ID: 903834406

View in Genome Browser
Species Human (GRCh38)
Location 1:26193602-26193624
Sequence GCGTGCCAGGCACTGTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1351
Summary {0: 1, 1: 10, 2: 60, 3: 273, 4: 1007}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903834406_903834413 20 Left 903834406 1:26193602-26193624 CCCCAGCACAGTGCCTGGCACGC 0: 1
1: 10
2: 60
3: 273
4: 1007
Right 903834413 1:26193645-26193667 AGGAAGTGACAAGGTTGCTGAGG 0: 1
1: 0
2: 2
3: 26
4: 291
903834406_903834412 11 Left 903834406 1:26193602-26193624 CCCCAGCACAGTGCCTGGCACGC 0: 1
1: 10
2: 60
3: 273
4: 1007
Right 903834412 1:26193636-26193658 GTGTTTTAAAGGAAGTGACAAGG 0: 1
1: 0
2: 5
3: 37
4: 346
903834406_903834411 0 Left 903834406 1:26193602-26193624 CCCCAGCACAGTGCCTGGCACGC 0: 1
1: 10
2: 60
3: 273
4: 1007
Right 903834411 1:26193625-26193647 ACAGGCAAAGTGTGTTTTAAAGG 0: 1
1: 0
2: 1
3: 24
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903834406 Original CRISPR GCGTGCCAGGCACTGTGCTG GGG (reversed) Intronic
900171844 1:1273239-1273261 GCGTGCCCGGGACTGTGCTTAGG - Intronic
900351676 1:2238024-2238046 CTGTGCCAGGCGCTGGGCTGTGG + Intronic
900630900 1:3634635-3634657 TCGTGCCAGGCACTGTGCTCTGG - Intronic
900653891 1:3745542-3745564 GTGTGCCGGGCACCGTCCTGGGG - Intergenic
900823869 1:4910910-4910932 GCCTGGCAGGCTCTGTCCTGTGG + Intergenic
900854040 1:5166432-5166454 GAGGGCCGGGCGCTGTGCTGGGG + Intergenic
901096903 1:6688906-6688928 ATGTGCCTGGCACTGTGCAGGGG + Intronic
901233402 1:7653788-7653810 ATGTGCCAGGCATTGTTCTGAGG + Intronic
901405360 1:9041445-9041467 GTGTGCCAGGCTCTGTGCTTGGG - Intronic
901438040 1:9261523-9261545 CTGTGCCAGGCAATGTGCAGGGG - Intronic
902081115 1:13821229-13821251 GCATACCAGGCACTTTGCTAAGG - Intronic
902115774 1:14119885-14119907 ATGTGCCAGGCACTGTTCTAAGG + Intergenic
902136939 1:14315268-14315290 GGTTGCCAGACACTGTGCTAGGG - Intergenic
902541433 1:17158355-17158377 ATGTGCCAGGCTCTGTGCTGGGG + Intergenic
902569645 1:17338931-17338953 GCATGTCAGGCACTGTACAGAGG - Intronic
902642312 1:17774746-17774768 TCGGGCCAGGCTCTGAGCTGCGG + Intronic
902706945 1:18212149-18212171 GGGTGCCGGGCACAGTGCTATGG + Intronic
902733698 1:18386197-18386219 ATGTGCCAGGCACTGTTCTAAGG - Intergenic
902783278 1:18717681-18717703 TCGTGCCAGGCTTTGTGCTGGGG - Intronic
903052082 1:20608948-20608970 GTGTGCCAGCCTCTGTGCTAAGG - Intronic
903096378 1:20979404-20979426 GCCTGCCAGTCACTGTTCTAGGG + Intronic
903127963 1:21260559-21260581 GCTTGCCAGGCTCTGTCCAGGGG - Intronic
903290638 1:22311942-22311964 GTGTGCCAGGCATGGTGCTGGGG - Intergenic
