ID: 903834050

View in Genome Browser
Species Human (GRCh38)
Location 1:26191229-26191251
Sequence CACCATAGGAAGCCTCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 171}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903834050_903834058 21 Left 903834050 1:26191229-26191251 CCAGGCAGAGGCTTCCTATGGTG 0: 1
1: 0
2: 2
3: 12
4: 171
Right 903834058 1:26191273-26191295 CTGCCCTCTTCCAGGACGCCTGG 0: 1
1: 0
2: 1
3: 22
4: 248
903834050_903834053 -4 Left 903834050 1:26191229-26191251 CCAGGCAGAGGCTTCCTATGGTG 0: 1
1: 0
2: 2
3: 12
4: 171
Right 903834053 1:26191248-26191270 GGTGACACCTGCCTGAAGGAAGG 0: 1
1: 0
2: 1
3: 22
4: 221
903834050_903834059 22 Left 903834050 1:26191229-26191251 CCAGGCAGAGGCTTCCTATGGTG 0: 1
1: 0
2: 2
3: 12
4: 171
Right 903834059 1:26191274-26191296 TGCCCTCTTCCAGGACGCCTGGG 0: 1
1: 0
2: 1
3: 12
4: 182
903834050_903834052 -8 Left 903834050 1:26191229-26191251 CCAGGCAGAGGCTTCCTATGGTG 0: 1
1: 0
2: 2
3: 12
4: 171
Right 903834052 1:26191244-26191266 CTATGGTGACACCTGCCTGAAGG 0: 1
1: 0
2: 0
3: 14
4: 156
903834050_903834056 13 Left 903834050 1:26191229-26191251 CCAGGCAGAGGCTTCCTATGGTG 0: 1
1: 0
2: 2
3: 12
4: 171
Right 903834056 1:26191265-26191287 GGAAGGTCCTGCCCTCTTCCAGG 0: 1
1: 1
2: 4
3: 24
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903834050 Original CRISPR CACCATAGGAAGCCTCTGCC TGG (reversed) Intronic
900356580 1:2267973-2267995 CAGCCTGGGAGGCCTCTGCCCGG - Intronic
900488346 1:2934213-2934235 CACCATGGGATTCCGCTGCCTGG - Intergenic
900932307 1:5745087-5745109 CAGCCTGGGAAGCCTTTGCCTGG - Intergenic
903834050 1:26191229-26191251 CACCATAGGAAGCCTCTGCCTGG - Intronic
905445962 1:38028673-38028695 CACCTCAAGAACCCTCTGCCAGG - Intergenic
906473564 1:46151416-46151438 CAAAAGAGGAGGCCTCTGCCAGG - Intronic
906686428 1:47766135-47766157 CACCATCGGCAGCCTCGTCCTGG + Intronic
906992700 1:50755678-50755700 CCCCACAGCAAGCTTCTGCCTGG + Intronic
909447142 1:75759981-75760003 CACCATACCCAGCCTCTGCTGGG - Intronic
910120827 1:83788191-83788213 CACCACAGGAAGCCTCTAGAAGG - Intergenic
920783718 1:209020331-209020353 CCCCATAGCAAACTTCTGCCTGG - Intergenic
924581042 1:245324273-245324295 CACCATAGGGAGTCTATTCCAGG - Intronic
924730481 1:246706959-246706981 CACCTTTGCAAGCCTCTGCTAGG - Intergenic
1062813458 10:482344-482366 GACCATGGGAGGCCTCTTCCTGG + Intronic
1062955789 10:1539486-1539508 CACCATAGGTAGCCTAGTCCCGG - Intronic
1063576608 10:7267085-7267107 TCACATAGGAACCCTCTGCCTGG - Intronic
1064859454 10:19811684-19811706 CAACACAAGAAGCCTGTGCCAGG + Intergenic
1067098256 10:43316352-43316374 CACCAGGGGAAGCCTGGGCCTGG + Intergenic
1067522760 10:47020660-47020682 CAGCCCAGGAAGGCTCTGCCAGG + Intergenic
1067724904 10:48762631-48762653 CAGCTTAGGAACCCTTTGCCAGG - Intronic
1070445486 10:76496730-76496752 CCCCAAAGGAAGCATCAGCCAGG - Intronic
1076235425 10:128860660-128860682 CAGCATGGGAAGCATCTGCCCGG + Intergenic
