ID: 903822069

View in Genome Browser
Species Human (GRCh38)
Location 1:26111014-26111036
Sequence GAGGCGCCTGCACCTGGCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 278}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903822069_903822081 14 Left 903822069 1:26111014-26111036 CCGCAGCCAGGTGCAGGCGCCTC 0: 1
1: 0
2: 4
3: 26
4: 278
Right 903822081 1:26111051-26111073 CCACGCCGAGGAGGTGGCCCTGG 0: 1
1: 0
2: 0
3: 30
4: 230
903822069_903822073 2 Left 903822069 1:26111014-26111036 CCGCAGCCAGGTGCAGGCGCCTC 0: 1
1: 0
2: 4
3: 26
4: 278
Right 903822073 1:26111039-26111061 CGCCCTCACTCCCCACGCCGAGG 0: 1
1: 0
2: 1
3: 21
4: 213
903822069_903822077 8 Left 903822069 1:26111014-26111036 CCGCAGCCAGGTGCAGGCGCCTC 0: 1
1: 0
2: 4
3: 26
4: 278
Right 903822077 1:26111045-26111067 CACTCCCCACGCCGAGGAGGTGG 0: 1
1: 0
2: 1
3: 16
4: 151
903822069_903822083 24 Left 903822069 1:26111014-26111036 CCGCAGCCAGGTGCAGGCGCCTC 0: 1
1: 0
2: 4
3: 26
4: 278
Right 903822083 1:26111061-26111083 GAGGTGGCCCTGGCTCCCTGCGG 0: 1
1: 0
2: 7
3: 49
4: 392
903822069_903822076 5 Left 903822069 1:26111014-26111036 CCGCAGCCAGGTGCAGGCGCCTC 0: 1
1: 0
2: 4
3: 26
4: 278
Right 903822076 1:26111042-26111064 CCTCACTCCCCACGCCGAGGAGG 0: 1
1: 0
2: 2
3: 10
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903822069 Original CRISPR GAGGCGCCTGCACCTGGCTG CGG (reversed) Intergenic
900646138 1:3709541-3709563 GTGGCAGCTGCACCTGCCTGTGG + Intronic
901048894 1:6416325-6416347 GAGGTGCCTGCCACTGCCTGTGG + Exonic
902155731 1:14484684-14484706 AAGGCGCATTCACATGGCTGCGG + Intergenic
903296110 1:22343953-22343975 GAGGCGACGGCGCCTGGATGGGG + Intergenic
903822069 1:26111014-26111036 GAGGCGCCTGCACCTGGCTGCGG - Intergenic
904098754 1:28003689-28003711 CATGCCACTGCACCTGGCTGGGG + Intronic
904684188 1:32248690-32248712 GAGGCACCAGCTCCTGGCGGGGG + Exonic
904751170 1:32742058-32742080 GCCGCGCCTTCAGCTGGCTGCGG + Exonic
904948474 1:34216515-34216537 GGTGAGGCTGCACCTGGCTGGGG + Intronic
904993055 1:34609234-34609256 AAGGCTCCTGAACCTGGCTCTGG - Intergenic
905630180 1:39514229-39514251 GAGACGCCTGCACGCTGCTGTGG + Intronic
905667580 1:39771961-39771983 GAGACGCCTGCACGCTGCTGTGG - Intronic
906348631 1:45037705-45037727 GAGCAGCCTGCACTTGGCTTGGG + Intronic
906529768 1:46517093-46517115 GTGGTGCATGCACCTGGCTGAGG + Intergenic
908082478 1:60596113-60596135 GAGGGTCATGAACCTGGCTGAGG + Intergenic
908527512 1:65002252-65002274 GGGGCGCTTGCTTCTGGCTGGGG - Intergenic
912520863 1:110243730-110243752 GGAGGGCCTGCACCCGGCTGTGG + Intronic
914490273 1:148147088-148147110 GTGCCGCCTCCACATGGCTGAGG + Intronic
915554637 1:156654607-156654629 TAGGCCCCTCCCCCTGGCTGTGG - Intronic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
920377001 1:205514195-205514217 GAGGGACCATCACCTGGCTGGGG + Intronic
921029726 1:211326825-211326847 GCGGCTGCTGCTCCTGGCTGCGG - Exonic
