ID: 903818786

View in Genome Browser
Species Human (GRCh38)
Location 1:26084992-26085014
Sequence ATGCAGAAGAGGGTCTTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903818786_903818793 15 Left 903818786 1:26084992-26085014 CCCCTCAAGACCCTCTTCTGCAT No data
Right 903818793 1:26085030-26085052 CTCTGCAGCATCCTACCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903818786 Original CRISPR ATGCAGAAGAGGGTCTTGAG GGG (reversed) Intergenic
No off target data available for this crispr