1076738082 10:132467627-132467649 CCCCAAAGCCAGCCTCTGCCCGG + Intergenic
1077408497 11:2393014-2393036 GGCCAGATGAAGCCTCTGCCAGG - Intronic
1078431872 11:11294326-11294348 TCACATAGGCAGCCTCTGCCTGG + Intronic
1079134108 11:17766529-17766551 CAGCAGAGGGACCCTCTGCCTGG - Intronic
1081968266 11:47182588-47182610 CCCCAAAGGAAGCTTCTCCCTGG - Intronic
1082229419 11:49745191-49745213 CCCCATAGCAAACTTCTGCCTGG + Intergenic
1082615034 11:55349284-55349306 CACCAGAGGAACCCTGGGCCAGG - Intergenic
1083471296 11:62885861-62885883 TACCATAGCAAACATCTGCCAGG - Intronic
1084007249 11:66329947-66329969 CACCACAGGGAGCTGCTGCCTGG - Intergenic
1085421865 11:76369686-76369708 TCACATAGGCAGCCTCTGCCTGG - Intronic
1085894091 11:80616540-80616562 CACTATATCCAGCCTCTGCCAGG + Intergenic
1085894708 11:80624833-80624855 CTCCATAGGAAACCATTGCCTGG + Intergenic
1086620665 11:88883931-88883953 CCCCATAGCAAACTTCTGCCTGG - Intronic
1088290118 11:108227032-108227054 CAACAGAGGAAGGCTCTGCGGGG - Intronic
1088686686 11:112290040-112290062 TGCCGTAGGAAGCCCCTGCCAGG + Intergenic
1089597630 11:119591279-119591301 CAGAAGAGGGAGCCTCTGCCAGG + Intergenic
1090321175 11:125844905-125844927 TACCATAGGGAGGCCCTGCCTGG - Intergenic
1090856960 11:130618241-130618263 CACTACAGGTAGCCTCTGGCTGG + Intergenic
1091420807 12:338468-338490 TACCCTGGGAAGCCTGTGCCTGG + Intronic
1100682846 12:96947930-96947952 GACCATAGGCAGCCTCTGCCTGG + Intronic
1101199797 12:102423010-102423032 CAACATAGGAATCTTCTGCTAGG - Intronic
1101259636 12:103014890-103014912 CACCAGAGAAATGCTCTGCCGGG + Intergenic
1101692772 12:107096920-107096942 CACCACAGAAAACTTCTGCCTGG - Intergenic
1101979579 12:109393903-109393925 CACTATAGCAACCCTCTTCCCGG - Intronic
1102261536 12:111446195-111446217 CAGCACAGGAAGCATCTGCAGGG + Intronic
1102473981 12:113176753-113176775 AACCAGAGGAAGGCTCTGCCAGG - Intronic
1103940368 12:124498259-124498281 CACCATGGTAAGCGTGTGCCAGG - Intronic
1104265818 12:127231708-127231730 TTACATAGGAACCCTCTGCCCGG - Intergenic
1106504715 13:30361027-30361049 AACCATATGAAGCCAGTGCCTGG + Intergenic
1109749592 13:66672417-66672439 CCCCATAGCACACCTCTGCCTGG - Intronic
1110559762 13:76898329-76898351 CTCCATAGCAAACTTCTGCCTGG + Intergenic
1110901826 13:80834159-80834181 CCCCATAGCAGGCTTCTGCCTGG + Intergenic
1112039680 13:95534297-95534319 AACCATATGAAGCTACTGCCAGG + Intronic
1112798547 13:103084713-103084735 CATCATAGCAAGACCCTGCCTGG - Intergenic
1115645087 14:35363719-35363741 CTCCATTGGAAGCCTCTGTCCGG + Intergenic
1117186058 14:53242134-53242156 CACCATTGGATCACTCTGCCTGG + Intergenic
1118788152 14:69064085-69064107 CACCTTAGGAAGCCAGTGCTAGG - Intronic
1119115899 14:72021231-72021253 GTGGATAGGAAGCCTCTGCCTGG + Intronic
1119155433 14:72405782-72405804 CACCAAAGAAGGCCCCTGCCAGG - Intronic
1122346609 14:101064920-101064942 CGCCAAAGGAATCCTCTGCTGGG + Intergenic
