ID: 903833490

View in Genome Browser
Species Human (GRCh38)
Location 1:26188653-26188675
Sequence CCGTGGGCTGCGCTGTGTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 183}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903833490_903833498 0 Left 903833490 1:26188653-26188675 CCCCCACACAGCGCAGCCCACGG 0: 1
1: 0
2: 0
3: 19
4: 183
Right 903833498 1:26188676-26188698 ACCTCCTTTGGCTCTCTGACAGG 0: 1
1: 0
2: 1
3: 11
4: 178
903833490_903833501 6 Left 903833490 1:26188653-26188675 CCCCCACACAGCGCAGCCCACGG 0: 1
1: 0
2: 0
3: 19
4: 183
Right 903833501 1:26188682-26188704 TTTGGCTCTCTGACAGGTGCTGG 0: 1
1: 0
2: 0
3: 21
4: 405
903833490_903833506 24 Left 903833490 1:26188653-26188675 CCCCCACACAGCGCAGCCCACGG 0: 1
1: 0
2: 0
3: 19
4: 183
Right 903833506 1:26188700-26188722 GCTGGGCTGGAGTTGGGAGCTGG 0: 1
1: 0
2: 10
3: 96
4: 778
903833490_903833504 17 Left 903833490 1:26188653-26188675 CCCCCACACAGCGCAGCCCACGG 0: 1
1: 0
2: 0
3: 19
4: 183
Right 903833504 1:26188693-26188715 GACAGGTGCTGGGCTGGAGTTGG 0: 1
1: 0
2: 10
3: 89
4: 646
903833490_903833505 18 Left 903833490 1:26188653-26188675 CCCCCACACAGCGCAGCCCACGG 0: 1
1: 0
2: 0
3: 19
4: 183
Right 903833505 1:26188694-26188716 ACAGGTGCTGGGCTGGAGTTGGG 0: 1
1: 1
2: 4
3: 55
4: 475
903833490_903833507 25 Left 903833490 1:26188653-26188675 CCCCCACACAGCGCAGCCCACGG 0: 1
1: 0
2: 0
3: 19
4: 183
Right 903833507 1:26188701-26188723 CTGGGCTGGAGTTGGGAGCTGGG 0: 1
1: 0
2: 8
3: 81
4: 662
903833490_903833509 30 Left 903833490 1:26188653-26188675 CCCCCACACAGCGCAGCCCACGG 0: 1
1: 0
2: 0
3: 19
4: 183
Right 903833509 1:26188706-26188728 CTGGAGTTGGGAGCTGGGCTGGG 0: 1
1: 0
2: 8
3: 81
4: 725
903833490_903833508 29 Left 903833490 1:26188653-26188675 CCCCCACACAGCGCAGCCCACGG 0: 1
1: 0
2: 0
3: 19
4: 183
Right 903833508 1:26188705-26188727 GCTGGAGTTGGGAGCTGGGCTGG 0: 1
1: 1
2: 6
3: 109
4: 689
903833490_903833503 11 Left 903833490 1:26188653-26188675 CCCCCACACAGCGCAGCCCACGG 0: 1
1: 0
2: 0
3: 19
4: 183
Right 903833503 1:26188687-26188709 CTCTCTGACAGGTGCTGGGCTGG 0: 1
1: 0
2: 4
3: 41
4: 327
903833490_903833502 7 Left 903833490 1:26188653-26188675 CCCCCACACAGCGCAGCCCACGG 0: 1
1: 0
2: 0
3: 19
4: 183
Right 903833502 1:26188683-26188705 TTGGCTCTCTGACAGGTGCTGGG 0: 1
1: 0
2: 1
3: 18
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903833490 Original CRISPR CCGTGGGCTGCGCTGTGTGG GGG (reversed) Exonic
903013027 1:20343822-20343844 CAGTGGGCGGGGCTGTGCGGAGG - Intronic
903217599 1:21851935-21851957 CCGTGGGCAGAGGTGTGAGGGGG + Intronic
903547396 1:24134666-24134688 CAGGGGGCTGGGATGTGTGGGGG - Intronic
903704021 1:25271791-25271813 TCCTGGGCTGCCCTGTGAGGAGG + Intronic
903723215 1:25421521-25421543 TCCTGGGCTGCCCTGTGAGGAGG - Intronic