1063460517 10:6212461-6212483 GTGGAGCCGGCCCCTGGCTGAGG + Intronic
1065476591 10:26144890-26144912 TGGGCCACTGCACCTGGCTGAGG - Intronic
1067513094 10:46911546-46911568 GAGGCCGCTGCGCCGGGCTGTGG + Intronic
1067649159 10:48140296-48140318 GAGGCCGCTGCGCCGGGCTGTGG - Intergenic
1067753131 10:48984971-48984993 GGGGCTGCTGCTCCTGGCTGTGG + Intergenic
1068226854 10:54117314-54117336 CAGGCACCTGCATCTGGATGAGG + Intronic
1069572251 10:69501333-69501355 GAGGAGCCTTCCCCTGGCCGGGG + Intronic
1069618479 10:69821391-69821413 GAGGAGACTGCACCTGGCCAAGG - Intronic
1069818424 10:71212959-71212981 GAGGCGCCCGAACCAGGCCGCGG + Exonic
1069956872 10:72057339-72057361 GAGGAGCCTGCAGCCTGCTGAGG - Intergenic
1070129700 10:73647847-73647869 GAGGCGCCTGCCCCAGGCCCAGG - Exonic
1072191629 10:93080870-93080892 GTGGCTCCCGCACCTGGTTGCGG - Intergenic
1074507804 10:114086856-114086878 GAGGCGCGTGCATGTGGCTGGGG - Intergenic
1076581555 10:131515636-131515658 CAGGGGCCTGCACCTGACTACGG - Intergenic
1076736805 10:132462648-132462670 GAGGCACCTGCTGCTGGCAGAGG + Intergenic
1077017500 11:403449-403471 GAGGCACCTGATCCGGGCTGCGG + Intronic
1077095128 11:795936-795958 GAGGCCCCTGAGGCTGGCTGTGG - Intronic
1077213511 11:1384312-1384334 GAGGCGGCTCCAGCTGCCTGAGG - Intergenic
1077322406 11:1948168-1948190 GAGGCCCCTGCACATAGCTGGGG + Intronic
1077352062 11:2097619-2097641 CAGGCGCCCGGACCTGGGTGGGG - Intergenic
1077542450 11:3153594-3153616 TGGGCGCCTGTTCCTGGCTGTGG - Intronic
1079999770 11:27334076-27334098 CAGGCCACTGCACCTGGCTCTGG + Intronic
1080601968 11:33829322-33829344 GAGGCGCTGGGACCTGGCTCCGG - Intergenic
1081739954 11:45431873-45431895 GAGGCTGCTGAACCTGGCAGTGG - Intergenic
1081863053 11:46345273-46345295 TAGGCGCCTTCCGCTGGCTGGGG - Intronic
1081875957 11:46408527-46408549 GAGGCGGCTGTCCCTGGCTCCGG + Exonic
1083568635 11:63742556-63742578 GAGTCGCTTGAACCTGGATGCGG + Intronic
1083602167 11:63955527-63955549 GAGGGGCCTGCTGCTGGCTGGGG - Exonic
1083893557 11:65608891-65608913 CAGGCCACTGCACCTGGCCGAGG + Intronic
1084681507 11:70669146-70669168 GAGTCGGCTGCTGCTGGCTGAGG + Intronic
1085391431 11:76184314-76184336 GAGGCCCCTGACCCAGGCTGAGG + Intergenic
1087775549 11:102253555-102253577 GAGCTGCCTGCAGCTGGGTGTGG - Intergenic
1088789823 11:113214626-113214648 GAGGCCCCGGGATCTGGCTGTGG - Intronic
1089524452 11:119087863-119087885 GTGGGGCCTGCAGCTGGCAGGGG - Intronic
1090324188 11:125870669-125870691 GAGGCGGCAGCAGCTGTCTGAGG + Intergenic
1090402680 11:126459005-126459027 GAGGAGCCTGCATCTCGCCGTGG + Intronic
1090788476 11:130070003-130070025 CAGGAGCCTGCCCGTGGCTGCGG - Exonic
1202805424 11_KI270721v1_random:3481-3503 GAGGCCCCTGCACATAGCTGGGG + Intergenic
1091691200 12:2598659-2598681 GAGAGGCCTGCAGCTGGCAGTGG - Intronic
1091749220 12:3012178-3012200 GACGAGCCAGCACCTGGATGTGG - Exonic
1093772703 12:23036044-23036066 GAGGCGCCTGCACATTTCCGGGG - Intergenic