1122851804 14:104537465-104537487 CATTAAAGGAAGCTTCTGCCTGG + Intronic
1122863444 14:104593022-104593044 CCCCACACGCAGCCTCTGCCTGG + Exonic
1122954065 14:105061690-105061712 CAACACAGGAAGCCTCTGCCTGG - Intronic
1125534964 15:40437453-40437475 CATCATAGGAAGCCCCTGGGGGG - Intergenic
1129412661 15:75358604-75358626 TCCCATAGGAAGCCTGTGCTGGG - Exonic
1129661683 15:77556296-77556318 CACCATACCAAGGTTCTGCCAGG + Intergenic
1130652948 15:85772622-85772644 CTCCAAAGGGAGTCTCTGCCTGG - Intronic
1130876321 15:88017721-88017743 CAACACAGGGAGCCTGTGCCTGG - Intronic
1133218289 16:4306781-4306803 CACCAGAAGCAGCCTCTTCCCGG + Intergenic
1133734921 16:8607671-8607693 CACCATGGCCAGCCGCTGCCTGG + Intergenic
1135382970 16:22008933-22008955 CACCAGAGGAAGCTGCGGCCGGG + Intronic
1138581637 16:57945391-57945413 GACCCCAGGAAGCCTCTGGCTGG - Intronic
1140629528 16:76834744-76834766 CACCTTAGGAAGCCTTTTGCTGG + Intergenic
1141411360 16:83835462-83835484 ACCCATGGGAAGCCTCTGCAGGG + Intergenic
1142349780 16:89574822-89574844 CAGCACAGGCAGCCTCGGCCTGG - Intergenic
1143772230 17:9175989-9176011 CGCCATAGGAAGCCGCTGGGTGG - Intronic
1144637959 17:16923080-16923102 CACTGTAGGAAGCCCCTACCTGG - Intergenic
1147557388 17:41488181-41488203 CAGCTTAGGAAGCCACTGCTGGG - Intronic
1147835825 17:43330940-43330962 CTGCATAGGAAGCATTTGCCAGG + Intergenic
1149868566 17:60163630-60163652 CTCCAAAGGAAGCCCCTCCCTGG - Intronic
1151863842 17:76786571-76786593 GAGCATAGGAAGCCTGTGTCTGG - Intergenic
1157677047 18:49576765-49576787 CAACATAGCAAGCTTCTGGCTGG - Intronic
1159640658 18:70859628-70859650 CCTCATAGGAAACCTCTGCTAGG + Intergenic
1160018390 18:75161805-75161827 CATCCCAGGAAGCCTGTGCCCGG - Intergenic
1161320613 19:3639091-3639113 GACCGTATGAAGCCCCTGCCTGG - Intronic
1161442176 19:4298157-4298179 CACCAACGGCAGCCTCAGCCTGG - Exonic
1163005833 19:14396195-14396217 CACCATAGGATGCCTCTGTGTGG + Intronic
1163551800 19:17969573-17969595 CACCTTAGGACGCGGCTGCCAGG + Intronic
1165064363 19:33220336-33220358 GACCATGAGAAGCCTCAGCCAGG - Intronic
1165227989 19:34367577-34367599 CACCTTAGCAAGCCTCTCACTGG + Intronic
1166255583 19:41601946-41601968 GACCCTGGGAAGCCTGTGCCGGG + Intronic
1166713550 19:44952164-44952186 GAGCATAGGAAGGCTCTGCAGGG + Intronic
1167366245 19:49056342-49056364 CCCCACTGGAAGCCCCTGCCGGG - Exonic
1167450635 19:49566484-49566506 CAACATAGCAAGACCCTGCCTGG - Intronic
928019312 2:27689487-27689509 CATCCTTGGAAGCCTGTGCCAGG - Intronic
929553838 2:42911588-42911610 TACCATAGGAAGCTTCTGAAGGG - Intergenic
932597283 2:73101861-73101883 AACCAGAGGAGGCCTCAGCCAGG + Intronic
935324608 2:101924969-101924991 CCCCATAGCAGGCTTCTGCCTGG - Intergenic
936059180 2:109283344-109283366 CCCCATTGCCAGCCTCTGCCAGG + Intronic
941468152 2:165854703-165854725 CACCCTAGGGAGGCTCTCCCAGG - Intergenic
943978001 2:194508514-194508536 CACCACAGGCAGCCTGGGCCAGG - Intergenic
