ID: 903814965

View in Genome Browser
Species Human (GRCh38)
Location 1:26058211-26058233
Sequence ATCAGTAAGAGGAAGGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 573
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 530}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903814958_903814965 -1 Left 903814958 1:26058189-26058211 CCTCTTATCTTATCATCATAAAA 0: 1
1: 0
2: 0
3: 29
4: 325
Right 903814965 1:26058211-26058233 ATCAGTAAGAGGAAGGTGGGGGG 0: 1
1: 0
2: 1
3: 41
4: 530

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903814965 Original CRISPR ATCAGTAAGAGGAAGGTGGG GGG Intronic
900426646 1:2583397-2583419 CTCAGTAGCATGAAGGTGGGAGG - Intergenic
901160607 1:7174078-7174100 CTCAGGGAGAGGGAGGTGGGAGG - Intronic
901973634 1:12927637-12927659 ACCAGTTAGATGAAGGTGGTGGG - Intronic
902011544 1:13274130-13274152 ACCAGTTAGATGAAGGTGGTGGG + Intergenic
902266371 1:15269467-15269489 ATCAGTAACAGAAAGATAGGTGG - Intronic
902620417 1:17647525-17647547 ATGAATAAAAGGAAGGAGGGAGG - Intronic
903814965 1:26058211-26058233 ATCAGTAAGAGGAAGGTGGGGGG + Intronic
904372190 1:30056726-30056748 AACAATAGTAGGAAGGTGGGAGG + Intergenic
905380762 1:37559871-37559893 CTCAGCAAGAGGAATGTGGCAGG + Intronic
905594250 1:39192210-39192232 TTCAGTCAGAGGCAGCTGGGAGG + Intronic
906124445 1:43418842-43418864 AGCAGCAGGAGGAGGGTGGGAGG + Intronic
906243657 1:44258025-44258047 CTCAGTATCAGGAAGGGGGGTGG - Intronic
906533822 1:46540162-46540184 ATGAGTAAGAGTGATGTGGGAGG - Intergenic
908495211 1:64688086-64688108 AGCAAGATGAGGAAGGTGGGAGG + Intronic
908854114 1:68405346-68405368 ATGAGTAAAAGGAAGGAGAGAGG + Intergenic
909581422 1:77240019-77240041 TTCAGTAATAGGAAGTTGAGGGG - Intergenic
910013478 1:82493725-82493747 ATCAGTAAAAGAAAGGTTAGAGG - Intergenic
910445176 1:87292595-87292617 ACAACTAAGAGAAAGGTGGGAGG + Intergenic
911121387 1:94300562-94300584 ATTAGTAAGAGGTATATGGGGGG - Intergenic
913061927 1:115216521-115216543 ATCAGTAAGAGAAAGGGGTTAGG - Intergenic
913074965 1:115334421-115334443 ATCAGAAAGAGTAAGGTGAAGGG - Intronic
913221802 1:116666475-116666497 ATCAGAAGGAGGGAGTTGGGGGG + Exonic
913582738 1:120243053-120243075 AGGAGAAAGAGGCAGGTGGGAGG - Intergenic
913625435 1:120655307-120655329 AGGAGAAAGAGGCAGGTGGGAGG + Intergenic
913688542 1:121256815-121256837 TTCAGTCAGGGGAAGGTGGGGGG + Intronic
913714706 1:121521633-121521655 ATCAATAAGATGAATGGGGGAGG + Intergenic
914040398 1:144044458-144044480 TTCAGTCAGGGGAAGGTGGGGGG + Intergenic
914149058 1:145023462-145023484 TTCAGTCAGGGGAAGGTGGGGGG - Intronic
914564668 1:148854547-148854569 AGGAGAAAGAGGCAGGTGGGAGG - Intronic
914608158 1:149275695-149275717 AGGAGAAAGAGGCAGGTGGGAGG + Intergenic
914684458 1:149965924-149965946 TTCAGAAATAGGAAGGTGGAAGG - Intronic
915832671 1:159145773-159145795 ATCTGTCAGAGGTGGGTGGGAGG - Intronic
916603617 1:166318691-166318713 ATCAGTAACAAAAAGATGGGTGG - Intergenic
916630789 1:166610230-166610252 CTCAGCAAGAGGAATGTGGCAGG + Intergenic
917452884 1:175161855-175161877 ATGAGGAAGAGGAAGGTAGAAGG - Intronic
919252026 1:195067832-195067854 AACAGTAGGGGGAAGGTTGGGGG + Intergenic
919310592 1:195901864-195901886 ATAATTAATAGGAAGGTGGCAGG + Intergenic
919812653 1:201418964-201418986 ATCAGAAGGTGGAGGGTGGGAGG + Intronic
920140932 1:203812270-203812292 ATCAGAAGGTAGAAGGTGGGAGG - Intronic
920475864 1:206275314-206275336 TTCAGTCAGGGGAAGGTGGGGGG + Intronic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
923400926 1:233614686-233614708 GCCAGTAAGGGGAAGGTCGGAGG - Intronic
923728603 1:236529166-236529188 ATGAGGAAGAGTGAGGTGGGAGG + Intronic
924328743 1:242921626-242921648 ATCAGGAAGAAGCAGGCGGGGGG - Intergenic
1063039766 10:2325225-2325247 AGCAGGCAGAGGAAGGTGGACGG + Intergenic
1063101320 10:2952661-2952683 GAAAGTAAGAGAAAGGTGGGAGG + Intergenic
1063170809 10:3508448-3508470 TTATGTAAGAGGGAGGTGGGAGG + Intergenic
1063343371 10:5289604-5289626 ATCAGTGGGTGGAGGGTGGGAGG + Intergenic
1064324377 10:14334797-14334819 ATCCTTTGGAGGAAGGTGGGAGG + Intronic
1064493436 10:15884152-15884174 ACCAGGAAGAGGAAGGTTAGTGG + Intergenic
1064642657 10:17430047-17430069 CTCAGAAAGGGGAAGATGGGAGG - Intronic
1065045180 10:21740960-21740982 ATCAGGAAAAGGAAGAAGGGAGG + Intronic
1065829347 10:29600284-29600306 ATCACAAAGGGGAAGGTTGGAGG + Intronic
1068835362 10:61546668-61546690 ATCGTTAAGAAGAAGGTGGCGGG - Intergenic
1068874580 10:61982720-61982742 AGCTGTTAGAGAAAGGTGGGAGG + Intronic
1068890556 10:62144389-62144411 ATCAGAAGGTGGAGGGTGGGGGG + Intergenic
1069718342 10:70534698-70534720 GCAAGTAAGAGGGAGGTGGGGGG - Intronic
1069887945 10:71635666-71635688 ATTGGAAAGAGGAAGGTGAGAGG + Intronic
1070053965 10:72916320-72916342 ATCAGAGAGTGGAAGGTAGGAGG - Intronic
1070158133 10:73848956-73848978 ATCAGGAAGAGGAGGAAGGGCGG + Intronic
1070269739 10:74941467-74941489 ATCAGTAACAGGAATGGGAGAGG + Intronic
1070497973 10:77041755-77041777 ATGGGTAAGAGGAAGATGAGAGG + Intronic
1070778658 10:79125033-79125055 AGCAGGAAGAGCAAGGTTGGAGG + Intronic
1070872295 10:79767021-79767043 ATCAGAAAAAGTAAGGTGGATGG + Intergenic
1071639215 10:87289192-87289214 ATCAGAAAAAGTAAGGTGGATGG + Intergenic