1097259596 12:57710135-57710157 GAGCCACCCGCACCTGGCTGTGG + Intronic
1100398294 12:94204034-94204056 GAGGGGCCTGCATCTGGCGAGGG - Intronic
1101144718 12:101830523-101830545 GAGGCGCCCGGTCCAGGCTGCGG + Intronic
1101372032 12:104138552-104138574 GAGGCACCTCCACGTGGCGGGGG - Intergenic
1102232898 12:111275789-111275811 GATGCTCCAGTACCTGGCTGAGG - Intronic
1104469648 12:129019208-129019230 GAGGCCTCTGTTCCTGGCTGTGG - Intergenic
1104887477 12:132119136-132119158 GAGCTGCCTGCTCCTGGGTGGGG - Intronic
1104903820 12:132203180-132203202 GAGGCGGCGGCACCAGGTTGGGG + Intronic
1106568543 13:30906838-30906860 CAGACGCCTCCACCCGGCTGCGG + Intronic
1107039968 13:35937928-35937950 GAGGAACCTGGGCCTGGCTGTGG + Intronic
1108613271 13:52105501-52105523 GAGCCGCCTGCACCTGACCCAGG + Intronic
1108721686 13:53139058-53139080 GGGGAGCATACACCTGGCTGGGG + Intergenic
1111716685 13:91887319-91887341 GGGGCACCTGCACCTGGCCCAGG + Intronic
1113835916 13:113328359-113328381 CAGGCGTCTGCACATGGCTGTGG + Intronic
1114388987 14:22285610-22285632 GAATCACCTGAACCTGGCTGTGG - Intergenic
1114455553 14:22851181-22851203 GAGGGGGCTGGGCCTGGCTGGGG - Intergenic
1117755429 14:58970089-58970111 CAGAGGCCTCCACCTGGCTGGGG + Intergenic
1118485581 14:66211635-66211657 CAGGCCTCTGCAACTGGCTGTGG + Intergenic
1119808602 14:77498626-77498648 GTGGCGGCGGCACCGGGCTGCGG - Intronic
1120872661 14:89352082-89352104 GAGGTTCCAGCCCCTGGCTGTGG - Intronic
1121321340 14:92993380-92993402 CAGGAGCCTGCAGCTGGCAGGGG + Intronic
1121510189 14:94506428-94506450 GAGGCACCTGATCCTAGCTGGGG + Intronic
1121900977 14:97693273-97693295 GAGTTGCTTGCACCTGGATGAGG - Intergenic
1122773888 14:104108764-104108786 GTGTCCCCTGCGCCTGGCTGAGG + Intronic
1122842203 14:104471433-104471455 GAGATGCCATCACCTGGCTGGGG + Intergenic
1123067321 14:105625246-105625268 GATGCGTCAGCACCCGGCTGGGG + Intergenic
1123098425 14:105777201-105777223 GGGGAGACTGCACTTGGCTGGGG + Intergenic
1124291702 15:28457418-28457440 GTGCCGCCTCCACATGGCTGAGG - Intergenic
1124373637 15:29117081-29117103 GAGGAGCCTGAACATGGCGGCGG - Exonic
1124453599 15:29821716-29821738 CCGGCGCCTGTGCCTGGCTGCGG - Intronic
1127313058 15:57769440-57769462 GAGGCTGCTGCAGCTGCCTGAGG - Intronic
1127931716 15:63601327-63601349 GAGGCGCCTGCACCGTCCTCGGG + Exonic
1129933286 15:79429903-79429925 GAGGAGACAGCACCTGGCTGAGG + Intergenic
1131547961 15:93331823-93331845 AAAACGCCTGCACTTGGCTGTGG + Intergenic
1132240099 15:100251263-100251285 GAGACGCATGCACCTGGGAGGGG + Intronic
1132342507 15:101087347-101087369 GTGGGGCCTGCACAAGGCTGAGG + Intergenic
1132465979 16:77685-77707 GAGGCCCCCGCCCCTGGCCGGGG - Intronic
1132745457 16:1434440-1434462 GCTGCACCTGCTCCTGGCTGTGG + Exonic
1132752440 16:1464997-1465019 GAGGGGGCTGGACCTGGCTTTGG - Intronic
1133036626 16:3037050-3037072 GAGTCGCTTCCACCTGGGTGGGG + Intergenic