903294637 1:22335920-22335942 GGGTGCCAGGCTCTGTGATAAGG + Intergenic
903315741 1:22504381-22504403 GTGTGCCAGGCAGTGTGCTGAGG + Intronic
903325966 1:22568707-22568729 AAATGCCAGGCACCGTGCTGGGG + Intronic
903357803 1:22758814-22758836 AGGTACCAGGCTCTGTGCTGGGG - Intronic
903405034 1:23088903-23088925 GCCAACCAGGCCCTGTGCTGAGG - Exonic
903547579 1:24136269-24136291 ATGTGCCAGGCACTATGCTGAGG + Intronic
903582912 1:24385551-24385573 TTGTGCCATGCACTGTTCTGAGG + Intronic
903753752 1:25646611-25646633 GGCTGCCAGGGACTGGGCTGGGG - Intronic
903834406 1:26193602-26193624 GCGTGCCAGGCACTGTGCTGGGG - Intronic
903856432 1:26340245-26340267 GCATGCAAGGCACTGTGCTAAGG + Intronic
903989548 1:27256812-27256834 ATGTGCCAGGCATTGTGCTGAGG - Intronic
904052913 1:27651004-27651026 ATGTGCCAGGCCCTGTGCTAGGG + Intergenic
904189700 1:28734106-28734128 GAGGGCCAGGCAGTGTGCTGGGG - Intergenic
904288960 1:29471487-29471509 GGGTGCCTGGCACTGTGCTGGGG - Intergenic
904316638 1:29670241-29670263 GTGTGCTAGACTCTGTGCTGAGG + Intergenic
904330467 1:29755077-29755099 GTGTACCAGGCACTGTGCTGTGG - Intergenic
904371102 1:30047872-30047894 GTGTGTCAGGCACTGTGAAGGGG - Intergenic
904415573 1:30359250-30359272 GGATGCCCAGCACTGTGCTGGGG + Intergenic
904416209 1:30362518-30362540 GTGTGCCAGGCACTGTGCTAAGG + Intergenic
904444115 1:30553690-30553712 ACGTGCTAGGCACTATGCTAGGG - Intergenic
904447948 1:30589701-30589723 ACGTGCCTGGCCCTGTGCTGTGG - Intergenic
904615284 1:31746211-31746233 GTGTGCCAAGCAGGGTGCTGAGG - Intronic
904683877 1:32247296-32247318 GCGTGCCAGGGAGTGTGTGGTGG - Exonic
904822455 1:33255101-33255123 CTGTGCCAGGCACTGTGCTTGGG + Intergenic
905186432 1:36200375-36200397 GCATGCCAGGCACTGGGCTAGGG - Intergenic
905227084 1:36486079-36486101 GTGTGTCCGGCACTGTACTGAGG - Intergenic
905242144 1:36588262-36588284 GTGTGCCAGGCCCTGAGCTGGGG - Intergenic
905284951 1:36873185-36873207 GAGTGCCAGGCCCTGTGCTGGGG - Intronic
905410784 1:37766428-37766450 GGGCGCCATGCTCTGTGCTGCGG + Intergenic
905527512 1:38650067-38650089 TTATGCCAGGCACAGTGCTGGGG + Intergenic
905924134 1:41737919-41737941 ACTTGCCAGGCCCTGTGCTGGGG + Intronic
905980659 1:42223090-42223112 GTGTGCCAGGCATTGTACTAGGG - Intronic
906242789 1:44252237-44252259 GCCTGCCTGGCACAGGGCTGAGG - Intronic
906553015 1:46682098-46682120 GAGTACCAGGTACTGTGCTAGGG + Intronic
906601820 1:47137207-47137229 GTGTGCCAGGCAGTATGCTAGGG - Intergenic
906730841 1:48079837-48079859 CCGTTCCAGGCCCTGTGCTAGGG + Intergenic
906742879 1:48199446-48199468 ATGTGTCTGGCACTGTGCTGGGG + Intergenic
907049349 1:51319097-51319119 ACATGCCAGGCACTGTCCTAAGG + Intronic