1071656022 10:87448757-87448779 ATCAGAAAAAGTAAGGTGGATGG - Intergenic
1073327494 10:102651094-102651116 AGCAGGAAGAGGAAGGAGGCTGG - Intronic
1073857018 10:107688256-107688278 ACCAGGAAAAGGAAGGAGGGAGG + Intergenic
1074147669 10:110730837-110730859 ATCAGGAAGAAGGAGGAGGGAGG + Intronic
1074328629 10:112479652-112479674 ATGAGTTACGGGAAGGTGGGGGG - Intronic
1074878066 10:117629978-117630000 AGCAGGCAGAGGAATGTGGGAGG - Intergenic
1075162482 10:120036669-120036691 ACAGGTAAGAGGAAGGTTGGGGG - Intergenic
1075500524 10:122969658-122969680 ATCAGAAGGTGGAAGGTGGGAGG + Intronic
1076329199 10:129652537-129652559 ATCACAAAGTTGAAGGTGGGAGG + Intronic
1077400046 11:2350646-2350668 ATGAGCAAGAGAGAGGTGGGGGG - Intergenic
1077698701 11:4419429-4419451 ATCAGAAAAAGGGTGGTGGGTGG + Intergenic
1077703215 11:4460666-4460688 CTCAGCAAGAGGAATGTGGCAGG + Intergenic
1079138753 11:17793537-17793559 AGAAGTAAGAGGAAGGAGAGTGG + Intronic
1079320506 11:19447945-19447967 AGGAGAGAGAGGAAGGTGGGAGG - Intronic
1079459243 11:20665575-20665597 ATGGGTTGGAGGAAGGTGGGAGG + Intergenic
1080384955 11:31805638-31805660 ACCACGAACAGGAAGGTGGGTGG + Intronic
1081086124 11:38803678-38803700 ATCAGAAATATGAAGGTGGGTGG + Intergenic
1081632698 11:44700628-44700650 CTCTGTAAGAGGATGGTAGGAGG + Intergenic
1081706642 11:45185906-45185928 CTTAATAAGAGGGAGGTGGGAGG + Intronic
1081845324 11:46237314-46237336 ATGAGTAAGAGGAAGCCGGTAGG + Intergenic
1082716320 11:56618518-56618540 CTCAGCAAGAGGAATGTGGTAGG + Intergenic
1082724551 11:56719460-56719482 CTCAGCAAGAGGAATGTGGTAGG - Intergenic
1083228398 11:61299505-61299527 TTCGGAAAGAAGAAGGTGGGAGG - Exonic
1083375471 11:62216720-62216742 CTCAGCAAGAGGAATGTGGTAGG - Intergenic
1083739327 11:64700134-64700156 AGAAGTAAGAGGAATGTGGAGGG - Intronic
1084040963 11:66542537-66542559 AGCAGAAAGAGGAAGATGGGTGG + Intronic
1084358092 11:68652628-68652650 ATCAGTGAGTGGAAGCTGGGGGG + Intergenic
1084644779 11:70449592-70449614 GTCACTCAGAGGAAGGAGGGTGG + Intergenic
1084908044 11:72363912-72363934 TTCAGTGAGAGGAAGCTGAGAGG - Intronic
1086038549 11:82446001-82446023 ATCTGTAGGAGGAAAGTGGATGG + Intergenic
1086849468 11:91792527-91792549 ATCAGTAAAAGGAAATTAGGAGG + Intergenic
1087378382 11:97372345-97372367 ACCAGGAAGTGGAGGGTGGGTGG + Intergenic
1088329835 11:108639865-108639887 AGAAGGAAGAGAAAGGTGGGTGG + Intergenic
1088371465 11:109092980-109093002 ATGAGTATGAGGGAGGTGGCGGG + Intergenic
1088534280 11:110843073-110843095 ATCAGAAGGTGGAGGGTGGGAGG - Intergenic
1089854784 11:121533684-121533706 AGCAGTAAGTGAGAGGTGGGTGG + Intronic
1090177915 11:124667953-124667975 ATCAGTAAGATAGAGGTGGTGGG - Intronic
1091184668 11:133636835-133636857 ATCTGTAAGAGGTGGGTGCGGGG + Intergenic
1091980665 12:4861365-4861387 CTCAGGAAGATGACGGTGGGAGG - Intergenic
1092540831 12:9419001-9419023 ATAAGTCTGAGGAAGGTGAGGGG - Intergenic
1092658933 12:10718299-10718321 ATGTGGAGGAGGAAGGTGGGTGG - Intronic
1093062571 12:14623042-14623064 ATCAGAAACTGGAAGCTGGGAGG + Intronic
1093517722 12:20010078-20010100 ACCAGTCAGCGGAATGTGGGCGG - Intergenic
1094078843 12:26510274-26510296 AGGAGTAAAAGGATGGTGGGTGG - Intronic
1094318532 12:29159236-29159258 ACCAATAAGAGTAAGATGGGAGG + Intronic
1095080717 12:37996332-37996354 CTCAGCAAGAGGAATGTGGTAGG - Intergenic
1095485482 12:42680115-42680137 CTCAGTAGGAGGCAGATGGGTGG + Intergenic
1095862694 12:46936173-46936195 TTAAATAAGAGGAATGTGGGGGG - Intergenic
1096463600 12:51836360-51836382 ATGAGGATGAGGATGGTGGGCGG - Intergenic
1096781826 12:53996227-53996249 ATCACTAAAAGGAAGGCGCGGGG + Intronic
1097079650 12:56420805-56420827 ATCGGGAAGAGGATGGTGAGTGG - Exonic
1097620955 12:61938900-61938922 CTCAGAAGGAGGAGGGTGGGAGG + Intronic
1098169688 12:67734421-67734443 ACTATTAAGAGGAAGGAGGGAGG - Intergenic
1099530150 12:83769052-83769074 ATCAGAAAGAGGAGAATGGGAGG + Intergenic
1099591945 12:84603476-84603498 ATCTGTAACAGGGAGCTGGGAGG + Intergenic
1099619604 12:84984469-84984491 CTCAGGAAGCTGAAGGTGGGAGG - Intergenic
1099638167 12:85243762-85243784 AAAAGTAGGAAGAAGGTGGGAGG + Intronic
1099734224 12:86547304-86547326 AGCAGGAAGAGGAAGGGGGGAGG - Intronic
1099808977 12:87556648-87556670 GTCAGTATGGGGAAGGTGGGAGG + Intergenic
1100976377 12:100126492-100126514 GTCAGTAATTGGATGGTGGGTGG - Intronic
1101869998 12:108558308-108558330 ATCAGGATGAGGTGGGTGGGAGG + Intronic
1102641983 12:114374863-114374885 ATCAATAAAAAGAAGGAGGGAGG + Intronic
1104255691 12:127135459-127135481 ATCAGAGGGTGGAAGGTGGGAGG + Intergenic
1104300662 12:127562318-127562340 ATTACTGCGAGGAAGGTGGGAGG - Intergenic
1105046409 12:133007541-133007563 GTGAGAAAGAGGAAGGTGGGAGG + Intronic
1105457135 13:20551424-20551446 ATGAGTAAGAGGAAGGGAGATGG + Intergenic
1105788998 13:23779386-23779408 ATCAGCTAGAAAAAGGTGGGAGG + Intronic
1105828333 13:24142647-24142669 ATGAGGAAGAGGAAAGGGGGAGG - Intronic
1108626049 13:52229780-52229802 CTGAGTTAGAGGAAGGTGTGTGG + Intergenic
1108644425 13:52412291-52412313 GTCAGTAAGTGGAAGGTGTTGGG - Intergenic
1108660014 13:52576699-52576721 CTGAGTTAGAGGAAGGTGTGTGG - Intergenic
1108813051 13:54253585-54253607 ATCAGAGGGTGGAAGGTGGGTGG + Intergenic