1133317940 16:4895507-4895529 GAGGGGCCTGTACAGGGCTGAGG + Intronic
1136458459 16:30395510-30395532 CGGGCGCCTGCACCCCGCTGAGG + Exonic
1137300287 16:47143083-47143105 GCGGCGCCTGCACCTCGCGGCGG - Intronic
1138026919 16:53529117-53529139 GAGGGGCGTGCAGGTGGCTGCGG - Intergenic
1138208590 16:55143843-55143865 GAGGAGCCTGCATCTGGCAAGGG - Intergenic
1139908047 16:70380287-70380309 TAGGTTCCTGCAGCTGGCTGAGG - Exonic
1141459832 16:84171583-84171605 GAGGGGCGTGTGCCTGGCTGAGG + Intronic
1141704232 16:85655816-85655838 GATGCACCTGCACCTCTCTGGGG + Exonic
1142346256 16:89555929-89555951 GAGGCGGCTGCTGCTGGCTGGGG - Intronic
1142686145 17:1577978-1578000 CAGGTGCCTGACCCTGGCTGGGG + Intronic
1143102847 17:4513812-4513834 CAGGCGCCTGCCCCGGGCTTGGG - Intronic
1144859528 17:18292176-18292198 GCAGAGCCTGCCCCTGGCTGAGG + Intronic
1145909721 17:28535325-28535347 GAGGAGGCTGGACCTGGCAGGGG + Intronic
1147188274 17:38724676-38724698 GCAGCGCCTGCAGATGGCTGGGG + Exonic
1147498306 17:40938261-40938283 GAGGTGGCTGCGCCTGGCTAGGG - Intergenic
1147718484 17:42523219-42523241 GTGGCCCCTTCACCTGTCTGGGG - Intergenic
1147742098 17:42675544-42675566 CCGGCGCCAGCACCTGGCGGAGG - Intronic
1147962504 17:44176801-44176823 GACGCCCCTGCACGTGGCGGCGG + Exonic
1148245568 17:46027742-46027764 CCTACGCCTGCACCTGGCTGGGG - Exonic
1150554167 17:66238647-66238669 GAGCCACCTGCACCTGGCTGGGG - Intronic
1152095618 17:78270023-78270045 GGGGCCCCTCCACCTGGCAGAGG - Intergenic
1152177512 17:78797554-78797576 GAGGCTGCTGCCCCTGGTTGGGG - Exonic
1152466059 17:80466739-80466761 GGGTCACCTGCACCTGGCTGGGG + Intergenic
1152721728 17:81927019-81927041 GAAGACCCTGCCCCTGGCTGGGG - Intronic
1152798669 17:82321158-82321180 GCGGGGTCTCCACCTGGCTGGGG + Exonic
1153424233 18:4945102-4945124 GGGGCGGCTGCACTGGGCTGGGG - Intergenic
1154272040 18:12928861-12928883 GAAGCTCTTGCACATGGCTGCGG + Intronic
1156463782 18:37336137-37336159 GAGGCTCCTGGGGCTGGCTGTGG - Intronic
1157110550 18:44816392-44816414 GAGGGGTCAGCAGCTGGCTGAGG + Intronic
1157476309 18:48025663-48025685 GAGGCCCCAGCCCATGGCTGAGG - Intergenic
1157497131 18:48164153-48164175 GAGGGTCATGCCCCTGGCTGTGG - Intronic
1158954384 18:62524453-62524475 GAGCCACCTGCGCCGGGCTGGGG - Intronic
1160441909 18:78899500-78899522 GTGGCGGCTCCACCTGGGTGGGG + Intergenic
1160995339 19:1879732-1879754 GTGCCGCCTCCACATGGCTGAGG - Intronic
1161422329 19:4182655-4182677 GAGGCGCATGCGCCTTGCCGTGG - Intergenic
1161422491 19:4183550-4183572 GAGGCACCTGACCCAGGCTGGGG + Intronic
1162148169 19:8626263-8626285 AAGGGGCCTGCACCTGGCAAGGG - Intergenic
1162572131 19:11479972-11479994 GAGGCGCCCGCGCGAGGCTGCGG + Intronic
1162874405 19:13610141-13610163 CAGGCGCAGGCACCTGGCTGGGG - Intronic
1162967207 19:14161571-14161593 GAGGGGCGTGGGCCTGGCTGTGG + Exonic
1163608936 19:18291428-18291450 GAGGCCGCTGCCCCAGGCTGCGG + Intergenic
1163692481 19:18745205-18745227 AAGGCGCCTGTACTTGGCTCTGG + Intronic