947277951 2:228416043-228416065 TTCCAAAGGAAGCCTCTCCCTGG - Intergenic
947697713 2:232206063-232206085 CACCATGGGAGGCCTGTGCAGGG + Intronic
1168774821 20:438778-438800 CACCATATCAGGCCTCTGCTGGG + Exonic
1171266138 20:23773511-23773533 AACCATAGGAAGCAGCTGCAGGG - Intergenic
1173248077 20:41349875-41349897 CACCTTAGGCAGCCTCCCCCAGG - Exonic
1173249373 20:41356645-41356667 CTCCATAGGAAGCCCCTCCTTGG - Intronic
1175900083 20:62356611-62356633 TCCCAGAGGAGGCCTCTGCCCGG + Intronic
1178676929 21:34638970-34638992 CAAGATGTGAAGCCTCTGCCTGG - Intergenic
1179569256 21:42268422-42268444 TACCACAGGAAGCCTCTGGCTGG + Intronic
1179593639 21:42427822-42427844 AACCAAAGGAAGGCTCTGCCGGG + Intronic
1179878928 21:44285512-44285534 CACCCTGGGCAGCCCCTGCCAGG + Intergenic
1180224892 21:46386470-46386492 CTCCATTGGGAGCCTGTGCCTGG + Intronic
1181013892 22:20057382-20057404 CTCCAGAGGAGGCATCTGCCTGG + Intronic
1181424172 22:22822361-22822383 CCCCACTGGAAGCCTCTGCTGGG - Intronic
1181445814 22:22973341-22973363 AACCATTAGAGGCCTCTGCCTGG + Intergenic
1181446962 22:22984435-22984457 AACCATAGGAAACTTCTTCCTGG + Intergenic
1183358491 22:37371682-37371704 CACCATGGTAACCCTGTGCCTGG - Exonic
1185294288 22:50045725-50045747 GACCATGGGAGGCCTCTCCCCGG + Intronic
953133310 3:40161467-40161489 CACCAGGGCAAGTCTCTGCCTGG - Intronic
953496074 3:43387877-43387899 CTCCACAGGAAGCCTCTCCCTGG - Intronic
956285345 3:67602998-67603020 CACCACAGGAACCATCTGTCTGG + Intronic
958637471 3:96763520-96763542 CCCCATAGCAAACTTCTGCCTGG - Intergenic
961528487 3:127524597-127524619 CAGCTTGAGAAGCCTCTGCCTGG - Intergenic
961739821 3:129026255-129026277 CACCCCAGGCAGCCTGTGCCAGG + Intronic
963004810 3:140717115-140717137 CATCATAGGTATCTTCTGCCAGG - Intergenic
964545424 3:157828626-157828648 CACTATAGCAGGCTTCTGCCTGG + Intergenic
966926781 3:184649516-184649538 AACTATAGGAAACCTCTGGCTGG + Intronic
968517563 4:1021246-1021268 CAGGAAAGGAGGCCTCTGCCAGG + Intronic
969350831 4:6597002-6597024 CTGCAGAGGCAGCCTCTGCCAGG - Intronic
969993052 4:11283869-11283891 CCCCATAGCAAACTTCTGCCTGG + Intergenic
972565735 4:40267477-40267499 AAATATAGGAAGCCTCTTCCTGG - Intergenic
972872143 4:43313216-43313238 CCTCATAGAAAGCCTCTGCTAGG + Intergenic
975614377 4:76231823-76231845 GACCATAGGAACCCTGTGCAGGG + Intronic
983889495 4:173016158-173016180 CACTATAGCACACCTCTGCCCGG - Intronic
985883278 5:2657050-2657072 CACCACAGGAAGGGGCTGCCTGG - Intergenic
990982622 5:61615590-61615612 CAGCCTGGGAAGCCACTGCCTGG + Intergenic
993068104 5:83126524-83126546 CCCCATAGCAAGTCTCTGCCTGG - Intronic
995210031 5:109527257-109527279 CACCATTGCATCCCTCTGCCAGG + Intergenic
997648063 5:135494271-135494293 AGAGATAGGAAGCCTCTGCCGGG - Intergenic
997691116 5:135828108-135828130 CAGCATGGGAAACCTCTGGCGGG - Intergenic
1001561960 5:172675588-172675610 CAGGAGAGGAAGCTTCTGCCAGG + Intronic
1003827030 6:9964495-9964517 AAGCATAGGAAGCATCTGCAGGG + Intronic