1109645781 13:65253044-65253066 ATCAGAGAGTGGATGGTGGGAGG - Intergenic
1111157008 13:84340967-84340989 ATCAGAGAGTGGAGGGTGGGAGG - Intergenic
1112235055 13:97628417-97628439 ATCAGAAGGTGGAGGGTGGGAGG + Intergenic
1112311070 13:98317975-98317997 ATGAGGAAGAGGAAGGAGAGAGG - Intronic
1112354254 13:98661014-98661036 TGCAGTAAGATGAAGGTGAGAGG - Intergenic
1113149464 13:107246050-107246072 ATGAGATAGAGGAGGGTGGGCGG - Intronic
1113428150 13:110227504-110227526 TTCACTAAGAGGCAGGTTGGGGG + Intronic
1113734052 13:112664479-112664501 AGAAAGAAGAGGAAGGTGGGTGG - Intronic
1113756200 13:112812644-112812666 AACAGTGAGAGCAAGGTGAGCGG - Intronic
1114273445 14:21119755-21119777 ACCAGTAAGAAGAATGTTGGGGG - Intergenic
1114754242 14:25240995-25241017 ATCAGGAAAAGAGAGGTGGGAGG - Intergenic
1115196234 14:30803011-30803033 CTATGGAAGAGGAAGGTGGGAGG - Intergenic
1115268936 14:31530063-31530085 ATCTGTAACAGGAAGGTGAGGGG - Intronic
1115294738 14:31812797-31812819 ATCAGAAGGAGGAAGCAGGGAGG + Intronic
1116023538 14:39489105-39489127 ATGTGTTAGAGGAAGGAGGGCGG - Intergenic
1116185337 14:41593204-41593226 ATCAGAGAGAGGAGGGTAGGAGG + Intergenic
1116960745 14:50965754-50965776 TGCAGTGAGAGGAAGGAGGGTGG - Intergenic
1118171983 14:63396335-63396357 AGGAGGAAGAGGAGGGTGGGAGG + Intronic
1118433560 14:65747746-65747768 CTCAGAAAGAGGAGGGTGGGAGG + Intergenic
1118475636 14:66114260-66114282 AGCAGTCAGAGGAATGTGGAAGG - Intergenic
1119492719 14:75050893-75050915 ATCAGTGAGAGCCACGTGGGTGG + Intronic
1119534136 14:75387001-75387023 ATCAGTAACAGAAAGGTGGCTGG + Intergenic
1119965872 14:78914897-78914919 AGCAATAAGGGGAAGGAGGGGGG + Intronic
1121004677 14:90482454-90482476 ATGAGAAAGAGGAAAGTGGGAGG - Intergenic
1121193984 14:92053793-92053815 ATCAGAAAGAGAAAGGAGGCTGG - Exonic
1121550100 14:94792841-94792863 AAGAGAAAGAGGAAGGAGGGAGG + Intergenic
1121616380 14:95316451-95316473 ATCAGACACAGGAAGGTGAGTGG + Intronic
1121918172 14:97855109-97855131 ATCAGGGAGAGAAAGGAGGGAGG + Intergenic
1121936705 14:98026308-98026330 ATGAGTGAGTGGATGGTGGGTGG + Intergenic
1122409706 14:101519639-101519661 ACCCGTAAGAGGAAGGAGGGCGG + Intergenic
1122580897 14:102770990-102771012 ATAAGCACGGGGAAGGTGGGAGG + Intergenic
1122879849 14:104685836-104685858 ATGGGTAAGTGGATGGTGGGTGG + Intergenic
1123795870 15:23769395-23769417 AGCAGGAAGAGGAACGTGGAAGG - Intergenic
1124920711 15:34023474-34023496 ATCATCAAGAGGAAGGTGAGAGG - Intronic
1127116277 15:55730884-55730906 ATAAGGAATAGGAAGCTGGGAGG - Intronic
1127999983 15:64181917-64181939 GTCATAAAGAGGAGGGTGGGAGG + Intronic
1129239113 15:74241215-74241237 CTCAGTCAGAGGAAGGAGAGGGG + Intronic
1130129078 15:81121861-81121883 TTCAGAAGGTGGAAGGTGGGAGG - Intronic
1130661356 15:85833722-85833744 AACAGGAAGGGGAAGGAGGGTGG + Intergenic
1131701280 15:94938757-94938779 AGCAGGCAGAGGAAGGTGGAAGG - Intergenic
1132174225 15:99696435-99696457 ATCAGTAACAGAAAGGTAGTAGG + Intronic
1132302405 15:100784180-100784202 ATCAGAAAGAGGCAGGCAGGAGG + Intergenic
1133313593 16:4867744-4867766 TGCAGTGAGAGGAAGGTGAGTGG + Intronic
1134495094 16:14726684-14726706 ATCAGAAAGAGGCTGGTGGTCGG - Intronic
1134500478 16:14765804-14765826 ATCAGAAAGAGGCTGGTGGTCGG - Intronic
1134527018 16:14952417-14952439 ATCAGAAAGAGGCTGGTGGTCGG - Intergenic
1134545386 16:15103933-15103955 ATCAGAAAGAGGCTGGTGGTCGG + Intronic
1134580103 16:15363246-15363268 ATCAGAAAGAGGCTGGTGGTCGG + Intergenic
1134714605 16:16350950-16350972 ATCAGAAAGAGGCTGGTGGTCGG - Intergenic
1134722480 16:16394314-16394336 ATCAGAAAGAGGCTGGTGGTCGG - Intergenic
1134944947 16:18317555-18317577 ATCAGAAAGAGGCTGGTGGTCGG + Intergenic
1134952211 16:18357708-18357730 ATCAGAAAGAGGCTGGTGGTCGG + Intergenic
1135067941 16:19326444-19326466 ATAGGTAAGATGTAGGTGGGTGG - Intergenic
1135218557 16:20593557-20593579 CTCAGAAGGAGGAAGGTGGGAGG - Intergenic
1135310553 16:21401771-21401793 ATCAGAAAGAGGCTGGTGGTCGG + Intergenic
1135448292 16:22536879-22536901 ATCAGAAAGAGGCTGGTGGTCGG - Intergenic
1135629368 16:24023780-24023802 ATGGGTAAGTGGAAGGTTGGGGG - Intronic
1135948587 16:26889837-26889859 CTCAGAAAGAGGAGGGTGGAAGG - Intergenic
1135964038 16:27021303-27021325 AGCAGTGAGAGGAAGGATGGGGG - Intergenic
1136150134 16:28342122-28342144 ATCAGAAAGAGGCTGGTGGTCGG + Intergenic
1136166370 16:28455937-28455959 ATCAGAAAGAGGCTGGTGGTCGG + Intergenic
1136196603 16:28659095-28659117 ATCAGAAAGAGGCTGGTGGTCGG - Intergenic
1136212943 16:28773220-28773242 ATCAGAAAGAGGCTGGTGGTCGG - Intergenic
1136257670 16:29053135-29053157 ATCAGAAAGAGGCTGGTGGTCGG - Intergenic
1137716237 16:50600040-50600062 ATAAGTAGGAAGACGGTGGGTGG - Intronic
1137889576 16:52144913-52144935 ATCAGGGAGTGGAGGGTGGGGGG + Intergenic
1138963682 16:62057853-62057875 ATCAAAAGGTGGAAGGTGGGAGG + Intergenic
1139077494 16:63470343-63470365 ATCAGAAGGTGGAGGGTGGGAGG + Intergenic
1139855428 16:69975923-69975945 ATCAGAAAGAGGCTGGTGGTCGG + Intergenic
1139885144 16:70203040-70203062 ATCAGAAAGAGGCTGGTGGTTGG + Intergenic
1139903739 16:70348292-70348314 AACAGGAATAGGAAAGTGGGAGG + Intronic