1164709213 19:30343466-30343488 GAGGGGCCTTGACCTGGGTGAGG + Intronic
1164713190 19:30373891-30373913 GGGCCGCGTGCACCTTGCTGAGG - Intronic
1165227809 19:34366571-34366593 GAGGCACCTGTCCCTGGCTTAGG + Intronic
1165311309 19:35030740-35030762 GAGGCGGCGGGACCTGGCGGCGG - Intronic
1166689110 19:44812279-44812301 GGGGCGCCTGGTGCTGGCTGAGG + Exonic
1167157899 19:47750470-47750492 GAGGGGCCTGGACCCAGCTGGGG + Intronic
925163429 2:1702361-1702383 GTGGGGCCTGCCCCAGGCTGAGG - Intronic
927257523 2:21053171-21053193 GAGGCACCTGAACCTCCCTGGGG + Intergenic
927475873 2:23413856-23413878 GAGGCCCGTGCACCCTGCTGTGG + Intronic
927686461 2:25174665-25174687 GATGCACCTGCACCTGGCTGCGG + Intergenic
929932921 2:46272623-46272645 GGGGCGCCTGTAGCTGGTTGGGG + Intergenic
930880214 2:56261899-56261921 GAGGGGCCAGAACCTGGCTTAGG - Intronic
931761868 2:65424664-65424686 GAGCCACCTGCACCTGGCATGGG - Intronic
933656214 2:84889046-84889068 GAGGGACCTGCACCAGGCTCTGG + Intronic
934559799 2:95307153-95307175 CAGGCTCCTCCATCTGGCTGAGG - Intronic
934853596 2:97716039-97716061 GAGGTGCCTGACCCAGGCTGGGG + Intronic
936979287 2:118249450-118249472 GAAGCGCCTGGAGCTGGCAGGGG - Intergenic
937955508 2:127419916-127419938 GAGGCACTGGCACCTGTCTGAGG - Exonic
938487380 2:131724291-131724313 GAGGCGCCTGCTCCCGGCCTGGG + Intronic
941804014 2:169692349-169692371 GAGGTGCCAGCATCTGGCAGGGG + Intronic
946104996 2:217361284-217361306 GAGGAGCATGCACTTGGCTGGGG + Intronic
946365835 2:219248499-219248521 GAAGCGCCTCCAGCTGACTGAGG - Exonic
948139903 2:235664853-235664875 GTTACGCCTGCACCTGGCTAAGG - Intronic
948204931 2:236158660-236158682 GAGGCGTCTGCTCCTGGCAGAGG - Intergenic
948613345 2:239183563-239183585 GAGGCACATGCACGTGGCAGTGG - Intronic
948717416 2:239874328-239874350 GAGGCAGCTGCACACGGCTGTGG - Intergenic
949045457 2:241870717-241870739 GAGCCATCTCCACCTGGCTGTGG - Intronic
1170573008 20:17642926-17642948 GAGGCCACTGCAGCTGGCTAGGG - Intronic
1171194516 20:23186882-23186904 GAGCCACGTGCACCTGGGTGGGG - Intergenic
1171420500 20:25014290-25014312 AGGGGGCCTGCACCTGGCTGTGG - Intronic
1173846041 20:46189377-46189399 GAGGCGCCTGTTCCTGGCTGTGG - Intronic
1174506840 20:51022768-51022790 GGGGCGGCTGCACGTGGCCGTGG - Intronic
1174696791 20:52567910-52567932 GAGTCGCTTGAACCTGGATGGGG - Intergenic
1174955201 20:55090255-55090277 GAGGTGCCTGCACCTAGCTGTGG - Intergenic
1175924664 20:62465909-62465931 GAGGCCGCGGCACCTGGCAGGGG + Exonic
1175995806 20:62811908-62811930 GAGGCGCCTGTACCCTGCAGGGG + Intronic
1176162218 20:63653643-63653665 GAGGAGCAAGCGCCTGGCTGCGG + Intergenic
1178384980 21:32141823-32141845 GAGGGGCAAGCACCTGGCTCCGG + Intergenic
1179248971 21:39657024-39657046 GAGGAGCCTGCAGCAGGCAGAGG + Intronic
1179433731 21:41345184-41345206 GAGGCGGGTGGGCCTGGCTGAGG + Intronic
1179433745 21:41345230-41345252 GAGGCGGGTGGGCCTGGCTGAGG + Intronic
