Intronic
1080534883 11:33212035-33212057 ATTTTTGTAGGGTTGGGGGGTGG - Intergenic
1080536117 11:33223469-33223491 TTTTTTGTAGAGATGGGGTCTGG + Intergenic
1081199993 11:40204090-40204112 TATTTTGTAGAGATGGGTGGTGG + Intronic
1081415281 11:42807507-42807529 ATCTTTTTATAAATGGGGGGAGG + Intergenic
1081495853 11:43609538-43609560 TAATTTGTAGAGATGGGGTGGGG + Intronic
1081538516 11:44013455-44013477 CTTTTAGTAGAGATGGGGGGTGG + Intergenic
1081624248 11:44638283-44638305 TTTTTTGTAGAGACGGCGGGGGG - Intergenic
1081848634 11:46259694-46259716 TTTTTAGTAGAGATGGGGGAGGG - Intergenic
1082073273 11:47956913-47956935 TTTTTTATAGAGATGGCGGGCGG + Intergenic
1082824089 11:57565540-57565562 CTTTTTGTAGAGATGGGGTTTGG + Intronic
1083142598 11:60734076-60734098 ATTTTTGTAGAGATGGCGGGTGG - Intronic
1083237160 11:61358546-61358568 TTTTTAGTAGAGATGGGGGCGGG - Intronic
1083320244 11:61841524-61841546 TTTTTTTGAGAGATGGGGGGGGG - Intronic
1083600798 11:63946380-63946402 ATTTTTGTAGAGACGGGGTTTGG + Intronic
1083604883 11:63972540-63972562 GTGTTTGTAGAGCTGGAGGGGGG - Intergenic
1083877807 11:65533599-65533621 TTTTTTGTAGAGATGGGGTTTGG - Intronic
1084240101 11:67813529-67813551 ATTTTTGTAGAGATGGCAGGTGG + Intergenic
1084266093 11:68005892-68005914 TTTTTTGTAGAGATGGGTTGGGG - Intergenic
1084289024 11:68149972-68149994 TTTTTAGTAGAGATGGGGGTGGG - Intergenic
1084663516 11:70561703-70561725 CTTTTTGTAGAGATGGCAGGGGG + Intronic
1084753484 11:71220051-71220073 TTTTTTGTAGAGATGGGTGGGGG - Intronic
1084787283 11:71449747-71449769 TTTTTGGTAGAGATGGGTGGGGG + Intronic
1084832345 11:71779308-71779330 ATTTTTGTAGAGATGGCATGTGG - Intergenic
1085017971 11:73187813-73187835 TTTTTTGTAGAGATGGGGTGGGG + Intergenic
1085110028 11:73879692-73879714 TTTTTTATAGAGATGGGGAGGGG - Intronic
1085119977 11:73961107-73961129 TTTTTTGTAGAGATGGGGTTTGG - Intronic
1085256120 11:75174365-75174387 ATGTTTGGAGAGGGTGGGGGCGG + Intronic
1085271085 11:75270314-75270336 TTTTTAGTAGAGATGGGTGGTGG - Intronic
1085881431 11:80471667-80471689 GTGTGTGTGGAGATGGGGGGGGG + Intergenic
1086348550 11:85922328-85922350 TTTTTTGTAGAGATGGTGTGGGG + Intergenic
1086906461 11:92423669-92423691 ATGTCTGTAGAGAGAGGGTGGGG + Intronic
1088080180 11:105902510-105902532 GTTTTTGTAGGGATGGGGTGTGG + Intronic
1088314306 11:108491539-108491561 TTTTTTGTAGAGATGGTGGGGGG + Intronic
1088671328 11:112144412-112144434 ATTTTTGTAGAGAAGGGGTCAGG + Intronic
1089078246 11:115756140-115756162 TCTTTTGTAGAGATGGGGGGGGG + Intergenic
1089516451 11:119035349-119035371 ATTTTTGTAGAGATGGCGGGGGG - Intergenic
1090636113 11:128691600-128691622 ATGGTTTTGGAGATGGGCGGGGG - Intronic
1091266074 11:134271986-134272008 TTGTTTGTGGGGATGGGGAGGGG - Intergenic
1091476802 12:783080-783102 TTTTTTGTAGAGACGGGGGTAGG + Intronic
1092144730 12:6206724-6206746 ATTTTTGGAGAGGCGGGGGGAGG - Intronic
1092287520 12:7137385-7137407 ATGGAGGTGGAGATGGGGGGTGG - Intronic
1092410336 12:8248074-8248096 ATTTTTGCAGAGATGGCAGGTGG + Intergenic
1093113997 12:15187133-15187155 ATCTTTGAGGAGATGGTGGGAGG + Intronic
1093775321 12:23067046-23067068 CTGTTTGTAGAGTTGCAGGGAGG + Intergenic
1093930386 12:24949745-24949767 AGCTTTGTATAGATGTGGGGAGG - Intergenic
1094143871 12:27208663-27208685 ATTTTTGTAGAGATGAGGTTTGG + Intergenic
1094203608 12:27817564-27817586 TTTTTTGTAGAGATCGGGGTTGG + Intergenic
1094372077 12:29749817-29749839 ATGTTTGTGATGATGGGGAGAGG - Intronic
1094715197 12:33006851-33006873 ATGTTTTGGGAGATGGGGGGGGG + Intergenic
1095263678 12:40128430-40128452 ATCTTGGTAGAGTTGGGGTGGGG - Intergenic
1095582146 12:43812834-43812856 CTTTTTGTAGAGATGGGGAGTGG - Intergenic
1095655909 12:44668703-44668725 ATGTGAGTAGTGATGGTGGGTGG - Intronic
1096159569 12:49366007-49366029 ATATTTTTTGAGATGGAGGGTGG + Intergenic
1096298654 12:50406307-50406329 TTGTTTGTAGAGGTTGGGGGTGG - Intronic
1096300156 12:50419726-50419748 GTTTTTGTAGAGATGGGGTGTGG - Intronic
1096505422 12:52089422-52089444 GTTTTTGTAGAGATGGGGAAGGG - Intergenic
1096855224 12:54476597-54476619 TTTTTTGTAGAGATTGGGGGTGG + Intergenic
1097251383 12:57634089-57634111 TTTTTTGTAGAGACGGGGGGGGG - Intergenic
1097768238 12:63550290-63550312 ATGTTTGTGGGAATGGTGGGAGG - Intergenic
1097784600 12:63745353-63745375 ATGTTTGTGGGAATGGTGGGAGG - Intergenic
1098124028 12:67270734-67270756 ATTTGTGAAGAGATGGGAGGCGG - Intronic
1098427332 12:70379592-70379614 TTTTTTGTAGAGATGGGGTTTGG + Intronic
1099584222 12:84495508-84495530 AGGTTTGAAGAGAAGGAGGGAGG - Intergenic
1099925257 12:89009152-89009174 ATTTTTGTGGAGAAGAGGGGAGG - Intergenic
1100492133 12:95090923-95090945 ATTTTAGTAGAGACGCGGGGCGG - Intronic
1100729938 12:97453790-97453812 ATGTTTGAAGAAATGGAGGGAGG - Intergenic
1100989882 12:100240336-100240358 GTTTTTGTAGAGATAGGGGCAGG + Intronic
1101033080 12:100678904-100678926 ATGTTTCTAAAGATGAGGGAAGG - Intergenic
1101318789 12:103653998-103654020 ATGGTTGGAGAGATGGATGGAGG + Intronic
1101417683 12:104522644-104522666 ATTTTTGTAGACGTGGCGGGTGG + Intronic
1101664303 12:106796369-106796391 TTCTTTTTAGAGATGGAGGGGGG - Intronic
1101713294 12:107288484-107288506 ATTTTTGTAGAGATTGGCGGTGG - Intergenic
1102022617 12:109694706-109694728 TTTTTTGTAGAGACGGCGGGGGG - Intergenic
1102298574 12:111755578-111755600 TTTTTAGTAGAGATGGGGGACGG + Intronic
1102388943 12:112534342-112534364 TTGTTTGTAGAGATGGGGGGTGG + Intergenic
1102451322 12:113044066-113044088 TTGTTTGTAGAGATGGGGTGTGG - Intergenic
1102509313 12:113403539-113403561 TTTTTTGTAGAGATTGGGGGGGG + Intronic
1102539057 12:113605327-113605349 CTTTTTGCAGAGATGGGGCGGGG + Intergenic
1102596187 12:113994199-113994221 TTTTTTGTAGAGATGGGGGGCGG - Intergenic
1102808048 12:115799452-115799474 ATATGTGTAGAGATGGGGTTTGG - Intergenic
1102840315 12:116113457-116113479 TTTTTTGTAGAGATGGGGACTGG - Intronic
1103075990 12:117983117-117983139 ATTTTTGTAGAGACAGGGGTGGG - Intergenic
1103092841 12:118109715-118109737 TTTTTTGTAGTGATGTGGGGTGG + Intronic
1103119069 12:118365408-118365430 TTTTTTGTAGAGATGGGCGGGGG + Intronic
1103170761 12:118817453-118817475 ATGTTTGTTGAGAATGGGGGTGG - Intergenic
1103406224 12:120677572-120677594 TTTTTTGTAGAGATGGGAGTGGG + Intergenic
1103531876 12:121608094-121608116 TTATTTGTAGAGATGGGGTCTGG + Intergenic
1103588208 12:121971689-121971711 ATGTTTGTTAAGGTGTGGGGTGG - Intronic
1103813472 12:123634261-123634283 TTTTTTGTAGAGATGGGGTCTGG - Intronic
1103998171 12:124843277-124843299 CTTTCTGTGGAGATGGGGGGGGG + Intronic
1104009889 12:124922714-124922736 TTTTTAGTAGAGATGGGGGGGGG + Intergenic
1104216875 12:126742262-126742284 AGCTTTATAGAGATGTGGGGAGG + Intergenic
1104849624 12:131865790-131865812 CTTTTTGTAGAGATTGGGGGCGG - Intergenic
1105370419 13:19797280-19797302 ATTTTTATAGAGATGGGGGCAGG - Intergenic
1105607317 13:21936902-21936924 GTGTGTGTAGAGAAGGTGGGTGG + Intergenic
1105745449 13:23373620-23373642 TTTTTAGTAGAGATGGGAGGCGG - Intronic
1105997015 13:25682282-25682304 GTGTTTGCAGAGGAGGGGGGAGG - Intronic
1106116440 13:26821564-26821586 GTGTCTGGAGAGATGGGAGGAGG + Intergenic
1106311044 13:28554581-28554603 ATTTTTTTAGAGATTGGGGTGGG + Intergenic
1106523443 13:30518917-30518939 ATTTTTGTAGAGATGGGGGCTGG + Intronic
1106775234 13:33002401-33002423 CTGTTTGTAAAGATGGGAGGTGG - Intergenic
1106922494 13:34578328-34578350 ATGTTTGTAGACATGGGTTTTGG - Intergenic
1107131926 13:36905576-36905598 GTTTTTGTAGAGATGGGGTTTGG - Intronic
1107480182 13:40779700-40779722 TTGTTTGTAGAGAAGGGGGGGGG - Intergenic
1107890976 13:44914206-44914228 TTTTTTGTAGAGACGGGCGGCGG + Intergenic
1107965614 13:45595820-45595842 TTTTTTGTAGAGATGAGGTGTGG + Intronic
1108263785 13:48684099-48684121 CTTTTTGTAGAGATCGGGGGGGG + Intronic
1108354412 13:49617442-49617464 TTTTTTGTAGAGATTGGGGTGGG - Intergenic
1109126167 13:58520270-58520292 TTCTTTTTAGAGATGGGGGAGGG + Intergenic
1109290293 13:60465880-60465902 ATGTGAGAAGAGATGGGGTGGGG + Intronic
1110236151 13:73220103-73220125 TTTTTGGTAGAGATGGCGGGGGG + Intergenic
1110288618 13:73778535-73778557 TTTTTTGTAGAGATGAGGTGAGG + Intronic
1110509291 13:76329906-76329928 ATGTTTTCAGGGATGGGGTGGGG - Intergenic
1111592767 13:90371208-90371230 ATTTTTGTACAGATGGGTGAGGG + Intergenic
1111744273 13:92246500-92246522 TGGTTTGTAAAGATGGGGTGTGG - Intronic
1111843551 13:93479609-93479631 TTTTTAGTAGAGATGGGGGGGGG - Intronic
1112015850 13:95330794-95330816 TTGTTTGTAGAGATGGGGTCTGG - Intergenic
1112033155 13:95475240-95475262 ATATTTGTAGGGATGGGGTCAGG + Intronic
1112269050 13:97951522-97951544 ATGTTTGTAGACGTTGGGGGAGG - Intergenic
1112385318 13:98934072-98934094 ATTTTTGGAGAGATGGGGGCGGG + Intronic
