ID: 903825914

View in Genome Browser
Species Human (GRCh38)
Location 1:26145741-26145763
Sequence TTCCTAGGGCAGCCTGTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903825914_903825920 -9 Left 903825914 1:26145741-26145763 CCAGATACAGGCTGCCCTAGGAA No data
Right 903825920 1:26145755-26145777 CCCTAGGAAGGGTGGGAGCTTGG No data
903825914_903825923 0 Left 903825914 1:26145741-26145763 CCAGATACAGGCTGCCCTAGGAA No data
Right 903825923 1:26145764-26145786 GGGTGGGAGCTTGGCTGAGTGGG No data
903825914_903825925 29 Left 903825914 1:26145741-26145763 CCAGATACAGGCTGCCCTAGGAA No data
Right 903825925 1:26145793-26145815 GCCACTGAGGCAGACCCTGAAGG No data
903825914_903825922 -1 Left 903825914 1:26145741-26145763 CCAGATACAGGCTGCCCTAGGAA No data
Right 903825922 1:26145763-26145785 AGGGTGGGAGCTTGGCTGAGTGG No data
903825914_903825924 16 Left 903825914 1:26145741-26145763 CCAGATACAGGCTGCCCTAGGAA No data
Right 903825924 1:26145780-26145802 GAGTGGGCTCTCAGCCACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903825914 Original CRISPR TTCCTAGGGCAGCCTGTATC TGG (reversed) Intergenic
No off target data available for this crispr