1179433759 21:41345276-41345298 GAGGCGGGTGGGCCTGGCTGAGG + Intronic
1179433773 21:41345322-41345344 GAGGCGGGTGGGCCTGGCTGAGG + Intronic
1179563861 21:42234482-42234504 GAGCTCCCCGCACCTGGCTGGGG + Intronic
1179633046 21:42690579-42690601 GAGGCGCAGGCACCAGCCTGGGG - Intronic
1180214328 21:46314966-46314988 GAGGCGCCTGTACCTGGCCCAGG - Intronic
1180960171 22:19758979-19759001 GCTGCCCCTGCACCTGGGTGAGG - Intronic
1181121414 22:20670272-20670294 GTGCCGCCTCCACATGGCTGAGG - Intergenic
1181441679 22:22939262-22939284 CAGGCTCCTGCTCCTGGGTGGGG - Intergenic
1181618014 22:24068224-24068246 GAGGCTCCAGCTCCTGGCAGAGG + Intronic
1184033702 22:41909005-41909027 GGGCTTCCTGCACCTGGCTGTGG - Intergenic
1184497120 22:44848426-44848448 GAGGCCACTGCCCCTGCCTGCGG - Intronic
1184684613 22:46090491-46090513 GAGGCCACTGAACCTGGCCGTGG - Intronic
1184949414 22:47829702-47829724 GAGGCGGCTCCCCATGGCTGGGG - Intergenic
1185068110 22:48642065-48642087 GAGGGGCCTGCACTTTTCTGAGG + Intronic
1185288662 22:50013502-50013524 GAGGCTTCTGCACCTGCCTCAGG + Intergenic
1185403014 22:50628117-50628139 GAGGAGCCGGTACCGGGCTGCGG + Exonic
949876711 3:8630883-8630905 GAGGCGCCTCCCCCAGGCTCTGG - Exonic
950115723 3:10449364-10449386 GAGGCGCCGGCAGATGGCTTCGG + Exonic
950452502 3:13073193-13073215 GCGGCGCCAGCAGCGGGCTGTGG + Intergenic
951272769 3:20647372-20647394 GAGGGGCCAGCACCTGGCAAAGG - Intergenic
952386076 3:32842730-32842752 GAAGAGCCTACACCTGGCTAAGG - Intronic
952746574 3:36787530-36787552 GAGCCTCCAGCACTTGGCTGTGG - Intergenic
954793169 3:53147697-53147719 GAGGCGTCAGCAGCTGGCAGGGG - Intergenic
960281311 3:115784249-115784271 GCGGCGCCTGCAGCTGCCTGGGG + Intergenic
961449379 3:126995543-126995565 AAGGAGCCAGCCCCTGGCTGAGG + Intronic
961565465 3:127760479-127760501 GTGGCGCCTGAGCCTGGATGAGG - Intronic
962893983 3:139697805-139697827 GAGCCTCCTGCACCTGACTCTGG + Intergenic
963847928 3:150178753-150178775 GAAGCGCCTGATCCTGGGTGAGG + Intergenic
966878386 3:184336230-184336252 GAGGAGCCTGCACCGGGAGGCGG + Intronic
967100243 3:186210204-186210226 TGTGCGCCTGCAGCTGGCTGTGG + Intronic
967777188 3:193396606-193396628 AAGGTGCCTGCAGCTGGGTGCGG - Intergenic
967945243 3:194798924-194798946 GAGGCACCTGGGGCTGGCTGAGG + Intergenic
967946223 3:194806266-194806288 GGGGCGACTGCTCCTGGCTTGGG - Intergenic
967992003 3:195138474-195138496 GGGCCGCCTGCACCCAGCTGTGG - Intronic
969032622 4:4226812-4226834 GAGGCGCTTGCAGCTGCCCGGGG + Exonic
969269969 4:6092799-6092821 GAGGCCCCTGCACCTGAATCTGG - Intronic
969499017 4:7541963-7541985 GGGGGTCCTGCACATGGCTGGGG - Intronic
969614483 4:8244412-8244434 GAGTTCCCTGCACCTGCCTGAGG - Intergenic
972374289 4:38456311-38456333 GAAGTGGCTGCACCTGGCTCAGG + Intergenic
973534428 4:51867183-51867205 TGGGCACCTGCACCTGGATGAGG + Intronic
978506033 4:109457416-109457438 CAGGTGCCAGCACCTGGCTAGGG + Intronic