907083880 1:51650961-51650983 GTGTACCAGACACTGTTCTGAGG + Intronic
907310687 1:53537333-53537355 GCACGCCAGGCACTGTGCTGGGG - Intronic
907323092 1:53618034-53618056 GCAGTCCAGGCCCTGTGCTGGGG + Intronic
907354398 1:53860610-53860632 CTGTGCCAGGCCCTGTGCAGGGG - Intronic
907375806 1:54038486-54038508 AGGAGCCAGGCACTGTGCTAGGG - Intronic
907380380 1:54082465-54082487 CTGTGCTAGGCACTATGCTGGGG + Intronic
907381514 1:54094693-54094715 ATGTGCCAGGCTCTGTGCTTGGG - Intronic
907413177 1:54296698-54296720 GCGTGCCAGGCACTGTTCCAGGG - Intronic
907526641 1:55057592-55057614 CAGTGCCAGGCTCTGTGCAGGGG + Intronic
907576106 1:55527226-55527248 CTGTGCTAGGCACTGTGCAGAGG - Intergenic
907707317 1:56844081-56844103 CTGTGCCAGGCAGTGTGCTGGGG + Intergenic
907724480 1:57006373-57006395 TGGTGCCAGTCACTGTGCTAAGG - Intronic
907834388 1:58095165-58095187 GTGAGCCAGGCTCTGTGCTGGGG - Intronic
907906399 1:58785988-58786010 GTGAGCCAGGCACTGAGCTGGGG + Intergenic
907944940 1:59127320-59127342 CAGTGCCAGGCACTGTGCTATGG + Intergenic
907944984 1:59127735-59127757 GTTTGCCAGGCACTGTGCTATGG + Intergenic
908113013 1:60915818-60915840 GGGGGCCAGGCTCTGTGCTATGG - Intronic
908281842 1:62547556-62547578 GTGTGCTAGGCACTATGCTGAGG - Intronic
908451761 1:64262933-64262955 GTATGCCAACCACTGTGCTGTGG - Intronic
908473690 1:64469674-64469696 GTGTGCCCGGCACTGGGCTCGGG - Intergenic
908766552 1:67559653-67559675 AGGTGGCAGGCACTGGGCTGAGG - Intergenic
908776811 1:67648645-67648667 CTGTGCCACGCCCTGTGCTGGGG + Intergenic
908784375 1:67720596-67720618 CTGTGCCAGGCACTGTGTTAAGG + Intronic
909277801 1:73710168-73710190 CCTTGCCTGGCATTGTGCTGTGG + Intergenic
910375884 1:86569853-86569875 ATGTGCCAGTCACCGTGCTGGGG - Intronic
910443887 1:87281315-87281337 GTGTGGCAGGCACTGCGCTCAGG - Intergenic
910486138 1:87716504-87716526 GTGTGCCAGGCATTGTTCTACGG + Intergenic
910706086 1:90131169-90131191 TGGTGCCAGGCACTGTGCTAGGG - Intergenic
910809267 1:91219377-91219399 GTGGGCCAGGCAGTGAGCTGTGG - Intergenic
910867797 1:91804005-91804027 TTGTGCCAGATACTGTGCTGGGG - Intronic
911101106 1:94096440-94096462 AAGGGCCGGGCACTGTGCTGAGG - Intronic
911499980 1:98673594-98673616 AGGTGTCAGGCACTGGGCTGGGG - Intronic
912323527 1:108736889-108736911 ATGTGCCAGGCACTGTTCTAAGG + Intronic
912429035 1:109619594-109619616 TCGTGCCAGGCACTGTGTAAAGG + Intronic
912511886 1:110195325-110195347 ACGGGCCAGGCCCTGTGCTGGGG + Intronic
912626465 1:111208776-111208798 GTATGCCTGGCACTGTGCTTAGG - Intronic
912700834 1:111877214-111877236 AAGTGCCAGGCACTGTGCCAGGG + Intronic
912711098 1:111950484-111950506 GGGCACCAGGCACAGTGCTGCGG - Intronic