1112520610 13:100091623-100091645 AGGTTTGCAGAGGTGGAGGGAGG - Intronic
1112797465 13:103072032-103072054 TTTTTTGTAAAGATGGGTGGGGG + Intergenic
1112845032 13:103631630-103631652 ATATTTGTAGAAATGGGGATTGG - Intergenic
1113194928 13:107791780-107791802 TTTTTAGTAGAGACGGGGGGGGG - Intronic
1113481710 13:110626268-110626290 ATGTTTGGAAAGTTTGGGGGTGG + Intronic
1113543496 13:111127476-111127498 TTTTTTGTAGTGATGGGGGGAGG - Intronic
1114178197 14:20342903-20342925 TTTTTAGTAGAGATGGGGGGGGG + Intergenic
1114514790 14:23291598-23291620 TTTTCTGTAGAGATGGGGGACGG - Intronic
1114730620 14:24989119-24989141 GAGGTTGTAGAGATGGTGGGGGG - Intronic
1115837770 14:37428411-37428433 TTTTTTGTAGAGATGGGGTTTGG - Intronic
1116643482 14:47496419-47496441 ATTTTTGTAGAAATGGGGTCAGG + Intronic
1116718251 14:48455831-48455853 CTGTGTGTGGGGATGGGGGGTGG + Intergenic
1116880762 14:50166404-50166426 TTTTTTGTAGAGATGGGGTTTGG + Intronic
1116954950 14:50913863-50913885 ATTTTTGTAGAGACGGGTGGTGG + Intronic
1117145234 14:52830696-52830718 ATTTTAGTAGAGATGGGGTGTGG + Intergenic
1117409663 14:55439615-55439637 TTTTTAGTAGAGACGGGGGGGGG - Intronic
1117415407 14:55490885-55490907 TTTCTTGTAGAGATTGGGGGGGG + Intergenic
1117712709 14:58548960-58548982 TTGTGTGTGGAGATGGGGGTGGG + Intronic
1117714185 14:58563726-58563748 CATTTTGTAGAGATGGGGTGGGG - Intergenic
1117903929 14:60565091-60565113 TTTTTTTTAGAGATGGGGGTTGG - Intergenic
1118278806 14:64410394-64410416 TTTTTTGTAAAGATGGGGGGGGG + Intronic
1118311996 14:64700734-64700756 TTTTTTGTAGAGGTGGGGTGGGG + Intergenic
1118474751 14:66106175-66106197 ATGTTTGTATAGAGGGGTGGGGG + Intergenic
1118858342 14:69641775-69641797 TTTTTTGTAGAGAGGAGGGGGGG + Intronic
1118969305 14:70619619-70619641 ATCTTTGTATAGATGGCCGGGGG - Intergenic
1118971393 14:70641564-70641586 GTGCGTGTAGGGATGGGGGGCGG - Intergenic
1119359964 14:74041124-74041146 ATTTTTGTAGAGATAGGGTCAGG - Intronic
1119373444 14:74167706-74167728 TTTTTTATAGAGATGGGGGAGGG + Intronic
1119534816 14:75394439-75394461 TTTTTTGTAGAGATGGGGTTTGG + Intergenic
1119880063 14:78092819-78092841 ATGTTTGTTATGATGTGGGGTGG + Intergenic
1119906160 14:78304010-78304032 CTGATTTTAGATATGGGGGGAGG + Intronic
1120877910 14:89391825-89391847 ATTTTAGTAGAGATGGGGTTTGG - Intronic
1121013998 14:90537360-90537382 TTTTTTGTAGAGATGGGGGGGGG + Exonic
1121043586 14:90771414-90771436 TTTTTTGTAGAGATGGGGTTTGG - Intronic
1121048299 14:90803694-90803716 GTGTGTGTAGATGTGGGGGGAGG - Intronic
1121203773 14:92143529-92143551 TTTTTTTAAGAGATGGGGGGTGG - Intronic
1121242072 14:92438431-92438453 ATTTTTGTAGAGATGGCGGGGGG - Intronic
1121921295 14:97883909-97883931 TTGTTTATAGAGAGGGGGTGGGG + Intergenic
1121975337 14:98398415-98398437 TTTTTTGTAGAGATGGGGTTTGG - Intergenic
1122485307 14:102075581-102075603 TTTTTTGTAGAGATGGGGTGGGG - Intergenic
1122618564 14:103038702-103038724 TTTTTTGTAGAGACGGGGGGGGG + Intronic
1122730321 14:103792353-103792375 TTTTTTGTAGAGATGGGGTTTGG + Intronic
1202873593 14_GL000225v1_random:188230-188252 ATTTTTTTAGAGATGGGGGCAGG + Intergenic
1123428547 15:20193743-20193765 ATGTTTATAGGGATGGAGGAAGG + Intergenic
1123701825 15:22919842-22919864 TTTTTTGTAGAGATGGGGTCTGG - Intronic
1124421980 15:29530634-29530656 ATGTCTGTGGTGATGGGTGGAGG + Intronic
1124439426 15:29675547-29675569 TTTATTGTAGAGATGGTGGGCGG - Intergenic
1124822301 15:33058274-33058296 ATGTTTGTAAAAATGTGGTGTGG + Intronic
1125768687 15:42151256-42151278 AGGTTTGTAGAGGCGGGAGGAGG + Intronic
1125960142 15:43823146-43823168 ATTTTTGCAGAGATTGGCGGGGG + Intronic
1126136182 15:45394341-45394363 ATTTTTGCACAGATGGGGTGTGG - Intronic
1126157438 15:45578305-45578327 TTTCTTGTAGAGATGGTGGGGGG - Intergenic
1126160874 15:45612277-45612299 TTTTTGGCAGAGATGGGGGGGGG - Intronic
1126250500 15:46562446-46562468 TTGTTTTTTGAGGTGGGGGGAGG + Intergenic
1126346831 15:47704539-47704561 TTTTTTGTAGAGATGGGGTTTGG - Intronic
1126612676 15:50545454-50545476 ATGTTGGGAGAGAGGGAGGGAGG - Intronic
1126789293 15:52206171-52206193 ATGTTTGTAGGGAAGTGGGTGGG - Intronic
1127151002 15:56075370-56075392 ATGTTTGTTGATAATGGGGGAGG + Intergenic
1127377880 15:58401751-58401773 ATGTGTGGAGAGTTGGGTGGGGG + Intronic
1127386460 15:58471315-58471337 TTTTTAGTAGAGATGGGGGGGGG + Intronic
1127829985 15:62742250-62742272 ATGGTGGGAGAGATGGGAGGTGG + Intronic
1127889010 15:63230979-63231001 ATTTTAGTAGAGAGGGGAGGAGG - Intronic
1128793413 15:70449151-70449173 ATGGATGGAGAGATGGAGGGAGG + Intergenic
1129012365 15:72432478-72432500 ATTTTTGTAGAGATGGGGTTTGG + Intergenic
1129026008 15:72574906-72574928 TTTTTTGTAGAGATGGGCGGGGG - Intronic
1129040096 15:72678477-72678499 AAGTTTGTAGAGATGGGGTCTGG + Intronic
1129092733 15:73168359-73168381 TTTTTAGTAGAGACGGGGGGTGG + Intronic
1129225314 15:74167024-74167046 ATTTTTGTAGAGACGGGGTTTGG - Intergenic
1129480417 15:75820823-75820845 ATTTTTGTAGAGATGAGGTCTGG + Intergenic
1129643829 15:77411780-77411802 CTTTTTGTAAAGATGGGGGTTGG + Intronic
1129999045 15:80031586-80031608 ATGAATGAAGAGATGGGTGGTGG + Intergenic
1130538963 15:84807980-84808002 ATCTTTTTAGAGATGGGGTCTGG + Intergenic
1131082773 15:89550796-89550818 CTGTTGGTAGGGATGGGGGAAGG + Intergenic
1131214859 15:90529008-90529030 GTTTTTGTAGCAATGGGGGGCGG - Intergenic
1131368694 15:91861805-91861827 TTTTTGGTAGAGATGGGGTGTGG + Intronic
1131706232 15:94999365-94999387 ATTTTTGTAGAGATGGGGTTTGG - Intergenic
1131894291 15:97008698-97008720 ATATTTGTAGAGTTTGGGTGGGG + Intergenic
1132042459 15:98536795-98536817 TTTTTTGTAGAGATGGGATGGGG - Intergenic
1132258186 15:100396651-100396673 TTCTTTGTAGAGACGGTGGGGGG + Intergenic
1132415355 15:101615261-101615283 ATGTGAGGAGAGGTGGGGGGGGG - Intergenic
1133103441 16:3492756-3492778 TTGTTTTAAGAGTTGGGGGGAGG - Intergenic
1133126202 16:3647830-3647852 TTTTTGGTAGAGATGGGGTGGGG - Intronic
1133218703 16:4308740-4308762 TTTTTTGTAGAGATGGGGCAGGG + Intergenic
1133351551 16:5104264-5104286 ATTTTTGTAGAGATGGCAGGTGG + Intergenic
1133796270 16:9049013-9049035 ATTTTTATAGAGATGGCTGGGGG - Intergenic
1133818835 16:9218429-9218451 TTTTTTGTAGAGATTGGGGTTGG - Intergenic
1133946305 16:10351616-10351638 TTTTTTGTAGAGACGGTGGGGGG + Intronic
1134286639 16:12867688-12867710 TTTTTTGCAGAGATGGGGGGGGG + Intergenic
1134423781 16:14118622-14118644 TTTTTTGTAGAGATGGGGTTTGG - Intronic
1134592653 16:15468321-15468343 TTTTTTGTAGAGATGGGGTTTGG + Intronic
1134652915 16:15925066-15925088 TTTTTTGTAGAGTCGGGGGGCGG - Intergenic
1135040327 16:19113364-19113386 TTTTTAGTAGAGATGGGGGGCGG + Intergenic
1135069745 16:19341428-19341450 TTTTTTGTAGAGATGGGGTCTGG - Intergenic
1135260985 16:20980549-20980571 CTTTTAGTAGAGATGGTGGGGGG + Intronic
1135261382 16:20983847-20983869 ATTTTTGTAGAGATAGGGGACGG - Intronic
1135640124 16:24112349-24112371 TTTTTTGTAGAGATGGGAGTTGG - Intronic
1135707530 16:24687616-24687638 ATTTTTGTAGAGATGGGAAAGGG - Intergenic
1135763576 16:25157374-25157396 TTATTTGTATAGATGGGGGGTGG - Intronic
1135919909 16:26640561-26640583 GTGTTTGGAGAGATGGGCGGCGG + Intergenic
1136088893 16:27904245-27904267 TTTTTTGTAGAGATGGGGTTTGG + Intronic
1136138717 16:28275151-28275173 TTTTTTGTAGAGATGGGGGAGGG - Intergenic
1136177525 16:28527963-28527985 GTGTGTGTAGAGATGGGTAGGGG - Intergenic
1136588926 16:31205408-31205430 TTTTTTGTAGAGATGGGGTCTGG + Intergenic
1136597917 16:31264716-31264738 TTTTTTGTAGAGATGGGGTCTGG + Intronic
1138422597 16:56909411-56909433 ATGGTGGTAGGGATGGGGGGTGG - Intronic
1138542772 16:57698514-57698536 TTTTTTGTAGACATGGGTGGGGG - Intronic
1139733377 16:68967091-68967113 ATTTTTGTAGAGATGGGGTCTGG + Intronic
1139764534 16:69215982-69216004 AAATTTGTAGAGATGAGGGTGGG + Intronic
1139795331 16:69478413-69478435 TTTTTTGTAGAGATGGGGTCTGG - Intergenic
1139816941 16:69682438-69682460 TTCTTTGTAGGGATGGCGGGGGG - Intronic
1140015123 16:71175099-71175121 GTATTTGTAGAGTTGGTGGGTGG - Intronic
1140065704 16:71609517-71609539 TTTTTTGTAGAGATGGCGGGGGG - Intergenic
1140375528 16:74442657-74442679 TTTTTTGTAGAGATTGGGGGTGG + Intergenic
1140488943 16:75317938-75317960 TTTTTAGTAGAGATGGGGGGTGG - Intronic
1140572062 16:76119020-76119042 ATGGTGGTAGCGATGGGAGGAGG + Intergenic
1141597187 16:85104536-85104558 TTTTTAGTAGAGATGGGGGGAGG - Intronic
1141641364 16:85343569-85343591 TTTTTTGTAGAGATGGGGTCTGG - Intergenic
1141854945 16:86674343-86674365 ATGGATGAAGAGATGGAGGGAGG - Intergenic
1141894720 16:86951999-86952021 TCCTTTGTAGAGATGGGGGAGGG - Intergenic
1142178764 16:88657117-88657139 TTTTTTGTAGAGATGGGGGGGGG + Intronic
1142180224 16:88664891-88664913 TTTTTTGTAGAGATGTGGGGGGG + Intergenic