1140235042 16:73151440-73151462 ACCAGTCAGAGGCAGGTTGGAGG + Intergenic
1140551178 16:75867579-75867601 ACCAGAGAGTGGAAGGTGGGAGG - Intergenic
1140803492 16:78510506-78510528 ATCAGAAAGATGAAAGTGGCCGG - Intronic
1141663376 16:85453505-85453527 ATCAGGAGGAGGTCGGTGGGTGG + Intergenic
1143772638 17:9178450-9178472 ATTAGGAAGAGGAGGGAGGGAGG - Intronic
1145618856 17:25689534-25689556 ATCAGTAAGTGGACGTTTGGAGG + Intergenic
1145807456 17:27745082-27745104 CTCAGAGAGATGAAGGTGGGGGG + Intergenic
1146109624 17:30076449-30076471 ATTACTAAGAGAAAGGTGAGTGG + Intronic
1146621602 17:34402667-34402689 AGCTGTAAAAGGATGGTGGGGGG + Intergenic
1147504424 17:41001474-41001496 ATCAGAGGGTGGAAGGTGGGAGG + Intergenic
1147604420 17:41766141-41766163 ATCAGGAAGACTAAGATGGGAGG + Intronic
1148514629 17:48204944-48204966 AAAAGAAAGAGGAAGGAGGGAGG - Intronic
1149033900 17:52113703-52113725 TTCAGTAAGAGGAAGTAGGATGG - Intronic
1149525450 17:57351992-57352014 AACACTGAGAGGAAGGTGTGAGG + Intronic
1149573964 17:57698094-57698116 AAGAGTGACAGGAAGGTGGGAGG - Intergenic
1150919405 17:69467437-69467459 ATCAGGAGGGGGAAAGTGGGAGG + Intronic
1151028578 17:70708166-70708188 ATCAGAGAGTGGAGGGTGGGAGG + Intergenic
1151436018 17:74098019-74098041 ATCAGTCCGAGGGGGGTGGGGGG - Intergenic
1152313683 17:79567055-79567077 AACGGGAAGAGGAAGATGGGAGG - Intergenic
1152368919 17:79873019-79873041 ATTAGGAAGAGGAAGGAGGTCGG - Intergenic
1153175185 18:2363870-2363892 AGCAGTCAGAGGAACGTGGAAGG + Intergenic
1154083111 18:11277307-11277329 ATCAGTAGGAGAAAGTTGGTGGG - Intergenic
1154116852 18:11618892-11618914 ATCAGAAAGAGGCTGGTGGTCGG + Intergenic
1154530867 18:15343947-15343969 CTCAGCAAGAGGAATGTGGTAGG + Intergenic
1155574147 18:27226650-27226672 ATCGGCAAGAGGAAGGAGGTGGG - Intergenic
1156566106 18:38192874-38192896 ATCAGAAGGTGGAGGGTGGGAGG + Intergenic
1157941568 18:51934438-51934460 ATGGATAAGAGGGAGGTGGGAGG + Intergenic
1158031850 18:52975506-52975528 ATCAGAGGGTGGAAGGTGGGAGG - Intronic
1158371354 18:56809010-56809032 AACAGTAAAAGGGAAGTGGGAGG - Intronic
1158414172 18:57234660-57234682 ATGAGGAAAAGAAAGGTGGGAGG + Intergenic
1158900144 18:61954699-61954721 TTCAGCTAGAGGCAGGTGGGTGG + Intergenic
1159509313 18:69376066-69376088 CTCAGTTAAAGGAAGGAGGGTGG + Intergenic
1160246878 18:77166246-77166268 CTCTGTGGGAGGAAGGTGGGAGG - Intergenic
1161229405 19:3165545-3165567 AGAGGTAAGAGGAAGCTGGGTGG - Intergenic
1161619086 19:5289040-5289062 ATCAGGAATAGGGTGGTGGGAGG + Intronic
1161989036 19:7673500-7673522 ATGAGGAGGAGGAAGGAGGGAGG - Intergenic
1162374974 19:10299636-10299658 ATAAGTAGGAGGAAGGAGTGAGG - Intergenic
1162381001 19:10331944-10331966 ATCAGCAGGAGGAAATTGGGAGG - Intronic
1163995310 19:21040079-21040101 ATTTGGAAGATGAAGGTGGGAGG - Intronic
1164001905 19:21108180-21108202 ATTTGGAAGATGAAGGTGGGAGG - Intronic
1165073516 19:33268759-33268781 AACAGAAACAGGAAGCTGGGAGG - Intergenic
1167019510 19:46862946-46862968 AGCTCCAAGAGGAAGGTGGGGGG - Intergenic
1167039805 19:47016944-47016966 AACAGTAAGAAGAAGATGGCTGG + Intergenic
1167114079 19:47478884-47478906 TTCAGAAGCAGGAAGGTGGGAGG + Intronic
1167259706 19:48451393-48451415 CTCAGCAAGAGGAAGGGTGGCGG + Intronic
1167276521 19:48543445-48543467 ATGAGCAAGATGAGGGTGGGAGG + Intergenic
1167443185 19:49521776-49521798 TTCAGGAAGGGTAAGGTGGGAGG - Intronic
1167795032 19:51703453-51703475 ATCAGCAAGAGGAGGGTCGCGGG + Intergenic
925332882 2:3072313-3072335 TCAAGTCAGAGGAAGGTGGGTGG + Intergenic
925732701 2:6931737-6931759 ATCAGTAAGAGAAAGATAGATGG - Intronic
926036346 2:9638728-9638750 ATGACTAAGGGGAAGGAGGGCGG - Intergenic
929804979 2:45136989-45137011 ATCAGAGGGAGGAAGGTGGGAGG - Intergenic
932414560 2:71565763-71565785 ATCTGTAAAATGAGGGTGGGTGG + Intronic
932600280 2:73119379-73119401 CTCAGCAAGAGGAATGTGGTAGG + Intronic
933335428 2:80952181-80952203 ATCTGAAAGTGGAGGGTGGGAGG - Intergenic
933728995 2:85443230-85443252 GTAAGTACGAGGTAGGTGGGTGG - Intergenic
935501720 2:103849123-103849145 ATCAGAGGGTGGAAGGTGGGAGG + Intergenic
936061954 2:109300673-109300695 AGGAGGAAGAGGAAGGTGGTTGG - Intronic
936395561 2:112125630-112125652 AGGAGGAAGAGGAAGGAGGGAGG + Intergenic
936777948 2:115996517-115996539 TTCAGTAAGAGGAAGACAGGAGG - Intergenic
937305288 2:120867146-120867168 AAGAGGAAGAGGAAGCTGGGTGG - Intronic
937988324 2:127648603-127648625 ATCAGTAAGAGGAGAGGGGCTGG + Intronic
938682161 2:133703023-133703045 CTCTGGAGGAGGAAGGTGGGAGG + Intergenic
938977918 2:136496814-136496836 ACCAGTAAGAGGAAGGGAGAGGG + Intergenic
939124657 2:138163068-138163090 ATAATTAAGTGGAAGATGGGAGG + Intergenic
940197442 2:151111309-151111331 ATCAGTAAAAAGATTGTGGGTGG + Intergenic
940847476 2:158657178-158657200 CTGAGTAAGAGGAAAGTAGGTGG - Intronic
941640178 2:167978756-167978778 ATCAGGAAGAGGAAGATGGGAGG - Intronic
941978534 2:171431458-171431480 ATCAGTAAGAATTAGGTGTGTGG - Intronic
942395958 2:175549894-175549916 AACAGGAAGAGGAAGGGGAGAGG - Intergenic
943213047 2:184992858-184992880 ATCTGAAAAAGGAAGGTGGTAGG + Intergenic
943470783 2:188291950-188291972 ATTAGGAAGAGGAGGGAGGGGGG + Intronic
946305331 2:218853807-218853829 TTCAGGAAGAGGAAAGTGGGCGG - Intergenic
