ID: 903829633

View in Genome Browser
Species Human (GRCh38)
Location 1:26166820-26166842
Sequence CTGTGGTTGTATAAGTGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903829633_903829634 -8 Left 903829633 1:26166820-26166842 CCTGTGCACTTATACAACCACAG No data
Right 903829634 1:26166835-26166857 AACCACAGACAGCTGCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903829633 Original CRISPR CTGTGGTTGTATAAGTGCAC AGG (reversed) Intergenic
No off target data available for this crispr