1006535370 6:34695645-34695667 CCCCAGATGAACCCTCTGCCAGG + Intronic
1007916852 6:45569241-45569263 CACCAAAGGAAGCTTTCGCCTGG + Intronic
1011264066 6:85497307-85497329 CACCACAGTAAACTTCTGCCTGG + Intergenic
1011498418 6:87961664-87961686 CATCATAGGGAGACTGTGCCTGG - Intergenic
1014134424 6:117871620-117871642 AACTATAGGAAGCATGTGCCTGG - Intergenic
1014862783 6:126490596-126490618 TACCATTGGAAGTCTTTGCCAGG - Intergenic
1015310864 6:131765793-131765815 AACCAGAGGAAACCCCTGCCAGG - Intergenic
1016795181 6:148110164-148110186 CACCATGGTAAGCCTGTGCCGGG + Intergenic
1017525683 6:155239781-155239803 CCCCAGAGGAAACCTCTGCGAGG - Intronic
1017677659 6:156830306-156830328 CACCATGGGACGCCCCAGCCTGG - Intronic
1017951752 6:159141168-159141190 CACCATAGGGCTCCTCTGCAGGG + Intergenic
1018969936 6:168520381-168520403 CACCATATGTGTCCTCTGCCTGG + Intronic
1019594212 7:1850908-1850930 CCCCATAGGAAGCAGCTTCCGGG + Intronic
1021244019 7:18239693-18239715 AACTATAGGAAGACTCTGCCAGG - Intronic
1023725531 7:43139272-43139294 CACCATGGCAAACCTCAGCCTGG + Intronic
1023909643 7:44544262-44544284 CACCTGGGGCAGCCTCTGCCAGG - Intergenic
1024034374 7:45495162-45495184 CCCCATAGGGAGACCCTGCCCGG + Intergenic
1024570265 7:50717366-50717388 CACCACAGGAAGCAGTTGCCAGG + Intronic
1024929720 7:54657433-54657455 GCACATTGGAAGCCTCTGCCTGG - Intergenic
1025040929 7:55645216-55645238 GACCAGAAGAAGCCTCAGCCGGG - Intergenic
1032206000 7:129866048-129866070 CACCTGAGGCAGCCTGTGCCCGG + Intronic
1032414443 7:131725552-131725574 CTCCAGAGGCAGCCTGTGCCTGG + Intergenic
1035655385 8:1301305-1301327 CTCCATGAGAGGCCTCTGCCTGG + Intergenic
1037841557 8:22248809-22248831 CAACACAGGAACCCTCTGCGAGG - Intronic
1040537383 8:48322205-48322227 CACCATACAAAGCCTCGGCCAGG - Intergenic
1040600096 8:48874389-48874411 CATAATAGGAAGCATCAGCCGGG - Intergenic
1041710287 8:60888173-60888195 AACTATATGAAGCCTCTGCCAGG - Intergenic
1047117850 8:121865050-121865072 GACCATCGGAAGCCTCTGGTAGG - Intergenic
1049740988 8:144240782-144240804 CACCACAAGGAGGCTCTGCCAGG - Intronic
1052357282 9:27518058-27518080 CAGCATGTGAATCCTCTGCCAGG + Intronic
1054930621 9:70631170-70631192 CACCAGATGAAGCCCCTACCGGG - Intronic
1055030957 9:71770803-71770825 CAGCATAGGAGGCCTGTGCTGGG + Intronic
1056786603 9:89597103-89597125 CCCCACAGGAAGCCGCTGTCAGG - Intergenic
1058672061 9:107368017-107368039 CCCCAGAGGAAGCCTCTGTGTGG + Intergenic
1059923975 9:119187537-119187559 CACCATAGGACACATCTGCAGGG + Intronic
1062158711 9:135068104-135068126 CCCTGTGGGAAGCCTCTGCCGGG + Intergenic
1185658010 X:1701676-1701698 CAGCACAGGTGGCCTCTGCCAGG + Intergenic
1185658016 X:1701719-1701741 CAGCGGAGGTAGCCTCTGCCAGG + Intergenic
1187937750 X:24352515-24352537 TCACATAGGTAGCCTCTGCCTGG - Intergenic
1198476007 X:136999012-136999034 CAACATAGGAAGGCTGCGCCTGG - Intergenic
1200076684 X:153554708-153554730 AGCCATAGGAAGCCTGTGGCTGG + Intronic