947624770 2:231612742-231612764 TTCAGTAAGAGGAAGGCTGGGGG - Intergenic
948178686 2:235963073-235963095 GTCTCTTAGAGGAAGGTGGGTGG + Intronic
1170058875 20:12238599-12238621 ATCAGAGGGCGGAAGGTGGGAGG + Intergenic
1171141747 20:22749526-22749548 AACAGTGAGAGAAAGGTGGAAGG + Intergenic
1171343782 20:24450685-24450707 ATTCCTCAGAGGAAGGTGGGTGG + Intergenic
1171577412 20:26346617-26346639 ATCTGTAAGAGGAAACTTGGAGG + Intergenic
1172106525 20:32520384-32520406 ATCATTAACAGGTATGTGGGTGG + Intronic
1172475854 20:35236995-35237017 ATCACTAAGAGCAAGTTGGTGGG + Intronic
1172574580 20:35998002-35998024 ATCAGTAACAGAAAGATAGGTGG - Intronic
1173080010 20:39856973-39856995 AAGAGGAAGAGGAAGATGGGAGG - Intergenic
1173185053 20:40834204-40834226 TTGAGTAAGAGGGAGGTGGACGG + Intergenic
1173571394 20:44078976-44078998 AGGAGTAAGAGGAAGCTGGAAGG - Intergenic
1173629029 20:44496174-44496196 ATACGTAAAAGGAAGGAGGGAGG + Intergenic
1173976456 20:47190290-47190312 ATGATTAATTGGAAGGTGGGTGG + Intergenic
1174870389 20:54175839-54175861 ATCACCAAGAGGAAAGTGGGGGG + Intergenic
1175076492 20:56379284-56379306 ATAAGTAAAAGGATGGTGGGCGG + Intronic
1175256624 20:57651963-57651985 AGGAGTGAGAGGAAGGCGGGGGG - Exonic
1175828862 20:61951178-61951200 CCCAGGAAAAGGAAGGTGGGGGG - Intergenic
1175895442 20:62333806-62333828 ATGAGCCAGAGGAAGGTGGCGGG + Intronic
1176142811 20:63552781-63552803 ATCAGAAAGACCCAGGTGGGAGG + Intronic
1176144490 20:63559518-63559540 GTCAGTCAGAGTCAGGTGGGAGG + Intronic
1176144516 20:63559619-63559641 GTCAGTCAGAGTCAGGTGGGAGG + Intronic
1176144557 20:63559778-63559800 GTCAGTCAGAGTCAGGTGGGAGG + Intronic
1176674051 21:9760642-9760664 CTTAGTAGGAGGAAGGAGGGGGG - Intergenic
1176766545 21:13024517-13024539 CTCAGCAAGAGGAATGTGGTAGG - Intergenic
1176984774 21:15422986-15423008 CTCAGAAAGAGGAGTGTGGGAGG + Intergenic
1177395953 21:20536507-20536529 ATCAGGCAGAGGAACGTGGGAGG - Intergenic
1177940848 21:27409855-27409877 AGCAGACAGAGGAAGGTGGAAGG - Intergenic
1178568461 21:33711505-33711527 ACCAGTAATAGGAAGATGGCAGG - Intronic
1179018025 21:37610675-37610697 ATCAGTAACAGAAAGGTAGCTGG + Exonic
1179490514 21:41738274-41738296 ATCACTCAGAGAAAGATGGGAGG + Intergenic
1180172898 21:46069713-46069735 ATCAGTAAGGAGACGGTGGGTGG - Intergenic
1180513667 22:16118965-16118987 CTCAGCAAGAGGAATGTGGTAGG - Intergenic
1181885105 22:26015646-26015668 ATCAGAAGGTGGAGGGTGGGAGG + Intronic
1183310962 22:37109331-37109353 ATCAGTGAGCAGAAGGTGAGGGG - Intronic
949219161 3:1608908-1608930 ATAAGAAAGAGGGAAGTGGGAGG + Intergenic
949996667 3:9622644-9622666 ATTAGTGAGAGGAAGGGAGGAGG + Intergenic
950852365 3:16074668-16074690 ATCAGAGGGTGGAAGGTGGGAGG + Intergenic
951240356 3:20279216-20279238 ATCAGTGAAAGGAGGGTAGGGGG + Intergenic
951576223 3:24116955-24116977 TTCATTAGGAGGAAGTTGGGAGG + Intergenic
951886736 3:27532047-27532069 CTCAGCAAGAGGAATGTGGTAGG - Intergenic
951973745 3:28479670-28479692 ATCAGAGGGTGGAAGGTGGGAGG - Intronic
952027450 3:29100061-29100083 AACAGGGAGGGGAAGGTGGGTGG - Intergenic
952080335 3:29750697-29750719 TTCAGAAGGTGGAAGGTGGGAGG - Intronic
952135984 3:30420299-30420321 AGAAGTAAGAGGAAACTGGGAGG + Intergenic
952196421 3:31080336-31080358 ATATGTAAGTGGGAGGTGGGTGG - Intergenic
952966922 3:38626812-38626834 ATCTGGTAGAGGAACGTGGGAGG + Intronic
953230263 3:41058369-41058391 AGGAGGAAGAGGAAGGAGGGAGG + Intergenic
953703706 3:45215624-45215646 AGCTGTAAGAGGAATGTGGATGG - Intergenic
954499501 3:50997719-50997741 ATCAAAAAGAGTGAGGTGGGTGG - Intronic
954687816 3:52380121-52380143 ACCAGTGAGAGTAAGGTGAGGGG + Exonic
954759155 3:52861539-52861561 ACAAAAAAGAGGAAGGTGGGGGG + Intronic
954993983 3:54865413-54865435 ATCAGTAGCGGGAAGGTGGGGGG - Intronic
955017657 3:55087816-55087838 ATCAGTAAGATGAGAATGGGAGG - Intergenic
955442684 3:58974254-58974276 ACTAGTAGGGGGAAGGTGGGAGG - Intronic
955510923 3:59679524-59679546 ATGAGTAAGAAGGAGGAGGGTGG + Intergenic
956045270 3:65189528-65189550 ACCAGTGAGAGCAAGGAGGGTGG - Intergenic
956411608 3:68985462-68985484 TTCAGTAAGAGGAAAGTTGAGGG - Intronic
956533529 3:70249490-70249512 ATCAGAAAGAGAAAGATGTGAGG - Intergenic
956689985 3:71867430-71867452 ATCAGTAACAGTAAGGTAGTTGG + Intergenic
956915896 3:73870434-73870456 ATCAGAGGGTGGAAGGTGGGAGG + Intergenic
956960867 3:74399289-74399311 GTCAGAAAGTGGAGGGTGGGAGG - Intronic
957912093 3:86633022-86633044 ATCAATAAAAATAAGGTGGGGGG + Intergenic
958019100 3:87977081-87977103 ATATGTAAGGGGATGGTGGGAGG - Intergenic
958661923 3:97079443-97079465 ATCAGAGGGTGGAAGGTGGGAGG + Intronic
958716474 3:97788896-97788918 AGCAGAGAGAGGTAGGTGGGTGG - Intronic
958727591 3:97924709-97924731 CCCTGTAAGAGGAAGGTAGGAGG - Intronic
958970516 3:100605710-100605732 ATCAATAGGATGAGGGTGGGGGG - Intergenic
959365919 3:105457397-105457419 ATTAGAAGGAGGAGGGTGGGAGG + Intronic
959967869 3:112376638-112376660 AGCAGGCAGAAGAAGGTGGGAGG - Intergenic
960647351 3:119902330-119902352 AGCAATAATAGGAAGGAGGGAGG + Intronic
961101124 3:124200053-124200075 ATCATAAACAGGAAGGTGGGTGG + Intronic
961302320 3:125930247-125930269 ATCAGGATCAGGTAGGTGGGCGG - Intronic