903833490 1:26188653-26188675 CCGTGGGCTGCGCTGTGTGGGGG - Exonic
904133963 1:28296759-28296781 CCTTGGACTCCTCTGTGTGGGGG + Intergenic
912722524 1:112032201-112032223 TCCTGGGCTGCGCTGTGTGCGGG + Intergenic
914802986 1:150974248-150974270 CCGTGGGCTTCCCTTTGTTGGGG - Intronic
917977750 1:180251118-180251140 CCCTGGCCTGGGCTGTGGGGTGG - Intronic
919818077 1:201454458-201454480 CCTTGGGCTGCTCTCTGTGGTGG - Intergenic
920370002 1:205472943-205472965 GCGTGGGCTGAGGTGAGTGGAGG + Intergenic
920394880 1:205637709-205637731 CCGTGTGCTGAGCTCTGTGCTGG + Intergenic
920864907 1:209743872-209743894 CCGTGGACTGTGCTCTGGGGTGG - Intergenic
922892484 1:229072573-229072595 CCCCCGGCTGCCCTGTGTGGAGG - Intergenic
1065967755 10:30783097-30783119 GGGTGGGCTGCCCTGTGTCGTGG + Intergenic
1067370633 10:45678673-45678695 CCCGGGGCCGCGCTGTGAGGTGG + Intergenic
1067389142 10:45847470-45847492 CCCGGGGCCGCGCTGTGAGGTGG - Exonic
1067502332 10:46816371-46816393 CCCGGGGCCGCGCTGTGAGGTGG + Intergenic
1069635685 10:69923504-69923526 CCATGGGCTGGGCTCTGTGTGGG + Intronic
1070136364 10:73697878-73697900 CCCGGGGCCGCGCTGTGAGGTGG - Exonic
1072636393 10:97181226-97181248 CAGAGGCCTGCGCTGTGTAGGGG - Intronic
1072701063 10:97641422-97641444 CCGGGGGCTCAGCGGTGTGGTGG + Intronic
1073776250 10:106789088-106789110 CAATGGCCTGAGCTGTGTGGTGG + Intronic
1075711601 10:124533741-124533763 CCGTGTGCTCCGCAGTGTGCAGG + Intronic
1076138325 10:128060295-128060317 CCGTGGAGTGCTCTGTGTGTGGG - Intronic
1076139441 10:128068021-128068043 CCGTGGGCTCCCCTGTGCTGGGG - Intronic
1076345641 10:129777274-129777296 TGGGGGTCTGCGCTGTGTGGAGG - Intergenic
1076405152 10:130206723-130206745 CTGTGGGGTGCGCTGTGGGATGG + Intergenic
1076847634 10:133077105-133077127 TCCTGGGCTGGGCTGGGTGGGGG - Intronic
1077022090 11:421456-421478 CTGTGGCCTCCCCTGTGTGGGGG - Intronic
1077022121 11:421596-421618 CTGTGGCCTCCCCTGTGTGGGGG - Intronic
1077198794 11:1295226-1295248 CCGAGGGCTGCTCTGTGGGGAGG + Intronic
1077227583 11:1445123-1445145 CCGTGGCCTGCGCTGGGTGCGGG + Intronic
1078326763 11:10387573-10387595 CCGTGAGATGCTCTGTGTGGCGG - Intronic
1081611793 11:44567355-44567377 CTGGCGGCTGCGCTGTGTGCAGG + Intronic
1083142942 11:60736559-60736581 CCAGGGGCTGAGCAGTGTGGTGG - Intronic
1083861945 11:65424912-65424934 CCGTGGGCGTTGCAGTGTGGGGG + Intergenic
1084148869 11:67278852-67278874 CCCTGGGCTGCAGTGAGTGGGGG + Intronic
1088363190 11:109012409-109012431 CTTTGGGCTGCCCTGTGTTGGGG - Intergenic
1089794503 11:120969432-120969454 CTGTGGGCAGGGCTGTGTGCAGG + Intronic
1090409042 11:126495130-126495152 CCCTGGGCTGTGCTGTGTGTGGG + Intronic
1090715841 11:129430049-129430071 CCAAGGGCTGCCCTCTGTGGAGG - Intronic
1091885169 12:4011757-4011779 GAGTGGGCTCCGCTGTGTGTTGG - Intergenic
1092263029 12:6962591-6962613 CTGAGGGCTGTGCTGTGAGGTGG + Intergenic