1142255167 16:89010389-89010411 CTGTCTGTAGAGTTGGGGTGAGG + Intergenic
1142513986 17:415053-415075 TTTTTTGTAGAGATTGGAGGGGG + Intronic
1142636278 17:1259763-1259785 ATTTTTGTAGAGATGGGGGTGGG - Intergenic
1142687384 17:1585556-1585578 TTTTTTGTAGAGACGGGGAGTGG + Intronic
1142835001 17:2578885-2578907 TTTTTAATAGAGATGGGGGGAGG - Intergenic
1143566188 17:7722174-7722196 ATTTTTATAGAGACGGGGGGGGG + Intronic
1143664958 17:8352204-8352226 GTGTTTTTGGAGATGGTGGGGGG + Intergenic
1143956012 17:10669724-10669746 TTTTTTGTAGAGATGGGGTCTGG - Intergenic
1143962379 17:10731325-10731347 GTGTTTGCAGAGGTGGGGTGGGG + Intergenic
1144607417 17:16679072-16679094 GTTTTTGTAGAGATGGCGGGGGG + Intergenic
1144967674 17:19088461-19088483 AAATTTGTAGAGACGGGGGGGGG + Intergenic
1144980244 17:19163604-19163626 AAATTTGTAGAGACGGGGGGGGG - Intergenic
1144987978 17:19214628-19214650 AAATTTGTAGAGACGGGGGGGGG + Intergenic
1145042124 17:19584781-19584803 ATTTTTGTAAAGATGGGGTCTGG + Intergenic
1145201380 17:20948302-20948324 TTATTTTTAGAGATGGGGGGGGG + Intergenic
1146033606 17:29387784-29387806 TTTTTAGTAGAGACGGGGGGGGG - Intergenic
1146066827 17:29642596-29642618 CTGTTTTTATAGATGGGGGATGG - Intronic
1146224613 17:31054718-31054740 ATTTTTGTAGAAATGGGGGGGGG + Intergenic
1146295877 17:31649877-31649899 TTTTTAGTAGAGATCGGGGGGGG - Intergenic
1146981005 17:37161708-37161730 ATGTGTGGAGAGGTGGGGGAAGG - Intronic
1147122811 17:38345577-38345599 ATGTAGGTAGGGATGGGTGGTGG + Intergenic
1147245493 17:39117557-39117579 TTTTTTGTAGACTTGGGGGGAGG - Intronic
1147271400 17:39274454-39274476 CTTTTTGTAGAGATGGGGTCAGG - Intronic
1147323890 17:39661258-39661280 CTGTCTGTGGAGATGGGGGGTGG + Intronic
1147642555 17:42012976-42012998 TTTTTTACAGAGATGGGGGGCGG + Intronic
1147662039 17:42121933-42121955 TTTTTTGTAGAGATTGGTGGGGG - Exonic
1147667478 17:42157782-42157804 ATTTGTATAGAGATGGGTGGGGG + Intronic
1147832593 17:43307300-43307322 TTTTTTGTAGAGATGGGGGTTGG - Intergenic
1147839391 17:43360154-43360176 ATGCTTGTACACATGGGGAGAGG + Intergenic
1148010644 17:44477985-44478007 TTTTTAGTAGAGATGGGGTGGGG + Intronic
1148104422 17:45111858-45111880 TTTTATGTAGAGATGGCGGGGGG - Exonic
1148450217 17:47772699-47772721 TTTTTTGTAGAGATGGGGTTTGG + Intergenic
1148813133 17:50307545-50307567 TTTTTGGTAGAGATGGGGGGGGG + Intergenic
1148968025 17:51454156-51454178 TTTTTTTTAGAGATGGTGGGGGG + Intergenic
1149292887 17:55234422-55234444 ATGTTTGTCAGGATGGGTGGGGG - Intergenic
1149765224 17:59270369-59270391 TTTTTAGTAGAGACGGGGGGGGG + Intronic
1149786558 17:59440465-59440487 CTTTTTGTAGAGATGGGGAGGGG - Intergenic
1149822890 17:59797158-59797180 TTTTTAGTAGAGACGGGGGGGGG - Intronic
1150048970 17:61940057-61940079 ATTTTAGTAGAGATGGGGTTTGG - Intergenic
1150266471 17:63835298-63835320 TTTTTTGTAGAGATGGGGTCTGG + Intronic
1150765663 17:67999982-68000004 ATTTTAATAGAGATGGGGGTGGG + Intergenic
1150836568 17:68569303-68569325 ATGGTGGTAGAGAAGAGGGGTGG - Intronic
1151451855 17:74202958-74202980 TTATTGCTAGAGATGGGGGGGGG + Intergenic
1151493468 17:74445994-74446016 TTTTTTGTAGAGATGGTGGGCGG - Intronic
1151822389 17:76503599-76503621 TTTTTTGTAGAGATGGTGGTGGG + Intergenic
1151891880 17:76955934-76955956 TTTTTTATAGAGATGGGGGTGGG + Intergenic
1151929342 17:77221709-77221731 ATTTTTGTAGAGATGAGGTCTGG + Intergenic
1152149811 17:78591914-78591936 TTTTTTGTAGAGACGGGGGGGGG + Intergenic
1152181977 17:78828044-78828066 TTGTTTGTAGAGATGGGGTCTGG - Intronic
1153057109 18:956777-956799 ATTTTTGTGGAGATGGGGTTTGG + Intergenic
1153218704 18:2844086-2844108 TTTTTTGTAGAGATGGGCGGGGG - Intergenic
1153829744 18:8911631-8911653 ATTTTTGTAGAGCTGGGGTCTGG - Intergenic
1154004771 18:10517652-10517674 ATGTTTTGAGAGATGGGAAGTGG + Intergenic
1154202587 18:12309192-12309214 ATTGTTGTAGAGATCGGGGCGGG - Intronic
1154384158 18:13878680-13878702 TTTTTTGTAAAGATGGGGGGCGG + Intergenic
1155309607 18:24510689-24510711 TTTTTTGTAGAGATGGGCGGGGG + Intergenic
1155338421 18:24789454-24789476 TTCTTTATAGAAATGGGGGGGGG - Intergenic
1155518606 18:26647333-26647355 TTTTTAGTAGAGATGGGGGGGGG - Intronic
1155538569 18:26843149-26843171 ATTTTTCTAGAGGTGGGAGGGGG - Intergenic
1155968293 18:32056437-32056459 TTTTTAGTAGACATGGGGGGTGG - Intronic
1155971012 18:32083732-32083754 ATTTTTGTAGAGATGGGGTTTGG - Intergenic
1156423221 18:36978980-36979002 ATATTTGTAGAGATGGGGTCTGG - Intronic
1156879491 18:42059945-42059967 TTTTTTGTAGAGACGGGGTGGGG + Intronic
1157476707 18:48028565-48028587 ATGTGTTTAGAGGTGGAGGGCGG + Exonic
1157626483 18:49055250-49055272 AAGTTTGGAGAGGTGGGTGGAGG + Intronic
1157946099 18:51982535-51982557 ATATTTGTAGAGAAGGGAGTGGG + Intergenic
1158243693 18:55406737-55406759 GTGGTTGTGGGGATGGGGGGAGG - Intronic
1158457866 18:57623287-57623309 ATTTTTGTGGAGATGGGGGAGGG + Intergenic
1158477434 18:57792791-57792813 ATGTGTATGGAGATGGGGAGTGG + Intronic
1158638033 18:59178440-59178462 ATTTTTGTGGAGATGGGTGGGGG - Intergenic
1158805584 18:60968070-60968092 ATGTTTAGAGAGATGCAGGGTGG - Intergenic
1158969568 18:62654067-62654089 ATGTTTGTAGGGAATGGGGTCGG - Intergenic
1159023595 18:63163021-63163043 GTTTTTGTAGAGATGGGGTCTGG + Intronic
1160522991 18:79519509-79519531 TTGTTTGTAGAGATGGGGGGTGG + Intronic
1160948918 19:1656374-1656396 ATTTTAGCAGAGATGGGGTGAGG + Intergenic
1161074820 19:2280519-2280541 TGTTTTGTAGAGATGGGGGGCGG + Intronic
1161136536 19:2623146-2623168 TTTTTTGTAGAGATGGGGTCTGG - Intronic
1161151072 19:2710030-2710052 ATATTTGTAGATATGGTGGGGGG - Intergenic
1161191205 19:2957353-2957375 TTTTTTGTAGAGATGGGGTCTGG - Intergenic
1161204461 19:3033838-3033860 CTTTTTGTAGAGATGGGGGGTGG - Intronic
1161374081 19:3930074-3930096 TTTTTGGTAGAGATGGTGGGGGG + Intergenic
1161387042 19:4000600-4000622 TTGTTTGTAGATTTGGGAGGGGG - Intergenic
1161431016 19:4232543-4232565 TTTTTTCTACAGATGGGGGGGGG - Intronic
1161521199 19:4724342-4724364 TTTTTAGTAGAGATGGGGTGGGG + Intronic
1161595035 19:5146760-5146782 TTTTTTGTAGAGATTGTGGGGGG - Intronic
1161638299 19:5403236-5403258 TTTTTTGTAGAGATGGTGGAGGG + Intergenic
1161641105 19:5423865-5423887 ATGTTTGGGCAGATGGTGGGTGG - Intergenic
1161664749 19:5568418-5568440 GTTTTTGTAGAGATGGGGCCTGG + Intergenic
1161686702 19:5706311-5706333 TTTTTTGTAGAGATGGGGCCAGG + Intronic
1161692177 19:5742611-5742633 TTTTTTGTAGATATGGTGGGGGG - Intronic
1162228296 19:9243220-9243242 GTGTGTGTGGAGATGGCGGGAGG - Intergenic
1162339497 19:10083667-10083689 TTTTTTGTAGAGCTGGGGGCGGG - Intergenic
1162366061 19:10250440-10250462 TTTTTTGTAGAGATGGCGGGGGG - Intergenic
1162389687 19:10381835-10381857 ATTTTTGTAGAGATGGGGTCTGG + Intergenic
1162697310 19:12486254-12486276 ATTTTCTTAGAGATGGGGGAGGG - Intronic
1162913021 19:13860030-13860052 TTTTTTGGAGAGATGGGGGTGGG - Intergenic
1162927652 19:13938279-13938301 ATGGGTCTGGAGATGGGGGGCGG - Exonic
1162952018 19:14076864-14076886 TTTTTTGTAGAGATGGGGTGGGG - Intergenic
1163062267 19:14769218-14769240 TTATTAGTAAAGATGGGGGGGGG - Intronic
1163166303 19:15500364-15500386 TTTTTTGTAGAGATGGGCAGGGG - Intergenic
1163277423 19:16294108-16294130 GTTTTTGTAGAGATGGGGGGAGG + Intergenic
1163307063 19:16487181-16487203 ATTGTTGTAGAGATGGGGCCAGG + Intronic
1163367685 19:16885073-16885095 TTTTTTGTAGAGATGGTTGGGGG + Intergenic
1163462952 19:17449664-17449686 TTTTTTGTAGAGATGGGGTCTGG - Intronic
1163512311 19:17742648-17742670 TTTTTTGTAGAGATGGGGTTCGG + Intergenic
1163535786 19:17875594-17875616 TTTTTTGTAGAGATGGGGGCGGG - Intronic
1163623003 19:18371941-18371963 TTTTTTGTAGAGATGGGGGGGGG - Intergenic
1163685742 19:18710786-18710808 ATTTTAGTAGAGATGGGGTTTGG + Intronic
1163750528 19:19074511-19074533 ATGTTTGTACAAATGTTGGGTGG - Intronic
1163795085 19:19333305-19333327 TTTTTTGTAGAGATGGGGTCTGG - Intronic
1164473628 19:28555847-28555869 ATGTTTGTGGAAATTTGGGGAGG - Intergenic
1164635864 19:29791130-29791152 TTTTTTGTAGAGATGGGGTCTGG - Intergenic
1164742314 19:30584916-30584938 ATTTTTGTAGAGAGGGGGTCTGG - Intronic
1164957775 19:32401952-32401974 TTTTTTGTAAAGATTGGGGGTGG - Intergenic
1165462075 19:35949848-35949870 TTATTTGTAGAGATGGGGTATGG - Intergenic
1165470937 19:36004186-36004208 TGATTTGTAGAGATGGGGGGAGG + Intronic
1165503906 19:36212441-36212463 ATTTTAGTAGAGACGGGGGGAGG - Intronic
1165584242 19:36899265-36899287 CTGTTTATAGAGATCGGGGGGGG - Intronic
1165620994 19:37247654-37247676 TTTTCTGTAGAGATGAGGGGAGG - Exonic
1165695760 19:37899768-37899790 ATTTTTGTAGAGATGGGAGTGGG + Intronic
1165834350 19:38745141-38745163 TTTTTTGTAGAGATGGGGCGGGG + Intronic
1165857005 19:38885271-38885293 ATTTTTGTAGAGATGGGGGGTGG + Intronic
1165858180 19:38892747-38892769 TTTCTTGTAGAGATGGCGGGGGG + Intronic