912858984 1:113196241-113196263 AAGTGCCAGGCTCTGTGCTAGGG - Intergenic
912859116 1:113197374-113197396 CAGTGCCAGGCACTTTGCTAAGG - Intergenic
912962613 1:114209411-114209433 AGGTGCCAGTCACTGTGCTGAGG - Intergenic
913255783 1:116952120-116952142 GTGTGCCAGGCACTGGACTAAGG + Intronic
913594028 1:120356239-120356261 TAGTACCAGGCCCTGTGCTGAGG + Intergenic
914093228 1:144522751-144522773 TAGTACCAGGCCCTGTGCTGAGG - Intergenic
914305296 1:146411137-146411159 TAGTACCAGGCCCTGTGCTGAGG + Intergenic
914415895 1:147481611-147481633 GCGTGCTGCCCACTGTGCTGAGG + Intergenic
914452033 1:147800944-147800966 ATGTGCCAGGCACTGTTCTTAGG - Intergenic
914506247 1:148291750-148291772 ATGTGCCAGGTACTGTGCTAAGG - Intergenic
914596761 1:149161675-149161697 TAGTACCAGGCCCTGTGCTGAGG - Intergenic
914830067 1:151164855-151164877 TTATGCCAGACACTGTGCTGAGG - Intronic
914913063 1:151802110-151802132 CTAGGCCAGGCACTGTGCTGAGG + Exonic
915481118 1:156186028-156186050 GTGGGCCAGGCAGTGAGCTGTGG + Intergenic
915928541 1:160042678-160042700 ATGTGCCAGGCACTGTGCAGGGG + Intronic
916040555 1:160957604-160957626 GTGTGCCAGGCATTGTGCATAGG - Intergenic
916498129 1:165363827-165363849 TTATGCAAGGCACTGTGCTGAGG - Intergenic
916518554 1:165543004-165543026 AGGTGCCAGGCACTGTGCTTAGG + Intergenic
916582329 1:166120148-166120170 CTGTGCCAGGTGCTGTGCTGGGG + Intronic
916691286 1:167192446-167192468 GTGGGCCAGGCACTATGCTGGGG - Intergenic
916722283 1:167493476-167493498 CTGTGCCAGGCCCTGTGCTGAGG + Intronic
916743202 1:167663862-167663884 ATGTGCCAGGCACTGTGCTGGGG + Intronic
916768274 1:167882951-167882973 ATGTGCCAGGCACTGTTCTCAGG - Intronic
917455813 1:175184649-175184671 GTGTGCCAGACACTGTGCACTGG + Intronic
917977409 1:180249206-180249228 AAGTGTCAGGCACTGTCCTGAGG - Intronic
918323614 1:183388810-183388832 GTGTGCCAGGCATTGTTCTAGGG - Intronic
918371500 1:183866262-183866284 GTCTGCCAGGCATTGTGCTAAGG + Intronic
919300830 1:195763431-195763453 GCGTGCCTGGCTGTGTGCAGTGG + Intergenic
919709144 1:200708940-200708962 GTGGGCCAGTCACTGTGCTGAGG + Intergenic
920033843 1:203052986-203053008 TTGTGCCAGGCACAGTGCTAAGG + Intronic
920351734 1:205342474-205342496 TGGAGCCTGGCACTGTGCTGGGG + Intronic
920547621 1:206831614-206831636 ATGCGCCAGGTACTGTGCTGAGG + Intronic
920849564 1:209619378-209619400 AAGTGCCAGGCACTGTGCTGGGG - Intronic
920926730 1:210348533-210348555 ACATCCCAGGCACTGTGCTAGGG + Intronic
921246802 1:213251821-213251843 GTGTCCCAGGCACTGTGCCTAGG + Intronic
921290475 1:213652233-213652255 ACGTGCCTGGCACTGTGTTAAGG + Intergenic
