ID: 903818793

View in Genome Browser
Species Human (GRCh38)
Location 1:26085030-26085052
Sequence CTCTGCAGCATCCTACCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903818787_903818793 14 Left 903818787 1:26084993-26085015 CCCTCAAGACCCTCTTCTGCATG No data
Right 903818793 1:26085030-26085052 CTCTGCAGCATCCTACCTCCTGG No data
903818791_903818793 4 Left 903818791 1:26085003-26085025 CCTCTTCTGCATGGCTTTGAATG No data
Right 903818793 1:26085030-26085052 CTCTGCAGCATCCTACCTCCTGG No data
903818788_903818793 13 Left 903818788 1:26084994-26085016 CCTCAAGACCCTCTTCTGCATGG No data
Right 903818793 1:26085030-26085052 CTCTGCAGCATCCTACCTCCTGG No data
903818790_903818793 5 Left 903818790 1:26085002-26085024 CCCTCTTCTGCATGGCTTTGAAT No data
Right 903818793 1:26085030-26085052 CTCTGCAGCATCCTACCTCCTGG No data
903818786_903818793 15 Left 903818786 1:26084992-26085014 CCCCTCAAGACCCTCTTCTGCAT No data
Right 903818793 1:26085030-26085052 CTCTGCAGCATCCTACCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903818793 Original CRISPR CTCTGCAGCATCCTACCTCC TGG Intergenic
No off target data available for this crispr