1166116839 19:40661531-40661553 TTTTTTGTAGAGATCGGGGTGGG + Intergenic
1166202410 19:41246730-41246752 ATTTTTTTAGAGATGGGGTCTGG + Intronic
1166211825 19:41311416-41311438 TTTTTTGTAGAGATGGGGTCTGG - Intronic
1166324311 19:42039800-42039822 TTTTTTGTAGAGATGGGGTCTGG - Intronic
1166741000 19:45114773-45114795 TATTTTGTGGAGATGGGGGGGGG - Intronic
1166776815 19:45318064-45318086 ATGTGTGTCGGGATGGGGGCGGG + Intronic
1167064855 19:47177536-47177558 CTGTTTGTACAGATTGGGGCAGG + Intronic
1167075658 19:47247235-47247257 TTTTTTGTAGAGATGGGGGGGGG + Intergenic
1167128645 19:47569698-47569720 TTTTTTGTAGAGATGGGTGGGGG - Intergenic
1167276321 19:48542216-48542238 ATTTTTGTAGAGATGGGGTCTGG - Intergenic
1167462667 19:49634428-49634450 TTTTTGGTAGAGATGGGGGCGGG + Intergenic
1167585191 19:50370648-50370670 TTTTTTGTAGAGATGGGGGTGGG + Intronic
1168028421 19:53660848-53660870 TTTTTTGTAGAGACGGGGGCAGG - Intergenic
1168142339 19:54396882-54396904 TTTTTTGTAGAGATGGGGTTTGG - Intergenic
1168260304 19:55189814-55189836 TTTTTTGTAGAGATGGAGGTCGG - Intronic
1168278651 19:55291665-55291687 GTGTTTTTGGAGATGGGGTGGGG + Intronic
1168313654 19:55474158-55474180 TTTTTAGTAGAGTTGGGGGGGGG + Intergenic
1168530087 19:57120241-57120263 TTTTTTGTAGAGATGGGTGGGGG - Intronic
1168542406 19:57224084-57224106 TTTTTTGTAGAGATGGGGTCTGG - Intergenic
926046565 2:9714260-9714282 ATTTTTGTAGAGATTCGGGGTGG - Intergenic
926243710 2:11106652-11106674 TTTTTTGTAGAGATGGAGGGCGG - Intergenic
926690909 2:15732733-15732755 AGGGTTCTAGAGATGGGGTGGGG + Intronic
927518715 2:23686776-23686798 AGGTTTGTAGAGATGGGGCTGGG + Intronic
927545926 2:23952754-23952776 TTTTTTGTAGAGATGGGGTCTGG + Intronic
927602407 2:24455494-24455516 TTTTTAGTAGAGATGGGGGGGGG + Intergenic
927785544 2:25971902-25971924 TTTTTTGTAGAGATGGGGTCTGG + Intronic
927807218 2:26158824-26158846 TTTTTAGTAGAGATGGTGGGGGG - Intergenic
927820654 2:26261214-26261236 TTGTTTGTCTGGATGGGGGGGGG - Intronic
927936255 2:27078507-27078529 ATGGTTGGAGAGGTGGGGGGAGG + Intergenic
928299714 2:30114444-30114466 ATTTTTGTAGAGATGGCAGTGGG + Intergenic
928405260 2:31009890-31009912 ATGGTTGTAGAGATGGGAAAAGG - Intronic
928436371 2:31257173-31257195 CTGTTTGCAGAGGTGGGGGTTGG + Intronic
929455933 2:42065526-42065548 ATTTTTTTTGAGATGGGCGGCGG - Intergenic
929530156 2:42745553-42745575 ATTTTTACAGAGATGGGGGCAGG + Intronic
929648554 2:43654710-43654732 TTTTTGGTAGAGATGCGGGGGGG - Intronic
930085157 2:47491560-47491582 ATTTTTTTAGAGACGGGGGTGGG - Intronic
930212487 2:48655783-48655805 AAATTTCTAGAGATGGGTGGTGG - Intronic
930631067 2:53755979-53756001 TATTTTGTAGAGGTGGGGGGGGG - Intronic
930688917 2:54338975-54338997 TTTTTAGTAGAGATGGGGGGGGG - Intronic
930705167 2:54497912-54497934 ATGTTTGTAGAGATGGTCTCCGG - Intronic
931311936 2:61089987-61090009 TTTTTTGTAGAGATGGGGTCTGG - Intronic
931421753 2:62134586-62134608 TTTTTTGTAGAGATGGGGGTAGG - Intronic
931543583 2:63355709-63355731 ATTTCAGTAGAGATGGGGGTTGG - Intronic
931732832 2:65168167-65168189 TTTTTTGTTGAGATGGGGTGGGG + Intergenic
932087771 2:68776845-68776867 AAGTGTGTAGATATTGGGGGTGG + Intronic
932114035 2:69029046-69029068 TTTTTAGTAGAGATGGAGGGGGG - Intronic
932129539 2:69175445-69175467 ATTTTTGTAGATATCGGCGGCGG - Intronic
932245594 2:70193641-70193663 TTTTTTGTAGAGATTGGGGGTGG + Intronic
932247487 2:70207730-70207752 TTTTTAGTAGAGATGGGGGGGGG + Intronic
932452798 2:71826154-71826176 CTGTTTCTTGAGATGGGTGGTGG + Intergenic
932705167 2:74019079-74019101 TTTTTTGTAGAGATGAGGGTTGG - Intronic
932780937 2:74557905-74557927 ATTTATGTAGAGATGGCGGGGGG + Exonic
932823047 2:74917488-74917510 ATGTTTTTAGAGACAGGGGAAGG - Intergenic
933652403 2:84859936-84859958 TTTTTTGGAGAGATGGGGGGGGG + Intronic
933730603 2:85453316-85453338 TTTTTTGTTGAGATTGGGGGGGG + Intergenic
933890025 2:86759621-86759643 TTTTTAGTAGAGATGGTGGGGGG - Intronic
934027081 2:88010129-88010151 TTGTTTGAAGATATGGTGGGGGG + Intergenic
934744940 2:96753216-96753238 ACTTTTGTAGAGATGGGGGCGGG + Intergenic
934774577 2:96928978-96929000 TTTTTTGTAGAGGTGGCGGGGGG - Intronic
934964709 2:98710635-98710657 TTTTTAGTACAGATGGGGGGCGG + Intronic
935520333 2:104096574-104096596 ATTTTTGTAGAGATGAGGTTTGG - Intergenic
936233923 2:110726712-110726734 GGGCTTGTGGAGATGGGGGGTGG + Intergenic
936600264 2:113889082-113889104 TTTTTTGGAGGGATGGGGGGGGG + Intergenic
937217427 2:120321545-120321567 TTTTTTGTAGAGATGGGGTGAGG + Intergenic
937925447 2:127164390-127164412 GTGTGTGTAGATATGGGAGGAGG + Intergenic
938892314 2:135718163-135718185 ATAGTAGTAGAGATGGGGTGTGG + Intronic
939179010 2:138782240-138782262 ATTTTTGTAGGGATGAGGAGTGG - Intergenic
939454805 2:142420410-142420432 TTTTTAGTAGAGATGGGGGTGGG + Intergenic
939528742 2:143329911-143329933 TTTTTTGTAGTGATGGGGGTTGG - Intronic
939611968 2:144321783-144321805 TTTTTTGTAGAGATGGGGTCTGG + Intronic
940143254 2:150519080-150519102 TTGTTTGAAGAATTGGGGGGTGG - Intronic
941389006 2:164888901-164888923 TTTTTTGTAGAGATGGGGTGGGG + Intergenic
942050865 2:172139515-172139537 TTTTTTGTAGAGATGGGGTTTGG + Intergenic
942100622 2:172579230-172579252 ATGTTTCCAGGGATGGGGGTGGG + Intronic
942973473 2:181985613-181985635 AAGTTTTTAGAGTTGGGGGCAGG - Intronic
943701866 2:190995838-190995860 ATGTGAGGAGAGATGGGTGGAGG + Intronic
944629325 2:201607477-201607499 TCTTTTGTAGAGATGGGGGCCGG - Intronic
944646573 2:201786316-201786338 ATGTTTGTATGCATGGAGGGAGG - Intergenic
944721544 2:202427798-202427820 TTTTTTGTAGAGATGGGGTTTGG - Intronic
944725438 2:202466773-202466795 GTGTTTGTAGAGATGTGGTATGG + Intronic
944901600 2:204222123-204222145 ATGTTGTTAAAGGTGGGGGGTGG - Intergenic
945317654 2:208388135-208388157 TTTTTAGTAGAGACGGGGGGGGG - Intronic
945438234 2:209844769-209844791 TTTTTTGTAGAGATGGGGGTGGG + Intronic
946383463 2:219365751-219365773 ATTTTTGTATAGATGGGGTTTGG + Intergenic
946853854 2:223933782-223933804 TTTTTTGTAGAGATGGGGGGGGG - Intronic
946941111 2:224771111-224771133 GTTTTTGTAGAGACGGGGGAAGG + Intronic
947211223 2:227710382-227710404 ATTTTTGTAGAGATGGAGTCTGG - Intronic
947214971 2:227741940-227741962 ATTTTTGTAGAGATGGGGTCTGG - Intergenic
947234903 2:227930546-227930568 TTTTTTGTAGAGATGAGGGCTGG + Intergenic
947685813 2:232083287-232083309 ATGTATGTATATGTGGGGGGGGG - Intronic
947979669 2:234398313-234398335 TTTTTAGTAGAGATGGGGTGGGG + Intergenic
948176181 2:235945277-235945299 TTTTTAGTAGAGTTGGGGGGGGG + Intronic
948445860 2:238032435-238032457 TTTTTTGTAGAGATGGGGTTTGG - Intronic
1169104254 20:2980676-2980698 TTTTTTGTAGAGATGGGGGGAGG - Intronic
1169234088 20:3914785-3914807 ATTTTAGTAGAGATGGGGTTTGG + Intronic
1169431876 20:5543687-5543709 ATGTATGTGGAGATGAGGAGGGG - Intergenic
1169483047 20:6002559-6002581 TTTTTGGTAGAGATGGCGGGCGG + Intergenic
1170537758 20:17358131-17358153 TTTTTTGTAGAGATTAGGGGGGG - Intronic
1170891847 20:20382606-20382628 TTTTTTGTAGCGATGGGTGGGGG + Intergenic
1171207501 20:23292496-23292518 ACATTTGTAGATACGGGGGGCGG - Intergenic
1171562326 20:26136689-26136711 GTGTTTGGATAGATGGAGGGGGG + Intergenic
1171996860 20:31738225-31738247 TTTTTAGTAGAGATGGGGGGGGG + Intergenic
1172049417 20:32105285-32105307 CTCTTTGTAGATATGGTGGGGGG - Intergenic
1172068865 20:32241620-32241642 CTTTTGGTAGAGATGGAGGGGGG - Intergenic
1172075388 20:32292421-32292443 TTGTTTGTAGAAGTTGGGGGGGG - Intronic
1172155670 20:32822154-32822176 ATGTTTTTTGAGCTGGGGTGTGG + Intronic
1172367679 20:34362588-34362610 TTCTTTGTAGAGATGGGGATGGG - Intergenic
1172523838 20:35585537-35585559 CTTTTTGTAGAGATGGGGTTTGG + Intergenic
1172584823 20:36075758-36075780 ATAATTATAGAAATGGGGGGGGG + Intergenic
1172672687 20:36645187-36645209 ATTTTTGTAGAGATGGCAGGCGG - Intronic
1172803882 20:37597684-37597706 ATGTTTGAATAAATGGAGGGAGG + Intergenic
1173259672 20:41422466-41422488 TTTTTTGTAGACATGGGGGGTGG - Intronic
1173508847 20:43610111-43610133 TTTTTAGTAGAGATGGGGGTTGG - Intronic
1173521520 20:43703594-43703616 ATGTGTGGAGTGGTGGGGGGTGG + Intronic
1173636385 20:44562431-44562453 ATTTTTGTAGAGATGGCGTTTGG - Intronic
1173729733 20:45319873-45319895 TTTTTTGTAGAGATGGGGGAGGG - Intergenic
1173815903 20:45987812-45987834 TTTTTTTTAGAGACGGGGGGGGG - Intergenic
1173952982 20:47007794-47007816 TTTTTTGTAGAGACGGGGGGTGG + Intronic
1174088357 20:48026549-48026571 TTTTTTGTAGAGATGGGGTCTGG + Intergenic
1174346178 20:49931856-49931878 TTTTTTGTAGAGATGGGGGAGGG + Intergenic
1174440252 20:50545846-50545868 TTTTTTGTAGAGACGGGGGGAGG - Intronic
1174525017 20:51163662-51163684 TTATTTGTAGAGATGGTGGGGGG - Intergenic