921527638 1:216237698-216237720 GTGTGCCAGGCTCTGTGATAAGG - Intronic
921618264 1:217297464-217297486 GTTTGCCAGGCACTGTGCTAGGG + Intergenic
921917967 1:220633974-220633996 GTGTGCCAGGAACTGTTCTAAGG + Intronic
922412588 1:225390730-225390752 GGGTGCCATGCAGTGTTCTGAGG + Intronic
922570463 1:226631726-226631748 GTTTGACAGGCACTGTGCAGGGG + Exonic
923085821 1:230703108-230703130 CCTTGCCAGGCACTGTGTTCTGG + Exonic
923094951 1:230767729-230767751 CCATTCCAGGCACTATGCTGGGG + Intronic
923094956 1:230767761-230767783 GCATTCCAGGCACTATGCTGGGG + Intronic
923236847 1:232042391-232042413 GTGTGCCCAGCACTGTGCTAGGG + Intergenic
923497879 1:234540743-234540765 GAGTGCCAGGCACTGTGCTGGGG - Intergenic
923595128 1:235355351-235355373 GCATGCCAGGATCAGTGCTGAGG - Intergenic
923638694 1:235728240-235728262 GAGTGCCAGGAACTGTGTCGAGG - Intronic
924185191 1:241481318-241481340 CTGTGGCAGGCACTGTGCTAGGG - Intergenic
924195796 1:241605547-241605569 ATGTGCCAGGCACTGTGCAGTGG + Intronic
924225338 1:241917299-241917321 CCATGTGAGGCACTGTGCTGGGG - Intergenic
924300612 1:242633833-242633855 CTCTGTCAGGCACTGTGCTGAGG + Intergenic
924306172 1:242691284-242691306 GCGTGCCAGGCTCTGTGCTCTGG - Intergenic
924456008 1:244219502-244219524 CAGTGCCAGGCCCAGTGCTGGGG + Intergenic
924588878 1:245384331-245384353 ATATGCCAGGCACTGTGCTGAGG + Intronic
924606001 1:245536006-245536028 GTGTTCCAGGCACTGTGCTTGGG + Intronic
1063019562 10:2114292-2114314 CCCTGCTGGGCACTGTGCTGGGG - Intergenic
1063369148 10:5509529-5509551 ATGTGCCAGGCGCTGTGCTGAGG + Intergenic
1063410701 10:5834447-5834469 ACGTGCCAGGGACTGTGCTCAGG + Intronic
1063411452 10:5839756-5839778 ACGTGCCAGGGACTGTGCTCAGG - Intronic
1063602703 10:7496935-7496957 GCTTGTTATGCACTGTGCTGTGG + Intergenic
1064162680 10:12959504-12959526 GTTAGCCAGGCACTGTGCTGAGG - Intronic
1064164246 10:12973097-12973119 ACGTGCCAGGTGCTCTGCTGGGG + Intronic
1065841751 10:29707761-29707783 ATATGCCAGGCACTGTGCTAAGG + Intronic
1065843636 10:29726798-29726820 GTTTGCCAGGCCCTGTGCTGAGG - Intronic
1065863887 10:29896447-29896469 ATGTGCTAGGCACTGTGTTGAGG + Intergenic
1065888415 10:30099506-30099528 ATGTTCCAGGCACTGTGCTAGGG + Intronic
1066029149 10:31399774-31399796 GCCTACCAGGCTCTGTGCTCTGG + Intronic
1066250605 10:33629332-33629354 GTGTGCCAGGCACTATTCTAAGG + Intergenic
1066757737 10:38727756-38727778 GTGTGCCAGGCATTGTGCCCTGG + Intergenic
1067221340 10:44346385-44346407 GTGTGCCTGGCCCTGGGCTGAGG - Intergenic
1067339142 10:45387053-45387075 GCGTGCCAGGCGCCGTGTGGAGG + Intronic
1068934278 10:62621019-62621041 ACGTGCCTGGCACTGTGCTGGGG + Intronic