1096795891 12:54077348-54077370 CCGTGGGCAGGGGTGTGTGGAGG + Intergenic
1101131814 12:101697818-101697840 GCGCGGGCTGCGCTCGGTGGCGG + Exonic
1103072637 12:117957501-117957523 CCGTGTGCTGCTCTGGGTGTGGG - Intronic
1103902451 12:124310476-124310498 CAATGGGCTGAGCTGTGGGGAGG + Intronic
1104964950 12:132504694-132504716 CCCAGGGCTGGGCTGGGTGGTGG + Intronic
1105609453 13:21955240-21955262 CCATGGGCTGAGCTCTGTGTTGG + Intergenic
1105645335 13:22312065-22312087 CCGCAGGCTGCGAGGTGTGGAGG - Intergenic
1113404279 13:110023547-110023569 AGGCGGGCTGCCCTGTGTGGTGG + Intergenic
1113894601 13:113755543-113755565 CCCTGGGCTGCTCTCAGTGGTGG + Intergenic
1113940022 13:114014199-114014221 AAAGGGGCTGCGCTGTGTGGTGG - Intronic
1114126599 14:19734138-19734160 CCATTGTCTGTGCTGTGTGGTGG - Intronic
1114665068 14:24372794-24372816 CCATGGGATGAGCTGAGTGGGGG - Intronic
1115642387 14:35342839-35342861 CCGTGCCCTGTGCTGGGTGGGGG - Intergenic
1119788204 14:77328099-77328121 CTGTGAGCTGCCCAGTGTGGGGG + Intronic
1122468226 14:101948720-101948742 CCGTGGGCTGGGTTGTGGAGCGG + Intergenic
1122672894 14:103385628-103385650 CCGCCGGCGGCGCTGTGTGGAGG + Exonic
1123161948 14:106287125-106287147 CCGTGGGCAGCTCTGCGTCGAGG + Intergenic
1124268777 15:28261950-28261972 CCTTGGGCTGCGTTGTGTGTGGG - Intronic
1124716309 15:32065740-32065762 CAGTGGGCTGTGTTGTGTGCTGG - Intronic
1124716331 15:32065893-32065915 CAGTGGGCTGTGTTGTGTGCTGG - Intronic
1127923741 15:63517554-63517576 CAGTGGGCTTCACTGTGAGGTGG + Intronic
1128944617 15:71812057-71812079 CCGTGGGCTGCGCCCTGCCGGGG - Exonic
1129376652 15:75137997-75138019 CAGTGGGCTGTGCTGCCTGGAGG - Intergenic
1133810103 16:9155029-9155051 CCCTGCCCTGAGCTGTGTGGAGG - Intergenic
1134072959 16:11272112-11272134 CCTTGGGCTACCCTGTGGGGAGG - Intronic
1135199298 16:20422919-20422941 CTGTGGGATGAGCTGTCTGGTGG + Intronic
1135219404 16:20600726-20600748 CTGTGGGATGAGCTGTCTGGTGG - Intergenic
1135273256 16:21086805-21086827 GCCTGGGCTGCGCTGCTTGGGGG + Intronic
1138103949 16:54277041-54277063 CAGTGGCCTGCGCAGAGTGGAGG - Intergenic
1138547038 16:57726088-57726110 CCGCGGGCTTCGCTGGGTTGCGG - Exonic
1139024990 16:62805432-62805454 AGGTAGGCTGGGCTGTGTGGTGG + Intergenic
1139349865 16:66328180-66328202 ACATCAGCTGCGCTGTGTGGTGG - Intergenic
1139924863 16:70480445-70480467 CTGTGTGCTGCACTGTGTGTGGG + Intergenic
1141787662 16:86212721-86212743 CCATGGTCTGTGCGGTGTGGAGG - Intergenic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1142667643 17:1471769-1471791 CCCTGGGCTGCCCTTGGTGGAGG - Intronic
1145273270 17:21415777-21415799 CTACGGGCTGCGCTGTGTGACGG + Exonic
1145311460 17:21703221-21703243 CTACGGGCTGCGCTGTGTGACGG + Exonic
1148439280 17:47703239-47703261 GCGTGGGCTGCGGTTAGTGGTGG + Intronic