1174794803 20:53513073-53513095 TTTTTTGTAGAGATTGGGGGGGG - Intergenic
1175866250 20:62178721-62178743 ATTTTTGTAGAGATGGAGTCTGG + Intronic
1176137788 20:63532437-63532459 GTGTGTGTAGACGTGGGGGGGGG + Intronic
1176153653 20:63607034-63607056 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153660 20:63607067-63607089 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153667 20:63607100-63607122 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153685 20:63607201-63607223 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153692 20:63607234-63607256 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153718 20:63607370-63607392 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153733 20:63607436-63607458 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153753 20:63607539-63607561 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153761 20:63607573-63607595 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153789 20:63607711-63607733 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153818 20:63607848-63607870 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153941 20:63608492-63608514 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153955 20:63608560-63608582 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153975 20:63608662-63608684 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153989 20:63608730-63608752 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154003 20:63608798-63608820 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154031 20:63608935-63608957 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154119 20:63609416-63609438 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154140 20:63609518-63609540 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154153 20:63609585-63609607 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154167 20:63609652-63609674 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154174 20:63609685-63609707 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154188 20:63609754-63609776 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154196 20:63609788-63609810 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154223 20:63609926-63609948 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154231 20:63609960-63609982 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176513831 21:7768474-7768496 ATGTTGGTAGCGGTGGTGGGTGG - Intronic
1177787746 21:25690518-25690540 TTTTTTGTAGAGATGAGGTGAGG + Intronic
1178191944 21:30293035-30293057 TTGTGTGTAAAGATAGGGGGAGG + Intergenic
1178511451 21:33208052-33208074 ATCTATGGAGAGATGGGGTGGGG - Intergenic
1178647944 21:34398998-34399020 ATGTTGGTAGCGGTGGTGGGTGG - Intronic
1178847051 21:36182649-36182671 TTTTTTGTAGAGATGGGGTCTGG - Intronic
1179473698 21:41629861-41629883 ATTTTTGTAGAGATGAGGTCTGG - Intergenic
1179677169 21:42991305-42991327 TTTTTTGTAGAGATGGGGTCTGG - Intronic
1180284507 22:10731367-10731389 ATTTTTATAGAGATGGGGGCAGG - Intergenic
1180884133 22:19227773-19227795 TTTTTTGTAGAGATGGGGTTTGG + Intronic
1180932090 22:19599181-19599203 TTGTTTGTAGAGATAGGGTCTGG + Intergenic
1181270623 22:21656661-21656683 ATGTTGGAAGAGCTGAGGGGTGG + Intronic
1181311684 22:21948310-21948332 TTTTTGGTAGAGATGGGGGGTGG - Intronic
1181744241 22:24944752-24944774 ATTTTGGTAGAGATGAGGTGAGG + Intronic
1181795628 22:25307077-25307099 ATTTCTATAGAGATGGGGGCCGG - Intergenic
1181812218 22:25410370-25410392 CTTTTTGTAGAGATGAGGGGAGG + Intergenic
1182203930 22:28603570-28603592 TTTTTTGTAGAGATGGGGTCTGG + Intronic
1182540797 22:31040384-31040406 TTTTTTGTAGAGATGGGAGGGGG + Intergenic
1182729233 22:32474305-32474327 TTTTTTGTAGAGATGGGGGGGGG + Intergenic
1182743009 22:32582539-32582561 ATTTTTGTAGAGACGGGCTGGGG + Intronic
1183202430 22:36394863-36394885 TTTATTGTAGAGATGGGAGGAGG + Intergenic
1183470619 22:38004163-38004185 TCTTTTGTAGAGATGTGGGGGGG + Intronic
1183559829 22:38563683-38563705 AAATTTGTGGAGATGGGGGAGGG - Intronic
1183911853 22:41085766-41085788 ATGTTTGTAGAGACAGGGTGGGG + Intergenic
1183913794 22:41100050-41100072 TTTTTTCTAGAGATGGTGGGGGG - Intronic
1183926255 22:41208305-41208327 TCTTTTGTAGAGATGGGGTGTGG + Intronic
1184053733 22:42029547-42029569 ATTTTTATAGAGATGGGGTCTGG + Intronic
1185268299 22:49916672-49916694 ATTTTTGTGGAGATGGGGTCTGG - Intronic
949204278 3:1419822-1419844 ATGTTTAGAGAGATGGTGGGAGG + Intergenic
949587957 3:5461470-5461492 ATGCTTTTAGAGATGGGGGTGGG - Intergenic
949631532 3:5933372-5933394 GTGTTTCTAGGGATGGGTGGAGG - Intergenic
950028652 3:9837503-9837525 AAATTTGTAGAGATGGTGGCTGG - Intronic
950038605 3:9904914-9904936 TTTTTTGTAGAGATGGGGTTTGG - Intronic
950114620 3:10442609-10442631 ATGGTAGTGGTGATGGGGGGAGG + Intronic
950298895 3:11856881-11856903 TTTTTAGTAGAGATGGGGGATGG + Intergenic
950383519 3:12637509-12637531 ATGTTAATAGAGATGGAGGCGGG - Intronic
950384344 3:12645734-12645756 TTTTTTGTAGAGGTGGGGTGGGG + Intronic
950389956 3:12688842-12688864 TTTTTTGTAGAGATGGGGACTGG - Intergenic
950774477 3:15337732-15337754 TTTTTGGTAGAGATGTGGGGAGG - Intronic
950780421 3:15386967-15386989 TTTTTAGCAGAGATGGGGGGTGG + Intronic
951011497 3:17686908-17686930 ATGTTAGTAGTGATGAGGGTAGG + Intronic
951031345 3:17885219-17885241 GTGTTTGTGGTGATGGGGGATGG - Intronic
951249648 3:20380132-20380154 AGGTTTCTAGAGATGGAAGGCGG - Intergenic
951551427 3:23878909-23878931 ATTTTTCCACAGATGGGGGGTGG - Intronic
951576782 3:24122635-24122657 ATGGTTGTGGAGGTGGGGTGGGG - Exonic
951640728 3:24831627-24831649 ATGCTTATAGATATGGTGGGGGG + Intergenic
951645942 3:24891550-24891572 ATATTTATAGAGATGGGGGTGGG - Intergenic
952136435 3:30427544-30427566 TTTTTTGTAGAGATGGGGCCTGG - Intergenic
952247269 3:31607769-31607791 TTGTTTGTAGAAATGGTAGGGGG + Intronic
952301134 3:32105862-32105884 ATTTTTGTACAGAGGGGTGGGGG + Intronic
952723849 3:36561221-36561243 GATTTTGTAGAGATTGGGGGAGG - Intergenic
952923138 3:38300988-38301010 GTTTTTTTAGAGATGGGGGTTGG + Intronic
953650764 3:44801185-44801207 TTTTTAGTAGAGATCGGGGGCGG + Intronic
953751327 3:45610630-45610652 CTGTTGGCAGAGCTGGGGGGTGG - Intronic
954318677 3:49815813-49815835 GCTTTTGTAGAGATTGGGGGTGG + Intergenic
954673111 3:52301160-52301182 ATGTTTGTGGAGATGGTGGCAGG + Intergenic
955217894 3:56999626-56999648 ATTTTTGTAGAGATGGGGTCTGG - Intronic
955671861 3:61410763-61410785 ATGTTTTTAGAGACGGGGGGGGG - Intergenic
955788158 3:62561437-62561459 TTTTTGGTAGAGATGGTGGGGGG + Intronic
956089356 3:65649202-65649224 ATTTTTTTAGAGATTGGGGTGGG - Intronic
956662149 3:71609876-71609898 TTTTTAATAGAGATGGGGGGGGG - Intergenic
957055576 3:75440204-75440226 ATTTTTGTAGAGATGGAAGGTGG + Intergenic
959510873 3:107210260-107210282 ATCAATGTAGAGCTGGGGGGGGG + Intergenic
959848757 3:111063912-111063934 ATTTTTGTAGAGATGGGGGGGGG - Intergenic
959852457 3:111105308-111105330 TTTTTTGTAGAGATGGGGTTTGG + Intronic
959853356 3:111117442-111117464 ATGTTTGTTAAGATGTGTGGTGG + Intronic
960669983 3:120146428-120146450 TTATTTGTAGAGATGAGGGGGGG - Intergenic
960733793 3:120755749-120755771 ATGGTAGTAGGGATGGGGGATGG - Intronic
960956590 3:123036141-123036163 AAGGTTGTAGAGATAGAGGGTGG + Intergenic
961291265 3:125848645-125848667 ATTTTTTTAGAGATTGGGGCAGG + Intergenic
961298811 3:125908402-125908424 ATTTTTGTAGAGATGGCAGGTGG - Intergenic
961889248 3:130116585-130116607 ATTTTTGTAGAGATGGCAGGTGG + Intergenic
961930828 3:130531001-130531023 GTGTGTGTAGAGGAGGGGGGTGG - Intergenic
961941263 3:130639513-130639535 TTTTTTGTAGAGATGGGGTTTGG - Intronic
961965169 3:130894357-130894379 AAGTTTCTAGAAATGGGGGCAGG - Intronic
962120214 3:132553192-132553214 TTTTTTGTAGAGATGGGGTTTGG + Intergenic
962377044 3:134867058-134867080 ATGTTTGTATAGATGGGAGGGGG + Intronic
962578397 3:136775323-136775345 TTTTTAGTAGAGATGGGGGGGGG + Intergenic
962806363 3:138930229-138930251 TTCTTTGTAGAGATGGTGGGGGG + Intergenic
964494392 3:157272640-157272662 ATTTTTGTAGAAATGGGGTTAGG + Intronic
965596200 3:170413818-170413840 TTTTTTATAGAGATGGGGGAGGG - Intergenic
965916009 3:173846609-173846631 ACATTTGTAGAAATGGGGGTGGG - Intronic
966606769 3:181828817-181828839 ATGTTTTTAGAAATGGGGTCTGG + Intergenic
966858045 3:184209670-184209692 ATTTTTGTAGGCATGGTGGGAGG + Intronic
966890435 3:184403762-184403784 TTTTTTGTAAAGATGGGGGGGGG + Intronic
967184687 3:186934377-186934399 TTTTTTGTAGAGATGGCGGTGGG - Intronic
967292906 3:187938869-187938891 TTTTTTGTACAGATGGTGGGGGG + Intergenic
968124804 3:196151108-196151130 TTTTTAGTAGAGATGGGGGGTGG - Intergenic
968442036 4:629054-629076 ATGTTGGGAGGGATGGAGGGGGG - Intronic