978823157 4:112989507-112989529 GAGGCTGCTGCACCTGTCAGAGG - Intronic
980825671 4:138069757-138069779 TAAGCCACTGCACCTGGCTGTGG - Intergenic
985531520 5:436453-436475 GAGGCGCAGGCACCTGGCATTGG - Exonic
985680458 5:1253245-1253267 GAGGACCCTGCACCTGGATGGGG - Exonic
985988800 5:3538588-3538610 GAGGCTGCTGAACCTGGGTGGGG - Intergenic
997383204 5:133452026-133452048 CAGGAGCCCACACCTGGCTGGGG + Intronic
998039932 5:138945472-138945494 GAGGTGCCAGCGCCTGGATGAGG - Intergenic
999245203 5:150150557-150150579 CAGCCTCCTGCACCAGGCTGGGG + Intronic
999648431 5:153742129-153742151 GAAGAGATTGCACCTGGCTGAGG + Intronic
1001566134 5:172700656-172700678 GAGGCGGCTCGAGCTGGCTGGGG - Intergenic
1002559393 5:180071471-180071493 GCGGCGCCAGCACCTGGCCGCGG + Exonic
1004709518 6:18155988-18156010 GAGGCGGCTGCAGCTGGCACCGG + Intronic
1005187565 6:23180373-23180395 CTGGCGCCTGCAGCTTGCTGGGG - Intergenic
1007508935 6:42360690-42360712 CTGGCTCCTGCACCAGGCTGTGG - Intronic
1010447877 6:75968820-75968842 GAGGGTCCTGCATCTGGTTGAGG - Intronic
1012834682 6:104250878-104250900 GAGGGGCCTGCATCTGGCAAGGG - Intergenic
1013479671 6:110543109-110543131 GATTCCCCTGCACCTCGCTGTGG - Intergenic
1015910089 6:138161571-138161593 GCGGCGCCTGCACCACGCTGGGG + Intergenic
1017096351 6:150808800-150808822 GTGGCCCCTGGACCTGGCTTTGG + Intronic
1017925812 6:158910844-158910866 GAGGCGACTGCCCCTGCCGGGGG - Intergenic
1018150276 6:160931163-160931185 GAGGCGCAGGCACGGGGCTGGGG + Intergenic
1018289973 6:162282106-162282128 GTGGCGCCAGAACCTGTCTGTGG - Intronic
1019143580 6:169962868-169962890 GAGGTGGCTGCAGCAGGCTGGGG - Intergenic
1019395527 7:816188-816210 GAGGGGTCTGCACCTGGGGGAGG - Intergenic
1019395535 7:816207-816229 GAGGGGTCTGCACCTGGGGGAGG - Intergenic
1019422556 7:957868-957890 GAGGCGGCTGCCTCTGGCTCTGG - Intronic
1019525431 7:1478477-1478499 GGGGCTCCTGCGCCTGGCCGAGG - Exonic
1019631689 7:2052971-2052993 GAGGCTCCTCCACCAGCCTGAGG + Intronic
1019632014 7:2054458-2054480 GAGGGAGCTGGACCTGGCTGTGG - Intronic
1020220834 7:6235387-6235409 GAATCGCTTGAACCTGGCTGAGG + Intronic
1020280215 7:6646502-6646524 GTGGCCTGTGCACCTGGCTGGGG + Intronic
1021728751 7:23575740-23575762 GAATCGCCTGAACCTGGCGGTGG - Intergenic
1022520706 7:31005227-31005249 TCAGCCCCTGCACCTGGCTGAGG + Intergenic
1023837966 7:44079606-44079628 GAAGCCCCTGCAGCTGGCTCAGG + Exonic
1023881328 7:44323225-44323247 GAGCTGCCTGCTCCTGGCTTGGG + Intronic
1026188513 7:68103085-68103107 GAGGTGCCTGCACCCCGCCGAGG + Intergenic
1026688297 7:72531490-72531512 CAGGCGCCTGGGCCTGGTTGAGG - Intergenic
1026723532 7:72853374-72853396 CAGGCGCCTGGGCCTGGTTGAGG - Intergenic
1026858526 7:73770219-73770241 GCTGCGCCTGCACCTGCCTGTGG + Exonic
1031406700 7:121395875-121395897 GCGGCGTCTGCACCTGGCGCTGG - Intronic
1032125979 7:129193172-129193194 GAGAGGCCTGCAGCTGGCAGTGG + Intronic
1033654039 7:143361808-143361830 GACCCGCCTGCACCTGTCAGCGG - Intronic