1148600816 17:48892945-48892967 TTGTGGGCTGGGCAGTGTGGAGG + Intronic
1152073880 17:78147162-78147184 CCTTTGGCTGGGCTGTTTGGAGG + Intronic
1152229803 17:79108787-79108809 TCCTGGGCTGCGCAGGGTGGTGG + Intronic
1152853315 17:82649617-82649639 GCGGGGGCTGTGCTGTGTGAGGG - Intergenic
1152931421 17:83112043-83112065 CCGTGCTCAGCGGTGTGTGGTGG + Intergenic
1153985955 18:10351044-10351066 CCGAGGACTGCCCGGTGTGGGGG - Intergenic
1155364570 18:25036818-25036840 CCATGGGCTGTGGTGTGGGGAGG + Intergenic
1156702458 18:39841783-39841805 TTGCGGGCTGCGCTGGGTGGGGG - Intergenic
1157534898 18:48450969-48450991 GCATGGGCTGGGCTGTGTGGAGG + Intergenic
1161042005 19:2115281-2115303 CCGTGGGCAGCGAGCTGTGGCGG + Exonic
1161084015 19:2325634-2325656 CCGAGGGCCGCCCTGTGCGGTGG + Intronic
1161245391 19:3249055-3249077 CCGCCAGCTGGGCTGTGTGGTGG - Intronic
1161736838 19:5996738-5996760 CCGAGGCCTCCCCTGTGTGGCGG + Intronic
1162721377 19:12664881-12664903 ACTTGGGCTGCGCTTTCTGGAGG - Exonic
1164548790 19:29190676-29190698 CAGCGGGGTGCACTGTGTGGGGG + Intergenic
1165394753 19:35558164-35558186 CTGTGGGCGGGGCTGGGTGGTGG + Intronic
1166217500 19:41345090-41345112 CCTTCGGCTGAGCTGTGTGAAGG - Intronic
1166337464 19:42116999-42117021 CCGTGAGCTGCGGGGTGTCGGGG + Intronic
1166689357 19:44813372-44813394 ACGTGGGCTGGGGTGGGTGGCGG + Intronic
1167096081 19:47375716-47375738 CCATGGGCTGTGGGGTGTGGGGG + Intronic
1168092682 19:54095989-54096011 CCCAGGGCTGCGCGGAGTGGCGG + Exonic
1168152670 19:54457204-54457226 CCGTGGGCTGTGGGGCGTGGGGG + Intronic
925034849 2:677166-677188 CCGTGGGCGGGGCCTTGTGGCGG - Intronic
927888171 2:26731075-26731097 CCGGGGGCTGCCCGGGGTGGGGG - Exonic
929108500 2:38386877-38386899 CGGTGGGCTCTGCTGTGAGGTGG - Intergenic
930091365 2:47533758-47533780 CCGTGGGCTGCTCTATTTGTTGG + Intronic
934488385 2:94738511-94738533 CTGTGGGCTGAGCTGTGCTGGGG + Intergenic
936080580 2:109429960-109429982 GGGTGGGCTGTGCTCTGTGGAGG - Intronic
937230882 2:120397544-120397566 CTGGGAGCTGGGCTGTGTGGAGG - Intergenic
937754283 2:125516604-125516626 CCGGTGGCTTCGCTGTGTGCTGG + Intergenic
937904072 2:127043486-127043508 TCCTCGGCTGCGCTGTTTGGAGG - Intergenic
948321965 2:237076944-237076966 CCATGGGCTGGGATGTTTGGGGG - Intergenic
948834885 2:240621113-240621135 CAGTGGGGTCCTCTGTGTGGGGG - Intronic
948866735 2:240778945-240778967 CCGTGTGGAGCGCTGTGTGTAGG - Intronic
948888883 2:240897299-240897321 CCGTGGGCTACCCTGTGAGGTGG - Intergenic
949021722 2:241744541-241744563 CAGTGAGCTGCTGTGTGTGGAGG + Intronic
1172230634 20:33333471-33333493 CCATGGTTTGGGCTGTGTGGTGG - Intergenic
1173520000 20:43692289-43692311 CCGTGGGCTGGGCACTCTGGAGG - Exonic
1174281206 20:49440870-49440892 CTTTGGGCTGGGCTGTGGGGAGG + Intronic
1174597550 20:51696185-51696207 CCGTGTGCTGTGCGGTGGGGAGG + Intronic