968998389 4:3960502-3960524 ATTTTTGTAGAGATGGCAGGTGG + Intergenic
969219523 4:5750821-5750843 ATGTTTGTATAGAAGAGGGATGG + Intronic
969418960 4:7079065-7079087 TTTTTAGTAGAGATGGGGTGGGG + Intergenic
969755612 4:9148142-9148164 ATTTTTGTAGAGATGGCAGGTGG - Intergenic
969815504 4:9684270-9684292 ATTTTTGTAGAGATGGCAGGTGG - Intergenic
969930335 4:10624883-10624905 ATGAGTTTAGAGATGTGGGGCGG - Intronic
970557833 4:17253568-17253590 TTTTTAGTAGAGATGGGGAGAGG - Intergenic
971453097 4:26818404-26818426 TTTTTTGTAGAGATGGGGGTGGG + Intergenic
972224555 4:36997445-36997467 ATTTTTGTAGACATGGGGCCTGG + Intergenic
972319090 4:37956186-37956208 TTTTTTGTAGAGATGGGAGCGGG + Intronic
972425640 4:38930032-38930054 ATGTTTCTTTAGAAGGGGGGCGG - Intronic
972452310 4:39214365-39214387 CTGTGTGCAGAGATGGGGGGCGG - Intronic
972648430 4:40992348-40992370 TTTTTGGTAGAGATGGGGGGGGG + Intronic
972685467 4:41348469-41348491 GTTTTTGTAGAGATGGGTGGGGG + Intergenic
972698464 4:41470696-41470718 ATGTTTGAAGAGAAGAGGCGTGG - Intronic
972854483 4:43090328-43090350 ATGGTTGGAGAGAGGGGTGGGGG - Intergenic
972874727 4:43344170-43344192 TTTTTAGTAGAGACGGGGGGGGG + Intergenic
972910335 4:43808434-43808456 ATGAATGTAGAGAGGGAGGGAGG + Intergenic
973242650 4:47973242-47973264 ATTTTTGTAGAGATGGGGTGTGG + Intronic
973650034 4:52989830-52989852 ATGTAAGCAGAGATGGTGGGAGG - Intronic
973932278 4:55805145-55805167 ATTTTTGTAATGATGGGGAGTGG + Intergenic
973950670 4:56010183-56010205 TTTTTAGTAGAGATGGGGGTGGG - Intronic
974034312 4:56804168-56804190 ATTTTTGTAGAGATGAGGCCTGG - Intergenic
974424886 4:61729046-61729068 ATATTTGTAGAGAGGGAGGGAGG + Intronic
975091710 4:70411718-70411740 TTTTTTGTAGAGATGGGGTCTGG - Intergenic
975177272 4:71302074-71302096 ATAATTGTAGAAATGGGGAGGGG + Intronic
975233103 4:71957828-71957850 ATGTGTGTTGGGTTGGGGGGTGG - Intergenic
975641091 4:76500984-76501006 TATTTTGTAGAGATGGGGGGTGG + Intronic
976583410 4:86767098-86767120 TTTCTTGTAGAGATTGGGGGCGG + Intronic
976614899 4:87066406-87066428 ATATTTATAGGGATGGGGGGCGG - Intronic
976670143 4:87643233-87643255 TTTTTTGTAGAGATGGGGGCTGG - Intergenic
977092033 4:92689666-92689688 ATGTTTCTAAAGATGGGGGTGGG - Intronic
978304044 4:107302722-107302744 AATTTTGTAGAGATGGGGTTTGG - Intergenic
979253909 4:118592365-118592387 TTTTTTCTAGAGATGGGGTGGGG + Intergenic
979335074 4:119453978-119454000 TTTTTTCTAGAGATGGGGTGGGG - Intergenic
979765449 4:124460138-124460160 ATGTTTGTAAACATGTGGCGTGG + Intergenic
981998844 4:151003611-151003633 TTGTTTGCAGAGAAGGGGCGGGG - Intronic
982438422 4:155403685-155403707 ATGTTTGAAAAAAAGGGGGGGGG + Intergenic
982696127 4:158603107-158603129 TTGTTTGTAGAGATGGCGGTGGG + Intronic
983040859 4:162924043-162924065 ATGTTTCCATAGATGGGGGTGGG - Intergenic
983506853 4:168562692-168562714 ATGTTTGAAGAGAGGGAAGGAGG + Intronic
983550469 4:169012114-169012136 TTTTCTGTAGAGATGGGGGTCGG - Intergenic
984005208 4:174297847-174297869 ATGTGTGTAGGGATAGGAGGCGG + Intronic
984251692 4:177343506-177343528 ATGTCTGTAGAGCTGGGGGCAGG + Intronic
984764061 4:183386021-183386043 TTTTTGGTAGAGATGGCGGGGGG - Intergenic
985729274 5:1538218-1538240 ATGGCTGTAGAGTTGGGGAGTGG - Intergenic
986335309 5:6750619-6750641 ATGTGTGTGGAGGTGGGTGGGGG + Intronic
986405819 5:7423928-7423950 TTGGCTGTAGAGATGGGGGTGGG - Intronic
987327820 5:16828439-16828461 TTTTTAGTAGAGACGGGGGGTGG - Intronic
989627949 5:43450169-43450191 TTTTTTGTAGAGATGGGGTCTGG + Intronic
990039502 5:51362118-51362140 TTTTTTGTAGAGATGGCAGGGGG - Intergenic
990262189 5:54034838-54034860 TTTTTTTTAGAGACGGGGGGCGG + Intronic
990417047 5:55596691-55596713 TTTTTAGTAGAGATGGGCGGGGG + Intergenic
990523568 5:56603492-56603514 GTGTTTGAAGAGATTGGGCGCGG + Intronic
990533519 5:56697409-56697431 TTTTTAGTAGAGATGGGGGGGGG - Intergenic
991046080 5:62224154-62224176 ATGTTTATAGGGATGGAGGAAGG + Intergenic
991065451 5:62419814-62419836 CTTTTTGTAGAGATGGGGTCTGG - Intronic
991349397 5:65705268-65705290 CTTTTTGTTGAGATGAGGGGGGG - Intronic
991573138 5:68076420-68076442 AGGTTTATAGGAATGGGGGGAGG - Intergenic
991706950 5:69367720-69367742 ATTTTTGTAGAGACGGGGTTTGG + Intronic
991771475 5:70044977-70044999 TTTTTAGTAGAGATGGGGTGGGG + Intergenic
991850766 5:70920395-70920417 TTTTTAGTAGAGATGGGGTGGGG + Intergenic
992252979 5:74894149-74894171 TTTTTAGTAGAGATGGGGGTTGG + Intergenic
992299598 5:75364588-75364610 ATTTTTCTACAGATGGGGTGGGG + Intergenic
992624852 5:78627639-78627661 ATGTTTGCAGAGAGGGAGTGAGG - Intronic
992756227 5:79908985-79909007 ATTTTTGTAGAGATTGGGGTGGG + Intergenic
992861607 5:80916564-80916586 TTGGTGGTAGAGATGGGGAGGGG - Intergenic
993469105 5:88285331-88285353 TTTTTTGTACAGATGGGGGGAGG - Intergenic
993574120 5:89580413-89580435 ATTTTTGTAGAGGTGGAGGTGGG + Intergenic
994079287 5:95688427-95688449 ATTTTTATAGAGATGGGGTCTGG + Intronic
994329462 5:98488612-98488634 ATTTTTATACAGATGGGGGTGGG + Intergenic
994422524 5:99539168-99539190 TTGTTTGTAGAGATGTGGTGTGG + Intergenic
994459849 5:100058335-100058357 TTGTTTGTAGAGATGTGGTGTGG - Intergenic
994714508 5:103305621-103305643 GGGTTTGTAGAGGTGGGGTGGGG + Intergenic
995015764 5:107306906-107306928 ACGTTGGCAGAGATGGAGGGAGG + Intergenic
995197851 5:109393620-109393642 ATTTTTTTAGAGATGGGGTCTGG - Intronic
995495801 5:112741706-112741728 AAATTTCTAGAGATGGGTGGTGG - Intronic
995553927 5:113308475-113308497 AGGTTTTTAGAGATGGGGATGGG - Intronic
995948848 5:117684896-117684918 ATGCTTGTAGAAATGGGGCTGGG + Intergenic
996338432 5:122410465-122410487 ATGTTCATAAAGATGGGGGCAGG + Intronic
996506654 5:124275577-124275599 TTTTTTGTGGAGATGGGGGCTGG - Intergenic
996559836 5:124816821-124816843 CTTTTTGTAGAGATAGGGGGTGG - Intergenic
997493835 5:134303670-134303692 TTTTTAGTAGAGACGGGGGGGGG - Intronic
997711496 5:136008512-136008534 ATGTTTGGACACATGGGGAGAGG + Intergenic
998013558 5:138714619-138714641 TTTTTTGAAGAGATGGGGGGGGG + Intronic
998154637 5:139777704-139777726 ATTTTTGTAGAGATGAGGTCTGG - Intergenic
998257860 5:140602584-140602606 ATTTTTGTAGAGATGGGGTTTGG - Intergenic
999128354 5:149263752-149263774 TTTTTTGTAGAGATGAGGGGGGG + Intergenic
999173013 5:149611269-149611291 AGGCTTGTAGAGATTGGGGGAGG + Intronic
999749120 5:154613501-154613523 TTTTTTGTAGAGATGGGACGGGG - Intergenic
1000062005 5:157666335-157666357 ATTTTTGTAGAGATAGGGTCTGG + Intronic
1000245327 5:159444255-159444277 TTATTTGTAGAGATGGGGGTGGG - Intergenic
1000405406 5:160882457-160882479 TTTTTTGTAGAGATGGGGTCTGG + Intergenic
1000546112 5:162604822-162604844 ATGTATGTAGAGCTGGAGGCTGG + Intergenic
1000727755 5:164792855-164792877 TTTTTTGTAGAGGTTGGGGGTGG - Intergenic
1000935359 5:167299472-167299494 ATGTGTGTAGGGAAGGGAGGGGG + Intronic
1001004098 5:168034563-168034585 TTTTTAGTAGAGATGGCGGGGGG - Intronic
1001013062 5:168115902-168115924 ATGTCTGTAGAGGTGTGGGAAGG + Intronic
1001644796 5:173272019-173272041 TTTTTTGTAGAGATGGGGGTGGG + Intergenic
1001728008 5:173924086-173924108 ATGTTTCTACAGATGGAGGAAGG - Intronic
1001735018 5:173990288-173990310 TCTTTTGTAGACATGGGGGGCGG + Intronic
1001806806 5:174593490-174593512 ATGTTGGTAGAACTGGGAGGTGG - Intergenic
1002283127 5:178144848-178144870 TTTTTTGTAGAGATGGGAGCAGG - Intronic
1002684800 5:181001487-181001509 ATATTTTTATAGATGGGGGGGGG + Intronic
1004395208 6:15241829-15241851 ATGTTTGTAGAGATGGTGTCTGG + Intergenic
1004675931 6:17842226-17842248 TTTTTTGTAGAGATGGGGTCTGG + Intronic
1005348119 6:24910173-24910195 GTGTCTGGAAAGATGGGGGGAGG - Intronic
1005518581 6:26577953-26577975 ATTTTTGGAGAGACGAGGGGTGG + Intergenic
1005580334 6:27228197-27228219 TTTTTAGTAGAGATGGGGGGGGG - Intergenic
1005603343 6:27449573-27449595 ATTTCTGTAGAGATGGGGTCTGG - Intergenic
1005652981 6:27901952-27901974 TTTTTTGGAGAGATGTGGGGTGG - Intergenic
1006468831 6:34214082-34214104 TTTTTTGTAGAGATGGGGGAAGG - Intergenic
1006549689 6:34811679-34811701 TTTTTAGTAGAGATGCGGGGGGG - Intronic
1006680003 6:35790102-35790124 ATTTTTGTAGAGATGGGGAGGGG + Intronic
1006805797 6:36788209-36788231 TTTTTTGTAGAGATGGTCGGGGG + Intronic
1007147260 6:39648199-39648221 TTTTTAGTAGAGACGGGGGGCGG + Intronic
1007477261 6:42127130-42127152 TTTTTTGTAGAGATGGGGTTGGG + Intronic
1007539080 6:42624321-42624343 GTGTTTGTTGAGTTGGTGGGGGG + Intronic
1008001515 6:46365163-46365185 ATTTTTCTACAGATGGGGTGAGG - Intronic
1008512489 6:52289691-52289713 TTTTTTGTAGAGATGGGGTCTGG + Intergenic
1008626143 6:53318559-53318581 GTTTTTGTAGAGATGGGGCGGGG - Intronic
1008648592 6:53541599-53541621 ATGTTAGTAGGGTGGGGGGGCGG + Intronic
1009771799 6:68153100-68153122 AAGGTTCTTGAGATGGGGGGAGG - Intergenic
1010123977 6:72411713-72411735 TTTTTTTTAGAGATGGGGGTCGG + Intergenic