961955580 3:130799615-130799637 CTCAGAAGGAGGATGGTGGGAGG + Intergenic
962038299 3:131677729-131677751 ATCAGATAGTTGAAGGTGGGTGG + Intronic
963019895 3:140863140-140863162 ATCGGAAGGTGGAAGGTGGGAGG + Intergenic
963505898 3:146184124-146184146 ATCAAAAGGAGGAAGGTGTGAGG + Intergenic
965175359 3:165323264-165323286 ATCAGTAGGAGGTTGGCGGGTGG + Intergenic
965246396 3:166276663-166276685 ATGAGTAAGAGGAAGGTAAGAGG + Intergenic
965965608 3:174485443-174485465 ATCAGAGAGAGGGGGGTGGGTGG - Intronic
966257172 3:177930250-177930272 ATCTGTAAGAGGTGTGTGGGTGG + Intergenic
966742210 3:183244216-183244238 AACAGGCAGAGGAAGGTGGAAGG + Intronic
967559604 3:190902446-190902468 ATGAGTAAGAGAAAGAGGGGAGG - Intergenic
969145913 4:5123908-5123930 ATCAATAAAAGGCAGGAGGGAGG - Intronic
969654555 4:8488925-8488947 ACCAGTAAGAGGAGGATGTGTGG + Intronic
970725017 4:19033627-19033649 GTTAGAAAGAGAAAGGTGGGGGG + Intergenic
971746001 4:30581897-30581919 ATCAGTAAGAGGGAAGAGGCAGG + Intergenic
972207354 4:36792045-36792067 TTCAGAAGGTGGAAGGTGGGAGG - Intergenic
972665677 4:41162915-41162937 ATCAATAAGGGCAAGGTGTGTGG + Intronic
973184290 4:47306360-47306382 AACAGTGAGAAGAAGGTGCGGGG + Intronic
973268894 4:48240330-48240352 AGCAGGAAGAGAAAGGAGGGAGG + Intronic
974707546 4:65541046-65541068 ATGAGAAAGGGGAAGGAGGGAGG - Intronic
974838438 4:67276920-67276942 ATCAGAAAGGGGAAGGAGAGGGG - Intergenic
975997841 4:80336651-80336673 ATCAGTGCTAGGAAGCTGGGAGG + Intronic
976148369 4:82066756-82066778 ACTAGTAAGATGATGGTGGGTGG + Intergenic
977270271 4:94909644-94909666 ATCAGGAAGAGGGAGGAGGAGGG - Intronic
978054814 4:104249953-104249975 ATCAATAACAGGAAGATAGGTGG + Intergenic
978121573 4:105085703-105085725 ATCAATAAAAGGAAGATGTGTGG + Intergenic
979008088 4:115330203-115330225 ATCAGAGAGTGGAAGGTGGGAGG - Intergenic
979595144 4:122526270-122526292 AACAGTCATTGGAAGGTGGGTGG - Intergenic
980175569 4:129340261-129340283 TTCAGAGAGTGGAAGGTGGGAGG - Intergenic
980848139 4:138348781-138348803 CACAGAAGGAGGAAGGTGGGAGG + Intergenic
981783220 4:148448371-148448393 GTCAGAAAGAGAAAGGAGGGGGG + Intergenic
982602010 4:157463619-157463641 ATCAGAAGGTGAAAGGTGGGAGG + Intergenic
982701554 4:158663365-158663387 ATCAAAAAGGGGAAGGTGAGGGG + Intergenic
983468865 4:168131280-168131302 ATCAGTAACAGAAAGATGGCTGG - Intronic
983599855 4:169515133-169515155 ATCAGTAGCAGGAAGGTGACAGG - Intronic
983834519 4:172371803-172371825 ATCAAAAAGAGGAAGGAGAGGGG - Intronic
984791276 4:183617181-183617203 AAAAGAAAGAGGAAGGAGGGAGG - Intergenic
985734118 5:1567590-1567612 CTCAGCAAGAGGAATGTGGCAGG + Intergenic
985802016 5:2010731-2010753 ATCATGAAGAGGGGGGTGGGAGG - Intergenic
985824562 5:2182587-2182609 ATCCGTAAGAGGATGGGAGGAGG - Intergenic
985851626 5:2392626-2392648 AAGAGAAAGAGGAAGGAGGGAGG - Intergenic
985929619 5:3046967-3046989 ATTAGGAAGAGAAGGGTGGGTGG + Intergenic
987029390 5:13961760-13961782 ATTAGTAGGAGGAATGGGGGAGG - Intergenic
987092924 5:14523434-14523456 ACCAGCAGGAGGAAGGAGGGAGG - Intronic
987227336 5:15856393-15856415 ATCAGAGGGTGGAAGGTGGGAGG + Intronic
987234831 5:15932190-15932212 ATCAGTAAAAGTGAGGTGGTTGG + Intronic
988393745 5:30669757-30669779 AGCAGGAAGAGGAAGTTGGAAGG + Intergenic
988673539 5:33407880-33407902 ATCAGTAACAGAAAGGTGTATGG + Intergenic
989823327 5:45822578-45822600 GTCAGTAACAGTAAAGTGGGTGG - Intergenic
989963030 5:50438842-50438864 ATCAATAAGATGAATGGGGGAGG - Intronic
989963676 5:50444484-50444506 ATCAATAAGATGAATGGGGGAGG - Intergenic
990256363 5:53974922-53974944 ATCAGTTATAAGAAGGTGAGCGG + Intronic
990396508 5:55385415-55385437 AGCAGCAACAGGTAGGTGGGAGG + Intronic
990695225 5:58408928-58408950 CTCAGAAAGAGGATGGTGAGAGG - Intergenic
991504300 5:67308155-67308177 AACAGTAGGAGGAAGGTAAGAGG - Intergenic
991557545 5:67912524-67912546 ATCAGGAGGAAGAAGGAGGGAGG + Intergenic
992319713 5:75601565-75601587 AGCAGGCAGAGGAAGGTGGAAGG + Intergenic
992403612 5:76434340-76434362 CTCAGAAAGAGGAGGGTGGGAGG - Intronic
993174504 5:84466167-84466189 AGCAGATAAAGGAAGGTGGGAGG + Intergenic
993686388 5:90943225-90943247 AACAGTAAGGGGTGGGTGGGTGG + Intronic
993906706 5:93631717-93631739 AGCAGTGAGGGGAAGCTGGGAGG - Intronic
994388678 5:99163531-99163553 CTCAGAAATGGGAAGGTGGGAGG + Intergenic
994619812 5:102149754-102149776 ATCAGAAGGTGGATGGTGGGAGG + Intergenic
994833270 5:104813577-104813599 AGTTGGAAGAGGAAGGTGGGAGG - Intergenic
995127372 5:108591804-108591826 TTCGGTAAAAAGAAGGTGGGGGG + Intergenic
995546425 5:113236773-113236795 ATCAGTTTGAGGAGGGAGGGAGG - Intronic
996151493 5:120041439-120041461 ATCAGAGAGTGGAGGGTGGGAGG + Intergenic
996318480 5:122188010-122188032 AAAAGAAAGAGGAAGGTGGCAGG + Intergenic
996578754 5:125006461-125006483 AACAGTAAGGGGTATGTGGGGGG - Intergenic
996825078 5:127673766-127673788 ATGAGTAAGAGGAAGGTGACTGG + Intergenic
997452856 5:133997408-133997430 ATCAAAAAGAATAAGGTGGGTGG + Intronic
997605003 5:135168569-135168591 AACAGTAAAAGGAAGCTGGTGGG - Intronic
998479018 5:142445695-142445717 CCCAGTAAGTGGAAGGTGGTAGG - Intergenic
998665264 5:144289510-144289532 ATCAGTAGAAGGAATGTGTGTGG - Intronic
998793756 5:145794620-145794642 ATCTGTAAGAGGAAGGAAGCAGG + Intronic