1175192979 20:57223934-57223956 CCGAGGGCCGCCCTGTGAGGGGG + Intronic
1175943008 20:62546501-62546523 CCGTGGGAAGCGCTGTGGCGTGG + Intergenic
1176045780 20:63091961-63091983 CTGTGGGGTGCTCTGTGAGGAGG - Intergenic
1177640327 21:23836416-23836438 CCGTGGACAGCTCTGAGTGGTGG + Intergenic
1179503653 21:41825399-41825421 CCGAGGGCTGCACGGTGAGGGGG - Intronic
1179715008 21:43282012-43282034 CCGGGGGCTGGGCTGTGATGGGG - Intergenic
1179790036 21:43751009-43751031 CGGTGGCTTGAGCTGTGTGGGGG + Intronic
1181030225 22:20145945-20145967 CCCTGGCCTGCTCTGGGTGGTGG + Intronic
1181030647 22:20147556-20147578 CCGTGGGTTGGGCTGGGTGGGGG + Exonic
1181125490 22:20699611-20699633 CTGTGGGGTGCTCTGTGGGGTGG + Intergenic
1181512664 22:23395826-23395848 CCGTGGAGTGGGCTGGGTGGGGG - Intergenic
1181695257 22:24589778-24589800 CCCTGGGCTGGGCACTGTGGTGG - Intronic
1182027939 22:27134931-27134953 GCCTGTGCTGAGCTGTGTGGGGG + Intergenic
1183489108 22:38107367-38107389 CGGGGGGCTGGGCTGTGTTGGGG + Intronic
1183927566 22:41216986-41217008 TCGTGGGCAGCGCTGTGAGAGGG + Intronic
1183931757 22:41239524-41239546 CTGTGGGCAGCGCTGGGCGGCGG + Exonic
1185276445 22:49951997-49952019 AGGTGGGCTGGGCTGAGTGGGGG - Intergenic
950504661 3:13387295-13387317 CCATGGGCAGGGCTCTGTGGCGG + Intronic
952965386 3:38617861-38617883 CCGTGGGGTGCCCTGTGGGTGGG - Intronic
954655292 3:52190755-52190777 CTGTAGGGTGCACTGTGTGGGGG + Intergenic
955965021 3:64380294-64380316 CGGTGGCCTGCGCTGGGTGCTGG + Intronic
956797921 3:72732850-72732872 CTGTGGGCTGGGCTCAGTGGGGG - Intergenic
956798245 3:72735266-72735288 CTGTGGGCTGGGCTCAGTGGGGG + Intergenic
968451511 4:678214-678236 GTGTGGGCTGTGCTGTGTTGTGG + Intronic
968523499 4:1045122-1045144 CCCTGGCCTGCACTGTGGGGAGG - Intergenic
971452127 4:26810046-26810068 CTGTGGCCTGCCCTGTGTGAGGG - Intergenic
979352926 4:119667043-119667065 CCATGGGCTACCCTGGGTGGTGG - Intergenic
986187464 5:5458378-5458400 CAGTGGGCTTCATTGTGTGGAGG + Intronic
993109844 5:83643488-83643510 CCGTGTGGGGCCCTGTGTGGTGG - Intronic
997632225 5:135377534-135377556 TCGTGGGCTGCACTGTGTTGGGG + Intronic
999224975 5:150014184-150014206 CCGAGGTCTGCACTGTGTGAAGG - Intronic
1002133181 5:177093550-177093572 AGGTGCGCTGAGCTGTGTGGGGG + Exonic
1002916626 6:1534039-1534061 CCGTAGTGTGAGCTGTGTGGTGG + Intergenic
1002916666 6:1534389-1534411 CCGTAGTGTGAGCTGTGTGGTGG + Intergenic
1006642511 6:35496557-35496579 CCGGGGGCCGCACAGTGTGGAGG - Intronic
1011755301 6:90492889-90492911 CAGTGTGCTGTGCTGTGTGAGGG + Intergenic
1014632484 6:123803703-123803725 CCGCGGGCTGCGCAGGGAGGCGG + Intergenic
1015951410 6:138557320-138557342 CTGTGGGCAGTGCTGTCTGGTGG - Intronic
1017539197 6:155382826-155382848 CACTGGTCTGCACTGTGTGGTGG + Intergenic
1019406582 7:887206-887228 CGGTGGGCAGCTCAGTGTGGTGG + Intronic