1010360243 6:74985212-74985234 ATGTGTATAGTGATGGGGAGAGG + Intergenic
1010665492 6:78625257-78625279 ATGGTTGTGGTGGTGGGGGGAGG - Intergenic
1012467612 6:99532981-99533003 ATTTTAGTAGAGACGGGGGGTGG - Intergenic
1012562468 6:100600176-100600198 ATGTGTGTATAGATGGGAGTTGG - Intronic
1012673270 6:102083856-102083878 CTTTTAGTAGAGATGGCGGGGGG + Intergenic
1012994970 6:105964034-105964056 ATTTTCCTAGAGATGGGGGGCGG + Intergenic
1013328229 6:109069723-109069745 TTTTTTGTTGAGATGGTGGGAGG + Intronic
1013562021 6:111315025-111315047 ATTTTTGTAGAGATGGGGTCTGG + Intronic
1014382260 6:120757141-120757163 AAAGGTGTAGAGATGGGGGGGGG - Intergenic
1014552660 6:122807068-122807090 CCTATTGTAGAGATGGGGGGGGG + Intronic
1014734716 6:125078877-125078899 CTATTTGTGGAGATGGGGGAGGG - Intronic
1015146793 6:129996019-129996041 TTTTTAGTAGAGATGGGGGGGGG + Intergenic
1015370747 6:132449299-132449321 TTTTTTGTAGAGATGGAGTGGGG + Exonic
1015771408 6:136772085-136772107 TTTTTAGTAGAAATGGGGGGGGG + Intronic
1015792989 6:136982541-136982563 TTTTTTGTAGAGATGGGGATGGG - Intergenic
1015933693 6:138387196-138387218 ATTTTTGTAGAGATGGTGGGGGG - Intergenic
1016286843 6:142483232-142483254 ATGTTTATAGAGAGGGTGTGAGG + Intergenic
1016434995 6:144027039-144027061 GTTTTTGTAGAGTCGGGGGGTGG - Intronic
1016947309 6:149546666-149546688 TTTTTTGTAGAGATGGCGGTCGG + Intergenic
1017107183 6:150898751-150898773 ATGTGTATGTAGATGGGGGGTGG - Intronic
1018307274 6:162470928-162470950 TTTTTAGTAGAGATGGGGTGGGG + Intronic
1018464955 6:164035477-164035499 TTTTTTGCAGAGATGGGGGAGGG + Intergenic
1018971675 6:168534072-168534094 TTTTTTGTAGAGATGGTGGGGGG - Intronic
1019672074 7:2285853-2285875 TTTTTTGTAGATATGCGGGGGGG + Intronic
1019681625 7:2353766-2353788 ATTTTCGTAGAGATGAGGGCTGG + Intronic
1019750131 7:2724082-2724104 TTTTTAGTAGAGATGGGGAGTGG + Intronic
1019869324 7:3744236-3744258 GTAATTGGAGAGATGGGGGGAGG - Intronic
1019887942 7:3921786-3921808 ATTTTTATAGAGATGGGGTCTGG - Intronic
1019985119 7:4650072-4650094 ATTTTTGTAGAGATTGGGGTGGG + Intergenic
1020066037 7:5189437-5189459 TTTTTTGTAGAGATGGGGTGGGG - Intergenic
1020113111 7:5458981-5459003 TTTTTTGTAGAGATGGGCTGTGG - Intronic
1020174450 7:5871174-5871196 TTTTTTGTAGAGACGGGGGGGGG - Intergenic
1020253080 7:6484584-6484606 ATTTTTGTAGAGACGGGGGGTGG - Intergenic
1020535388 7:9389820-9389842 GGGGGTGTAGAGATGGGGGGTGG + Intergenic
1020580487 7:9993065-9993087 ATTTTTGTAGAGTTGGGGGGGGG - Intergenic
1021711479 7:23420286-23420308 ATTTTTGTAGAGATGGGGTTTGG - Intronic
1023710401 7:42986492-42986514 ATGTGTGTGGAGAGGGGGTGGGG - Intergenic
1024068980 7:45769710-45769732 TTTTTTCTAGAGATAGGGGGAGG + Intergenic
1024883789 7:54118428-54118450 ATTATTGTAGAGATGGGGTGGGG - Intergenic
1025099063 7:56120765-56120787 TTTTTGGTAGAGATGGGGGCGGG - Intergenic
1026083592 7:67243587-67243609 TTTTTGGTAGAGATGGCGGGGGG + Intergenic
1026191607 7:68133580-68133602 TTTTTTGTAGAGATGGGGGGGGG - Intergenic
1026326877 7:69318114-69318136 TTTTCTGTAGAGATGGGGGTGGG + Intergenic
1026346141 7:69475852-69475874 TTTGTTGTGGAGATGGGGGGTGG - Intergenic
1026546840 7:71330572-71330594 TTTTTTGTAGAGATGGTGTGGGG + Intronic
1026693450 7:72570460-72570482 TTTTTAGTAGAGATGGGGGGAGG - Intronic
1026823220 7:73563887-73563909 TTTTTTTTAGAGATGGGGGGGGG + Intergenic
1026908721 7:74079987-74080009 TCTTTTGTAGAGATGGGGGGGGG - Intergenic
1026920384 7:74151212-74151234 TTTTCTGTAGAGATGGGGGATGG - Intergenic
1027183953 7:75958811-75958833 TTTATTGTAGAGATGGCGGGGGG - Intronic
1027197557 7:76041163-76041185 TTTTTTTTGGAGATGGGGGGAGG - Intronic
1027212628 7:76163551-76163573 TTTTTGGTAGAGATGGGGGTGGG - Intergenic
1027247851 7:76379563-76379585 TTTTTTGTAGAGATTGGGCGAGG + Intergenic
1027597963 7:80200144-80200166 TTTTTTGTAGAGATGGTGGGGGG - Intronic
1028094690 7:86745391-86745413 ATGTTTCTAGATTTGGAGGGTGG - Intronic
1028287675 7:89023148-89023170 ATATTTGAATAGATGGGTGGTGG + Intronic
1028707457 7:93866658-93866680 TTTTTTGTAGAGATGGGGTCTGG + Intronic
1029084301 7:97999179-97999201 TTTTTTGTAGAGACGGGGAGGGG + Intergenic
1029122487 7:98278273-98278295 TTTTCTGTAGAGATGGGCGGGGG + Intronic
1029140085 7:98403009-98403031 TTTTTTGCAGAGATGGGGGTGGG - Intergenic
1029199235 7:98827495-98827517 TTTTTTGTAGAGATGGGTGGGGG - Intergenic
1029253245 7:99251795-99251817 TTTTTTATAGAGATGGCGGGTGG - Intergenic
1029421760 7:100475685-100475707 CTGGTTGTGGAGCTGGGGGGAGG + Intronic
1029478245 7:100797947-100797969 GTTTTTGTAGAGATGGGGGCGGG + Intergenic
1029492710 7:100881119-100881141 TTTTTTGTAGGGATGGCGGGGGG + Intronic
1029521508 7:101065775-101065797 TTTTTAGTAGAGATGGTGGGGGG + Intergenic
1029523037 7:101076419-101076441 TCTTTTGTAGAGATGGGGGGGGG - Intergenic
1029529976 7:101118869-101118891 TTTTTTGTAGAGGTTGGGGGGGG + Intergenic
1029547992 7:101221399-101221421 TTTTTTGTAGAGATGGGGTTTGG + Intronic
1029598903 7:101552435-101552457 ATTTTTATAGAGATGGGGGTGGG - Intronic
1030051949 7:105545979-105546001 TTTTTAGTAGAGATGGGGGATGG + Intronic
1030272197 7:107681933-107681955 TTTTTTGTAGAGATTGGGGCGGG - Intronic
1031046089 7:116889549-116889571 TTTTTGGTAGAGATGGGGAGGGG - Intronic
1031166236 7:118230473-118230495 GTGGTTTTAGATATGGGGGGAGG + Intronic
1032062631 7:128737716-128737738 TTTTTTGTAGAGATAGGGGGAGG + Intergenic
1032126483 7:129198127-129198149 TTTTTTGTAGAGATGGGGTTTGG + Intronic
1032219595 7:129983971-129983993 ATCTTTCTAGAGATGGGGTTTGG - Intergenic
1032269412 7:130389875-130389897 TTTTTTGTGGAGGTGGGGGGGGG - Intergenic
1033089882 7:138375798-138375820 TTTTTTGTAGAGATGGGGTCTGG - Intergenic
1033167885 7:139057176-139057198 ATGTTTCTAGAGATGGGGAGGGG - Intronic
1033282274 7:140014734-140014756 TTTTTAGTAGAGACGGGGGGTGG - Intronic
1033328565 7:140398962-140398984 TTTTTTGTAGAGATGGGGTCTGG - Intronic
1033360160 7:140633339-140633361 ATTTTTATAGAGATGGGGTTTGG + Intronic
1033386106 7:140877280-140877302 TTTTTTTAAGAGATGGGGGGGGG + Intronic
1034082829 7:148296367-148296389 ATTTTAGTAGAGATGGTGGGCGG - Intronic
1034286803 7:149889677-149889699 TTTTTTGTGGAGATGGGGTGGGG - Intergenic
1034559468 7:151870840-151870862 ACGTTTGCAGAGATGGGGCTGGG - Intronic
1034606228 7:152318444-152318466 TTTTTAGTAGAGATGGGGAGGGG - Intronic
1034655068 7:152722653-152722675 TTGTTTGTAGAGATGGGGTCTGG + Intergenic
1034708556 7:153170546-153170568 CTTTGTGTAGAGATGGGGAGGGG + Intergenic
1035166193 7:156991536-156991558 ATTTTTGTGTAGATGCGGGGCGG - Intergenic
1035291630 7:157842983-157843005 ATGACTTTAGAGATGGGAGGAGG - Intronic
1035461888 7:159044941-159044963 CTTTTAGTAGAGATGGGGTGGGG + Intronic
1036378858 8:8223451-8223473 ATTTTTGTAGAGATGGCAGGTGG - Intergenic
1036702668 8:11023439-11023461 TTTTTTGTAGAGATGGGGTCTGG + Intronic
1036824030 8:11962468-11962490 TTTTTTATAGAGATGGGGGGAGG - Intergenic
1036850706 8:12199151-12199173 ATTTTTGTAGAGATGGCAGGTGG + Intergenic
1036872071 8:12441416-12441438 ATTTTTGTAGAGATGGCAGGTGG + Intergenic
1037389589 8:18379847-18379869 ATGCCTTTAGTGATGGGGGGTGG + Intergenic
1037579770 8:20237501-20237523 ATGTGTGTATACATGGGGGTAGG - Intergenic
1037579788 8:20237786-20237808 ATGTGTGTATACATGGGGGTAGG - Intergenic
1038136989 8:24796969-24796991 ATGTTTGCAGAGATGGAGTGTGG - Intergenic
1038403011 8:27299778-27299800 ATGTTTGGAGAGCTTGGGAGAGG + Intronic
1038427464 8:27473527-27473549 TTTTTTGTAGAGACGGCGGGGGG - Intronic
1038435519 8:27532933-27532955 ATTTTTGTAGAGACGGGGTCTGG - Intronic
1038642581 8:29339832-29339854 TTTTTGGTAGAGATGGGGGGGGG - Intronic
1038976988 8:32709591-32709613 TTATTTGTAGAGATGGGGTCTGG + Intronic
1039465008 8:37778784-37778806 TTTTTTGTAGAGACGGGGGGTGG - Exonic
1039466987 8:37791623-37791645 TTTTTAGTAGAGATGGGGGGTGG + Intronic
1039708644 8:40033293-40033315 AATTTAGTAGAGATGCGGGGGGG + Intergenic
1041089724 8:54290893-54290915 TTGTTAGTAGAGATGGGGTTTGG + Intergenic
1041246040 8:55889378-55889400 TTTTTTGTAGAGATGGGGTTTGG + Intronic
1042164470 8:65932286-65932308 ATGTTTTTAAAAATGGGGGGAGG + Intergenic
1042208330 8:66351523-66351545 ATGCTTGTATATATGGGGGGAGG - Intergenic
1042552642 8:70007915-70007937 TTTTTTGTAGAGATGGGGTCTGG - Intergenic
1042654972 8:71085857-71085879 ATGTCTGAAGACATGGGGGCAGG + Intergenic
1042874255 8:73426110-73426132 CAGTTTGTAGACATGGGGAGAGG - Intronic
1043409255 8:79975114-79975136 TTTTCTGTAGAGATGGGGTGGGG - Intronic
1044683271 8:94802792-94802814 ACTTTTTTAGAGATGGCGGGGGG + Intergenic
1044983938 8:97741729-97741751 TTTTTAGTAGAGACGGGGGGGGG - Intergenic
1045038843 8:98201394-98201416 ATTTTTTTAGAGATGGGGTCCGG + Intronic
1045446728 8:102273814-102273836 ATGTTTGGGGAGGTGGGAGGAGG + Intronic