1035081803 7:156222383-156222405 CAGGCTTGTGCACCTGGCTGGGG + Intergenic
1037855390 8:22367556-22367578 GTGGAGGCTGCACCTGGCCGTGG + Intronic
1038459396 8:27703268-27703290 GCAGCACCTGCACCTGGCAGAGG + Intergenic
1039892642 8:41695435-41695457 GTGGGGCCTCCACGTGGCTGCGG - Intronic
1040786808 8:51176323-51176345 TGGGCGCCTGCATCTGGATGAGG + Intergenic
1044558774 8:93592204-93592226 GAGGCACCTCCAGCTGGCTTGGG + Intergenic
1047495106 8:125403644-125403666 GAGGAGCCTGCATCCAGCTGTGG + Intergenic
1049299555 8:141862373-141862395 TAGTCTCCTGCACCCGGCTGAGG + Intergenic
1049517177 8:143066524-143066546 GAATCGGCTGCACATGGCTGTGG + Intergenic
1051710722 9:19927956-19927978 GGGTCTGCTGCACCTGGCTGGGG + Intergenic
1051855521 9:21559946-21559968 GAGGCGCCTGGACGGGGCTGCGG + Intergenic
1052303087 9:26975129-26975151 GAGGCGGCAGCAGCTGCCTGAGG + Intronic
1055954066 9:81757597-81757619 GAGTTGCCTGGACCTGGCTGGGG - Intergenic
1056593894 9:87989325-87989347 CAGGCCACTGCACCTGGCTGAGG + Intergenic
1059311300 9:113390617-113390639 GAGCCGCCAGCGGCTGGCTGAGG - Exonic
1059432244 9:114257278-114257300 GAGGCTCCTGGAGCTGGCAGAGG + Intronic
1060182560 9:121544573-121544595 CAGGCAGGTGCACCTGGCTGAGG - Intergenic
1060435191 9:123586797-123586819 GAGGCACCGGCACCTGGCGACGG - Intronic
1060897039 9:127224942-127224964 GCGGGGCCTGCTCCGGGCTGAGG + Intronic
1061226821 9:129285146-129285168 GAGTCGCCAGCACCTGGTTCTGG + Intergenic
1061611871 9:131752122-131752144 TAAGCCACTGCACCTGGCTGAGG + Intergenic
1061764931 9:132875668-132875690 GATGCTCCTGCACCTGCCTGCGG + Intronic
1061791324 9:133060791-133060813 AAGGGGCCTGCAGGTGGCTGGGG - Intergenic
1061795002 9:133081358-133081380 AAGGGGCCTGCAGGTGGCTGGGG - Intronic
1062282984 9:135760197-135760219 GCTGCTGCTGCACCTGGCTGTGG - Intronic
1062348823 9:136128794-136128816 TGGCTGCCTGCACCTGGCTGCGG - Intergenic
1062561290 9:137143243-137143265 GAAGAGCCTGGGCCTGGCTGGGG - Intronic
1062589833 9:137268647-137268669 AAGGGGCCTGCATCTGGCTGGGG + Intronic
1062628638 9:137454036-137454058 GAGGAGCCTGGGCCGGGCTGGGG + Intronic
1062628655 9:137454074-137454096 GAGGAGCCTGGGCCGGGCTGGGG + Intronic
1062628672 9:137454112-137454134 GAGGAGCCTGGGCCGGGCTGGGG + Intronic
1062628689 9:137454150-137454172 GAGGAGCCTGGGCCGGGCTGGGG + Intronic
1062628706 9:137454188-137454210 GAGGAGCCTGGGCCGGGCTGGGG + Intronic
1062628723 9:137454226-137454248 GAGGAGCCTGGGCCGGGCTGGGG + Intronic
1186290611 X:8093710-8093732 GAGGAGCCTGCAGTTTGCTGTGG + Intergenic
1186488871 X:9955618-9955640 GAGTCGCCACCACCAGGCTGGGG - Intergenic
1192279339 X:69667803-69667825 GAGGGGCCTGCATCTGGCGAGGG + Intronic
1197775784 X:130117916-130117938 GGTCCGCCTGCACCGGGCTGTGG - Intergenic
1198385490 X:136125176-136125198 GAGGCCCCAGCATTTGGCTGTGG + Intergenic
1200124569 X:153807231-153807253 GCGGCTCCCGCAGCTGGCTGCGG + Intronic