1022638025 7:32155573-32155595 CTCTGGGCTGTGTTGTGTGGAGG - Intronic
1024479372 7:49848279-49848301 CCGTGGGAGGCTCTGAGTGGAGG - Intronic
1026413655 7:70155215-70155237 CCGTGGGCTGAGCTCTGGGGAGG + Intronic
1029664528 7:101986622-101986644 CCGTGGGCTCTGCTGCCTGGAGG + Intronic
1029724334 7:102392376-102392398 CCATGGGCTTGGCAGTGTGGTGG - Intronic
1031147514 7:118013608-118013630 CCATGTGCTGCTCAGTGTGGGGG + Intergenic
1031977514 7:128103537-128103559 CCGTCCGCTGCGCTGAGTGGAGG + Intergenic
1032081978 7:128863793-128863815 CCCTGGGCTGGACTGTTTGGGGG - Intronic
1032239962 7:130153077-130153099 CTGAGGGCTGTGCTGTGCGGAGG + Intergenic
1032823842 7:135550381-135550403 CCCTGGGCAGCAGTGTGTGGAGG - Intergenic
1033176974 7:139133812-139133834 GCGCGGCCTTCGCTGTGTGGTGG + Exonic
1034870075 7:154676048-154676070 CCATGGGGTGTGCTGTCTGGAGG + Intronic
1034870164 7:154676481-154676503 CCATGGGGTGTGCTGTCTGGAGG + Intronic
1035055388 7:156031812-156031834 CCGTGGCCAAGGCTGTGTGGAGG - Intergenic
1035243657 7:157548550-157548572 CCGGGGCCTGCGCTTTGTGGAGG - Intronic
1037478271 8:19278814-19278836 ACTTGGGCTGAGCTTTGTGGGGG - Intergenic
1043016021 8:74941201-74941223 CCTTGGGCTGGGCTGTCTGATGG + Intergenic
1048915837 8:139182023-139182045 CCGTGGCCTGAGCTGTATGTTGG - Intergenic
1050382402 9:5043020-5043042 CCCTGGGCCCTGCTGTGTGGAGG + Intronic
1053669405 9:40345854-40345876 CTGTGGGCTGAGCTGTGCTGGGG - Intergenic
1053785512 9:41650019-41650041 CTGTGGGCAGGGGTGTGTGGAGG + Intergenic
1053919201 9:42972095-42972117 CTGTGGGCTGAGCTGTGTTGGGG - Intergenic
1054159519 9:61664154-61664176 CTGTGGGCAGGGGTGTGTGGAGG - Intergenic
1054174231 9:61863971-61863993 CTGTGGGCAGGGGTGTGTGGAGG + Intergenic
1054380535 9:64485874-64485896 CTGTGGGCTGAGCTGTGCTGGGG - Intergenic
1054449090 9:65393038-65393060 CTGTGGGCAGGGGTGTGTGGAGG + Intergenic
1054479293 9:65595157-65595179 CTGTGGGCAGGGGTGTGTGGAGG - Intergenic
1054515211 9:66030437-66030459 CTGTGGGCTGAGCTGTGCTGGGG + Intergenic
1054663306 9:67716810-67716832 CTGTGGGCAGGGGTGTGTGGAGG - Intergenic
1056709887 9:88983858-88983880 CCGTGGGAAGAGCAGTGTGGGGG - Intergenic
1061617797 9:131791768-131791790 CCGTGGGCTAAGCGGTGGGGAGG + Intergenic
1062108127 9:134766830-134766852 CCTGGGGCTGCTCTCTGTGGTGG + Intronic
1062214926 9:135384071-135384093 CCTTGGGCTGCCCTCTCTGGTGG - Intergenic
1062399716 9:136367089-136367111 CGGTGGGCTGGGCTGGGTGGAGG - Intronic
1185554294 X:1008214-1008236 CCGAGGGCTGAGTTGTGAGGTGG - Intergenic
1190743403 X:53305836-53305858 CTTTGGGCTGCACTGTGTGGTGG - Intronic
1200077496 X:153558582-153558604 CCGGGGGCTGGGATGTTTGGGGG - Intronic
1200134202 X:153867023-153867045 CCCTGGGCTGAGCTGCCTGGGGG - Intronic
1200239486 X:154486375-154486397 GCGTGGGCTTCGCCGTCTGGGGG - Intronic