999397740 5:151240892-151240914 TTCAGTAAGAAGAAGGGGTGGGG + Intronic
999575411 5:152971234-152971256 CTCAGAAGGAGGAGGGTGGGAGG + Intergenic
999589998 5:153134341-153134363 TTCAGTAAAAGGAAGTTGGAAGG + Intergenic
1001993679 5:176136582-176136604 ATCAGAGAGTGGAGGGTGGGAGG - Intergenic
1002086966 5:176781971-176781993 TTCAGTTAGCGGAAGCTGGGAGG - Intergenic
1002701195 5:181126199-181126221 ATCAGAAAAAGGAGGGTGGCTGG - Intergenic
1002969138 6:1996155-1996177 ATGAGAAAGAGGAAGGAGGAAGG - Intronic
1003400885 6:5789904-5789926 ATCAGAGAGTGGAGGGTGGGAGG - Intergenic
1003993578 6:11514113-11514135 ATCACTAACAGGAAGGCAGGAGG + Intergenic
1005120256 6:22381673-22381695 ATCAGAAAAAGGAAGATAGGAGG - Intergenic
1005430206 6:25748683-25748705 CTCAGCAAGAGGAATGTGGTAGG + Intergenic
1006264168 6:32903348-32903370 ATCACACAGAGGAAGGTGGAAGG - Intergenic
1006416428 6:33906930-33906952 GTCATTAAGAGGCAGGTGGAGGG + Intergenic
1007188058 6:39989458-39989480 ATCAGAAAGGGGAGGGTAGGAGG - Intergenic
1007268596 6:40618068-40618090 ATCAATAAGATCAAGGTGGCTGG + Intergenic
1007345351 6:41224652-41224674 ATCTGTCAGAGTGAGGTGGGAGG - Intergenic
1007539786 6:42630635-42630657 GGCAGTAAGAGGAAGTTTGGTGG - Intronic
1007808821 6:44472134-44472156 ATCAGGAAGAGGAAAGGAGGTGG - Intergenic
1008730440 6:54475688-54475710 CTCAGAAAGGGGAAAGTGGGAGG + Intergenic
1008786882 6:55178751-55178773 ATCAGTATGAAGGAGATGGGTGG - Intronic
1010923360 6:81712362-81712384 ATCTGAGAGTGGAAGGTGGGAGG + Intronic
1011329879 6:86192337-86192359 GGAAGTAAGAGAAAGGTGGGTGG - Intergenic
1013158957 6:107522876-107522898 ATCAGAATGTGGGAGGTGGGAGG + Intronic
1013502073 6:110762253-110762275 ATCAGTGAGAAGAAGATGGAGGG - Intronic
1013559088 6:111286650-111286672 ATCAGTCTGAGGAAGGTCAGTGG + Intergenic
1013887499 6:114987994-114988016 AGCAGGCAGAGGAAGGTGGAAGG + Intergenic
1014709104 6:124785686-124785708 ATCAGTCAGAGGCTAGTGGGGGG - Intronic
1015636269 6:135277808-135277830 CTCAGAAGGGGGAAGGTGGGAGG + Intergenic
1015821952 6:137270913-137270935 ATCAGAGGGGGGAAGGTGGGAGG + Intergenic
1017004593 6:150020722-150020744 AGAAGGAAGAGGAGGGTGGGAGG + Intronic
1017933311 6:158979798-158979820 TTCACTCTGAGGAAGGTGGGTGG + Intronic
1018042825 6:159940296-159940318 CTCAGCTAGAGGAAGGTGGAGGG - Intergenic
1018247693 6:161838600-161838622 ATGAGGAAGAGGAAGGTGGCTGG - Intronic
1018264403 6:162006747-162006769 AACAATAAGAGAAGGGTGGGAGG - Intronic
1018861875 6:167716838-167716860 ATCAGAGAGTGGAGGGTGGGAGG + Intergenic
1018921853 6:168181029-168181051 ATCAGCAAGAGAAAAGTGTGGGG - Intergenic
1019004686 6:168786462-168786484 GTCAGCGAGAGAAAGGTGGGAGG + Intergenic
1019870292 7:3754668-3754690 CTAAGTAAGGGGAAGGGGGGTGG + Intronic
1020404637 7:7818135-7818157 ATCAGAGGGTGGAAGGTGGGAGG - Intronic
1020577783 7:9956356-9956378 AAAAAGAAGAGGAAGGTGGGGGG - Intergenic
1021682601 7:23149432-23149454 CCCAGTAAGAGAAAGGTAGGAGG - Intronic
1022369801 7:29759760-29759782 ATCACATAGAGGAAGGTGAGAGG - Intergenic
1022565488 7:31395851-31395873 ATCAGTTAGTGGTAGCTGGGCGG - Intergenic
1022699698 7:32747676-32747698 ATAAGGAAGAGGGGGGTGGGTGG + Intergenic
1022816143 7:33916362-33916384 ATCAGGAAGTGGCAGGTAGGAGG + Intronic
1022872588 7:34494742-34494764 AGTAGCAAGAGGAAGGTTGGGGG - Intergenic
1022935650 7:35173386-35173408 ATAAGGAAGAGGGGGGTGGGTGG + Intergenic
1024571175 7:50723859-50723881 AACAGACATAGGAAGGTGGGAGG + Intronic
1025870641 7:65429510-65429532 ATCAGGAGGTGGAGGGTGGGAGG + Intergenic
1026841125 7:73670395-73670417 ATCAGTGAGCTGAAGGTGGTGGG + Intronic
1027523589 7:79240006-79240028 ATCAGTAAGAGGATGTTGAAAGG - Intronic
1027929258 7:84510096-84510118 ATCAGGCAGAGGAAAGTGGATGG + Intergenic
1029831604 7:103266120-103266142 ATAAGGAAGAGGGGGGTGGGTGG + Intergenic
1029943831 7:104510895-104510917 ATCAGAGAGTGGAGGGTGGGAGG + Intronic
1030188961 7:106791840-106791862 CTCAGTGAGAGGAAGGGAGGTGG - Intergenic
1031768255 7:125808052-125808074 AGCAGTCAGAGGAACGTGGAGGG - Intergenic
1032464889 7:132137907-132137929 ATGAGTATGAGGATGGTGGAAGG + Intronic
1033337465 7:140465783-140465805 AAGAGTAAGAGGTAGGTGGCCGG + Intronic
1033804207 7:144936446-144936468 ATGAGGAAGAGGAATGTGGGTGG - Intergenic
1034101395 7:148453696-148453718 ATCAGAGAGTGGAGGGTGGGAGG + Intergenic
1035070418 7:156140575-156140597 AGGAGAAAGAGGCAGGTGGGGGG + Intergenic
1035673272 8:1436385-1436407 AGCAGGCAGAGGAAGGTGGAAGG - Intergenic
1035777151 8:2196786-2196808 AGCAGGCAGAGGAAGGTGGAAGG - Intergenic
1035874181 8:3169808-3169830 ACCAGAAAGAAGAAAGTGGGGGG - Intronic
1036468186 8:9022857-9022879 ATAAGGAAGAGGAAAGTGGGTGG - Intronic
1036475234 8:9087202-9087224 AAAAATAAGATGAAGGTGGGGGG - Intronic
1036635490 8:10547512-10547534 GTCAGAAAGAGGAAGGCAGGAGG - Intronic
1036705504 8:11043388-11043410 AGCAGGAAGAGGAGGCTGGGTGG - Intronic
1038323528 8:26551760-26551782 ATCAGTAACAGGAAGATAGCTGG + Intronic
1038626322 8:29196984-29197006 TTCAGTGGGAGGAAGGTGGGAGG - Intronic
1040317291 8:46271233-46271255 CTCAGCAAGAGGAATGTGGTAGG + Intergenic
1040343185 8:46455707-46455729 CTCAGCAAGAGGAACGTGGTAGG + Intergenic
1040577642 8:48667685-48667707 ATTAGTAAGGGGAAGGGGGCTGG - Intergenic