1045447057 8:102277555-102277577 ATTTTAGTAGAGATGGGGTTTGG + Intronic
1046605232 8:116364367-116364389 TTTTTTGTAGAGATGGGGTCTGG - Intergenic
1047042900 8:121017683-121017705 ATGTTTGTTTAGAGAGGGGGAGG + Intergenic
1047085676 8:121512857-121512879 ATGTTTTTAAAGTTGGTGGGAGG - Intergenic
1047192269 8:122688979-122689001 TTTTTTTTGGAGATGGGGGGTGG - Intergenic
1047211744 8:122846134-122846156 ATGTTGGCAGAGAGGGGAGGAGG + Intronic
1047272244 8:123373207-123373229 TTTTTTGTAGAGATGGGGCGGGG + Intronic
1047415644 8:124662695-124662717 ATATTTGTAAATATTGGGGGAGG + Intronic
1047434918 8:124828270-124828292 GTTTTTGTAGAGATGGGTGGGGG + Intergenic
1047451264 8:124967027-124967049 ATGTCTGAAAAGATGGGGTGGGG - Intergenic
1047683308 8:127277200-127277222 GTGTGTGTTGAGATGGTGGGGGG + Intergenic
1047710670 8:127548965-127548987 AGGGTTATAGAGATGGGGGAAGG - Intergenic
1047735852 8:127764470-127764492 ATTTTTGTAGAGATGGGATCTGG - Intergenic
1047738794 8:127790338-127790360 TTTTTTGTAGAGATGGGGTTTGG + Intergenic
1048166905 8:132069998-132070020 ATGTTCGTACTGACGGGGGGGGG + Exonic
1048254190 8:132893374-132893396 ATGTGTGTAGTGTGGGGGGGTGG + Intronic
1048481666 8:134801586-134801608 ATGGTTGTAGAGTGGGGTGGCGG - Intergenic
1048562808 8:135560036-135560058 ATTTTTGCAGAGATGGGGTCTGG - Intronic
1048833789 8:138499385-138499407 TTTTTTGTAGAGATGGGGTCTGG + Intergenic
1049529508 8:143147356-143147378 GTGTTTGGAGAGAAGGGGGATGG + Intergenic
1049529520 8:143147406-143147428 GTGTTTGGAGAGAAGGGGGATGG + Intergenic
1050173502 9:2846569-2846591 ATTTTTGTAGAGATGGGGTTTGG - Intergenic
1050228110 9:3484916-3484938 CTTTCTGTAGAGATGGGGTGGGG - Intronic
1050244883 9:3678375-3678397 ATATTTTCAGAGATGGGGGGAGG + Intergenic
1050454643 9:5822074-5822096 TTTTTTGTAGAGATGGGGTTTGG - Intronic
1050719384 9:8568322-8568344 CTGTTAGTAGAGAGGGAGGGAGG - Intronic
1051195390 9:14558365-14558387 GTATTTGTAGAGATGGAAGGTGG + Intergenic
1051330858 9:16023838-16023860 ATCTTTGTGGGGGTGGGGGGAGG - Intronic
1052292873 9:26864347-26864369 ATATTTCTAAATATGGGGGGTGG + Intronic
1053186150 9:36018125-36018147 GTTTTTGTAGAGATGGAGTGGGG - Intergenic
1053198012 9:36135260-36135282 TTGTTTATAGAGATGGGAGGGGG + Intergenic
1055280240 9:74665962-74665984 CTTTTTGTAGAGATGGGGTTTGG - Intronic
1055709574 9:79045394-79045416 CTGCCTGTAGAGATGGGGGTTGG - Intergenic
1056109452 9:83380359-83380381 ATCTTGGTGGAGATGGTGGGAGG + Intronic
1057396840 9:94688316-94688338 ATTTTTGTAGAGATGGGGTCTGG - Intergenic
1057741149 9:97712320-97712342 TTTTTTGTAGAGATGGGTTGGGG - Intergenic
1057782098 9:98058092-98058114 TTTTTTGTAGAGATGGGGTTTGG + Intronic
1058038915 9:100283137-100283159 TTTTTTGTAGAGATGGGGAGGGG - Intronic
1058506753 9:105674189-105674211 ATGGTTGTAGATATGGGAAGGGG + Intergenic
1058891129 9:109361704-109361726 TTTTTTGTAGAGATGGGGTGTGG - Intergenic
1059204376 9:112450256-112450278 CTATTGGTAGAGATGGGGGGGGG - Intronic
1059308876 9:113375039-113375061 CTTTTTGTAGAGATGTGGGGTGG + Intronic
1060342613 9:122790265-122790287 TTTTTTGTAGAGATGGTGGGGGG - Intergenic
1060901228 9:127259862-127259884 TTTTTTGTAGAGATGGGCGGGGG - Intronic
1060943115 9:127554736-127554758 TTTTTAGTAGAGACGGGGGGTGG + Intronic
1060950203 9:127596797-127596819 TTTTTTGTAGAGATGTTGGGGGG + Intergenic
1061123486 9:128658899-128658921 GTTTTTGTAGAGATGGGGGCAGG + Intergenic
1061197777 9:129117222-129117244 TTTTTTGTAGAGATGGGGTTTGG + Intronic
1061282178 9:129603731-129603753 TTTTTTAAAGAGATGGGGGGGGG + Intergenic
1061328371 9:129877688-129877710 TTCTTTTTCGAGATGGGGGGTGG - Intronic
1061494546 9:130964504-130964526 ATTTTTGTAGAGATTGGGGTGGG + Intergenic
1061675820 9:132215063-132215085 TTTTTTGTAGAGATTGGGGGGGG + Intronic
1061692433 9:132344387-132344409 TTTTTTGTAGAGATGGGGGAGGG + Intronic
1061712856 9:132499557-132499579 ATGTTTGGAGGGAGAGGGGGCGG - Exonic
1061723612 9:132569227-132569249 TTTTTTGTAGAGATGGGGGGAGG - Intronic
1061770357 9:132915000-132915022 GTTGTTGTAGAGATGGGGTGTGG - Intronic
1061963353 9:133999082-133999104 ATGGATGGAGAGATGGGTGGAGG - Intergenic
1062240554 9:135535394-135535416 TTTTTAATAGAGATGGGGGGGGG + Intergenic
1062411518 9:136427783-136427805 TTTTTAGTAGAGATGGGGGGGGG + Intergenic
1062587888 9:137257980-137258002 ATTTTTGTAGAGGTGGGGTCTGG + Intronic
1203730863 Un_GL000216v2:88307-88329 ATTTTTTTAGAGATGGGGGCAGG - Intergenic
1185454435 X:301450-301472 TTTTTTGTAGAGATGGGGTCTGG + Exonic
1185554775 X:1011859-1011881 TTTTTTGTAGAGATGTGGCGGGG + Intergenic
1185645731 X:1614382-1614404 TTCTTTGTAGAGATCGGGGTGGG - Intergenic
1185789014 X:2914405-2914427 TTTTTTGTAGAGATGGGGGGGGG + Intronic
1185808093 X:3078974-3078996 ATGTTTGTAGAGACGGAAAGTGG - Intronic
1185818157 X:3175711-3175733 TTTTTTGTAGAGATTGGGTGGGG + Intergenic
1186147267 X:6637366-6637388 TTATTTGTAGAGATGCGGGGGGG - Intergenic
1186151141 X:6675965-6675987 TGTTTTGTAGAGATGGGGGCAGG - Intergenic
1186173510 X:6902050-6902072 TTTTTTGTAAAGATGGCGGGGGG + Intergenic
1186631929 X:11358928-11358950 ATGTTTCTAGACATGGGTGGAGG - Intronic
1187056843 X:15748727-15748749 TTTTTTTTAGAGATGGGGGTTGG - Intronic
1187163112 X:16782371-16782393 ATATTTGTAGAAATGGTAGGAGG - Intergenic
1187414201 X:19078376-19078398 TTTTTTGTAGAGATGGAGGGGGG - Intronic
1187860592 X:23678755-23678777 TTTTTTGTAGAGATGGGGTGTGG - Intronic
1187904912 X:24056678-24056700 TTTTTTGTAGAGATGGGGTTTGG - Intronic
1188985107 X:36762120-36762142 ATGTGTGTGGAGGTGGGGGTAGG - Intergenic
1189018898 X:37313926-37313948 AGGTTGGTAGAGATGGGAGCTGG + Intergenic
1189114848 X:38331757-38331779 ATTTTTGTAGAGATGGGGTTTGG + Intronic
1189204122 X:39223021-39223043 ATGTTTGTAAGGATTGGGGTGGG - Intergenic
1189343139 X:40219778-40219800 TTTTTTGTAGAGATGGGGGAGGG + Intergenic
1189368331 X:40407372-40407394 TTTTTTGTAGAGATCGGGGCTGG + Intergenic
1189647375 X:43148129-43148151 ATGTATGTAGAGAAGGGATGGGG + Intergenic
1189787702 X:44573975-44573997 TTTTTGGTAGAGATTGGGGGTGG + Intergenic
1190039972 X:47063328-47063350 TTGTTTGAAGAGCTAGGGGGAGG - Intergenic
1190077258 X:47326485-47326507 ATTTTTGTAGAGATTGAAGGGGG - Intergenic
1190317474 X:49160527-49160549 ATTTTTGTAGAGACTGGGGTGGG - Intergenic
1190868394 X:54404348-54404370 ATTTTTGTAGAGATGGGGTCTGG - Intergenic
1190887990 X:54546030-54546052 ATTTTTGTAGAGATGGGGGGAGG + Intronic
1191686118 X:63892558-63892580 ATGTTTGCACTGATGGGGGTAGG - Intergenic
1192423481 X:71054420-71054442 GTGTGTGTAGAGATGGGGGAGGG - Intergenic
1192477232 X:71453392-71453414 TTGTTTGTAGAGATTGGGGGTGG - Intronic
1192859822 X:75055536-75055558 TTTTTGGTAGAGATGGGCGGGGG - Intronic
1193658216 X:84224410-84224432 TTTTTTGTAGAGATGGGGTCTGG + Intergenic
1193720766 X:84984500-84984522 TTTTTTGTAGAGATGGCAGGGGG - Intergenic
1194652950 X:96537444-96537466 TTTTTTGTAGAGATGGGGTTTGG - Intergenic
1194876563 X:99196302-99196324 ATATTTGTAAAGATGGGGCCTGG + Intergenic
1194971487 X:100348932-100348954 TTTTTGGTAGAGATGGTGGGGGG + Intronic
1195060532 X:101189932-101189954 TTGTTAGTAGAGACGGGGGGAGG + Intergenic
1195328354 X:103776327-103776349 GTGTTCGTAGAGCTGGGGGTGGG + Intronic
1195451606 X:105020149-105020171 TTTTTTGTAGAGATTGGTGGGGG + Intronic
1195465825 X:105177483-105177505 ATTTTTCTAGGGATTGGGGGAGG - Intronic
1196084027 X:111664703-111664725 TTTTTTGTAGAGATGGGGGGGGG - Intergenic
1197008182 X:121529375-121529397 ATTTTTCTACAGATGGGGGCAGG - Intergenic
1197041756 X:121944503-121944525 CAGTTTGTAAAGATGGGGAGAGG + Intergenic
1197446495 X:126556243-126556265 CTGTTTGTAGTGGTGGAGGGTGG + Intergenic
1197567861 X:128110996-128111018 ATGTTTGTGGGGGTGGGGGAGGG - Intergenic
1197999180 X:132413900-132413922 ATGTGTGCAGAGGTGAGGGGTGG + Intronic
1198495058 X:137183954-137183976 ATGTGTGTATAGAGGGGTGGTGG - Intergenic
1198724127 X:139658851-139658873 TTTTTTGTAGAGACGGGGTGGGG + Intronic
1199729008 X:150612518-150612540 TTTTTTGTAGAGATGGTGGGGGG - Intronic
1199734171 X:150668514-150668536 TTTTTTGTAGAGATGGAGGAGGG - Intronic
1200087958 X:153619317-153619339 TTTTTTGTACAGATTGGGGGGGG + Intergenic
1200180585 X:154148051-154148073 ATTTCTGTAGAGATGGGGTCTGG - Intronic
1200186413 X:154186446-154186468 ATTTCTGTAGAGATGGGGTCTGG - Intergenic
1200192065 X:154223584-154223606 ATTTCTGTAGAGATGGGGTCTGG - Intronic
1200197820 X:154261388-154261410 ATTTCTGTAGAGATGGGGTCTGG - Intronic
1200366172 X:155667090-155667112 ATCTTTGTAGAGAGATGGGGTGG + Intronic
1200396633 X:155993653-155993675 AGGATTGTGGAGATGGGTGGTGG + Intergenic
1200787206 Y:7271749-7271771 TTTTTGGTAGAGATGGGGGCTGG + Intergenic
1201711463 Y:16997521-16997543 ATGTTTGTAGAGAGGAAGGATGG + Intergenic