1040660582 8:49570499-49570521 ATCAGTATGAAAAATGTGGGTGG - Intergenic
1042123405 8:65512298-65512320 AACACAATGAGGAAGGTGGGAGG + Intergenic
1042454845 8:68989207-68989229 AACAGGAAGAGGAAGGTCTGGGG + Intergenic
1042556620 8:70038716-70038738 ATCAGGAAGGCTAAGGTGGGAGG + Intergenic
1042628970 8:70795125-70795147 ATCAGAAGGTGGAGGGTGGGAGG - Intergenic
1043397119 8:79849219-79849241 ATCAGAGGGTGGAAGGTGGGAGG + Intergenic
1044346620 8:91111725-91111747 ATCAGAGAGTGGAAGCTGGGAGG + Intronic
1045091800 8:98753466-98753488 ATCAGAAGGTGGAAGGTGGAAGG + Intronic
1046388563 8:113537237-113537259 ATCAGAGAGTGGAGGGTGGGAGG - Intergenic
1046801372 8:118432340-118432362 TTCAGTAATAGGAACTTGGGAGG + Intronic
1047426109 8:124748453-124748475 AAGAGCAGGAGGAAGGTGGGTGG + Intergenic
1047778434 8:128092358-128092380 ATCAGTCAGAGGAAGGCCTGAGG - Intergenic
1048688387 8:136930283-136930305 ATCTGTAAGAGCAAGTGGGGAGG - Intergenic
1048811736 8:138294235-138294257 ATCAGAAAGAGGAGAGTGGAAGG + Intronic
1050323096 9:4473636-4473658 ATCAGAGAGTGGAGGGTGGGAGG + Intergenic
1051170381 9:14314698-14314720 AGGAGGAGGAGGAAGGTGGGGGG - Intronic
1051489706 9:17647912-17647934 AGGTGGAAGAGGAAGGTGGGGGG - Intronic
1051502689 9:17795413-17795435 AACAGGAAGAGGAATGAGGGAGG + Intronic
1051899161 9:22020018-22020040 ATCAGAAGGTGGAAGATGGGTGG - Intronic
1052875607 9:33559988-33560010 ATCTATACGAAGAAGGTGGGTGG - Intronic
1054328869 9:63731917-63731939 ATCCAGAAGAGCAAGGTGGGAGG + Intergenic
1054912699 9:70468448-70468470 TTCAGGCAGAGGAAGGAGGGTGG - Intergenic
1055340088 9:75272396-75272418 CTCAGAAGGGGGAAGGTGGGAGG - Intergenic
1055849226 9:80605477-80605499 ATCAATAAGAGCAAGTTGGCTGG - Intergenic
1056541217 9:87572979-87573001 ATCAGCATCTGGAAGGTGGGAGG - Intronic
1057959758 9:99443288-99443310 ATCAGAAGGTGAAAGGTGGGAGG + Intergenic
1058276497 9:103048046-103048068 ATCAGAAGGGGGAGGGTGGGAGG + Intergenic
1058822123 9:108742223-108742245 ATCGGTAAGAGGAATGAGGCCGG - Intergenic
1058845723 9:108957227-108957249 CTCAGGAGGTGGAAGGTGGGAGG - Intronic
1059718375 9:116934610-116934632 TTCAGGGAGTGGAAGGTGGGAGG + Intronic
1060753765 9:126193983-126194005 ATCACTATGAGGAAGAAGGGTGG - Intergenic
1061434893 9:130554882-130554904 ATCAGTGAGAGGGAGGAGGTGGG + Intergenic
1061490598 9:130941898-130941920 GCCAGAAAGAGGAAGGTGAGGGG - Intergenic
1061588639 9:131584132-131584154 ATCAGAGACAGGAAGGCGGGAGG + Intronic
1062179240 9:135181893-135181915 ATCAGGCAGAGGAAGGTGGAAGG + Intergenic
1062324151 9:136004437-136004459 ACTGGTAAGAGGAAGGAGGGCGG - Intergenic
1062682665 9:137790444-137790466 ATCAGTGAGAGGATGCTGTGTGG + Intronic
1203378359 Un_KI270435v1:3030-3052 ATCTGCAAGAGGAAATTGGGAGG + Intergenic
1186024650 X:5296033-5296055 ATTTGGAAGACGAAGGTGGGAGG + Intergenic
1186530488 X:10290476-10290498 CTCACTGGGAGGAAGGTGGGTGG + Intergenic
1187556595 X:20357940-20357962 TTCAGTAAGTGGAAGAGGGGAGG - Intergenic
1188158744 X:26774973-26774995 CTCAGAAAGGGGAAGGTGGGAGG + Intergenic
1188721346 X:33527227-33527249 ATCGGTGGGTGGAAGGTGGGAGG + Intergenic
1188900542 X:35727762-35727784 ATCAGTGGGAGGAGGGTGGGAGG - Intergenic
1188992100 X:36833908-36833930 ATCAGAGAGTGGAGGGTGGGAGG + Intergenic
1189177557 X:38973116-38973138 ATCAGAGGGAGGAGGGTGGGAGG + Intergenic
1189783868 X:44542436-44542458 ATCAGTGGGAGGAATGGGGGTGG + Intronic
1190823300 X:53994456-53994478 TTGAATAAGATGAAGGTGGGAGG - Intronic
1191047322 X:56152599-56152621 ATCAGTTAGAGGAAGCTGTGTGG + Intergenic
1191739277 X:64419256-64419278 ATCAGGGAGTGGAAGGTGAGAGG - Intergenic
1192557013 X:72098282-72098304 ATAAGAAAGAGGAAGTTGGCCGG + Intergenic
1192949244 X:75998930-75998952 ATCAGAAGGTGGATGGTGGGAGG - Intergenic
1193773381 X:85614771-85614793 ATCAGAGGGTGGAAGGTGGGAGG - Intergenic
1193894304 X:87093210-87093232 ACCAGTGGGGGGAAGGTGGGAGG - Intergenic
1193945882 X:87733757-87733779 ATCAAGAATAGGAGGGTGGGAGG + Intergenic
1193992353 X:88323605-88323627 ATCAGAAGAGGGAAGGTGGGAGG - Intergenic
1194559409 X:95402598-95402620 ATCAGAAGGTGGAAGGTTGGAGG + Intergenic
1195719961 X:107857575-107857597 ATTATTAAGAGGAAGTTGGCCGG - Intronic
1195807455 X:108791639-108791661 TTCACTAAAAGGAAGATGGGAGG - Intergenic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1196239238 X:113321666-113321688 ATCAGAGGGTGGAAGGTGGGAGG + Intergenic
1196830284 X:119770577-119770599 ATCAGAGAGTGGAGGGTGGGAGG - Intergenic
1196961465 X:121007619-121007641 AGCAGAATGGGGAAGGTGGGAGG + Intergenic
1198327696 X:135590326-135590348 ATCAGAAGGTGGAAGATGGGAGG + Intergenic
1199192418 X:144986022-144986044 AAGAGTAAGAGGGGGGTGGGGGG + Intergenic
1200204158 X:154303839-154303861 ATGAGCAAGAAGATGGTGGGGGG - Intronic
1200216002 X:154368550-154368572 CTGAGGAAGAGGAAGGTGGGTGG + Intronic
1200230198 X:154440136-154440158 ATGAGTGAGGGGAAGCTGGGTGG + Exonic
1200257185 X:154589428-154589450 CTCAGTAAGGGGAATGTGGCAGG - Intergenic
1200260585 X:154614974-154614996 CTCAGTAAGGGGAATGTGGCAGG + Intergenic
1200766888 Y:7087765-7087787 AAGAGGAAGAGGAAGGTGGAAGG - Intronic
1201943888 Y:19489490-19489512 ATCAGTAACAGAAAGTTGGAGGG + Intergenic