1069036730 10:63653308-63653330 GAGTGCTAGGCACTGTGCTATGG - Intergenic
1069708898 10:70476748-70476770 ACGTGCCAGGCACTGTGCTGTGG + Intergenic
1069747324 10:70724056-70724078 GTGTGCCAGGCACTGTGCCAAGG - Intronic
1069819851 10:71220699-71220721 GTGTGCCGGGCACTGTGCTAAGG - Intronic
1069862655 10:71481216-71481238 GGGTGCCGGTGACTGTGCTGGGG - Intronic
1069915808 10:71786009-71786031 ACACTCCAGGCACTGTGCTGAGG - Intronic
1070299739 10:75194551-75194573 ATGTGTCAGACACTGTGCTGGGG - Intergenic
1070787147 10:79168487-79168509 ACTGGCCAGGGACTGTGCTGGGG - Intronic
1070838108 10:79464106-79464128 GTGTGCCAGGCCTGGTGCTGAGG + Intergenic
1071685631 10:87752434-87752456 CTGTGCCAGGCACTATGCTGAGG + Exonic
1072003975 10:91224397-91224419 GTGTGTCAGGCACTGTGCTGGGG + Intronic
1072039265 10:91591600-91591622 GCATGTCAGGCGCTGTGCTAAGG - Intergenic
1072421425 10:95292791-95292813 CTATGCCAAGCACTGTGCTGGGG - Intergenic
1072661007 10:97363512-97363534 GTGTGCCCAGCACTGTGCTGAGG - Intronic
1072668078 10:97408994-97409016 CTGTGCCAGGCACTGGGCTAAGG - Intronic
1072743251 10:97922848-97922870 GTGTGCCAGGCACTGAGCCGTGG - Intronic
1072818286 10:98531034-98531056 CCGTGCCAGGCACTATACTATGG + Intronic
1072962806 10:99944616-99944638 ATGTGCCAGGCACTGTGCTAAGG - Intronic
1073029672 10:100515601-100515623 ACATGCCAGACACTGTGCTAGGG - Intronic
1073150733 10:101309818-101309840 GCCTCCCAGGCTCTGTGCTGAGG + Intergenic
1073489593 10:103844236-103844258 GGGTGCCAGGCACTGCGCTGAGG + Intronic
1074424409 10:113338402-113338424 GGGTGCCAAACACTGTGCTAGGG + Intergenic
1074445572 10:113518635-113518657 CTGAGCCAGGCCCTGTGCTGAGG + Intergenic
1074692412 10:116018334-116018356 ATGTGCCCAGCACTGTGCTGTGG + Intergenic
1074703220 10:116110271-116110293 CTGTGCCAGGCACTGGGCTATGG + Intronic
1074773324 10:116747631-116747653 GCAAGCCAGGCACTGGGCTGTGG - Intergenic
1074913760 10:117936437-117936459 GCTTGCCACGCACACTGCTGTGG - Intergenic
1075407901 10:122206751-122206773 GTGTGCAAGGCACTGTTCTCTGG + Intronic
1075532528 10:123241867-123241889 GCGTGCCAGGCACTGTTCTGGGG + Intergenic
1075539775 10:123302397-123302419 TTGTGCCAGGCACTGTGCTAAGG - Intergenic
1075630278 10:123996340-123996362 GAGTGCCACGCCCTGTGCTGGGG - Intergenic
1076054828 10:127364002-127364024 TAGTGCCAGGCACCGTGCTAGGG - Intronic
1076307509 10:129475379-129475401 GCCTCTCATGCACTGTGCTGAGG - Intronic
1076348357 10:129796373-129796395 ATGGGCCAGGCACTGTTCTGGGG + Intergenic
1076551215 10:131279171-131279193 GTGTGCCAGGCACTGTATCGGGG - Intronic
1076630149 10:131847457-131847479 GCGTGGCAGGCCCTGCGCTGTGG - Intergenic
1076796356 10:132800150-132800172 GCCTGGCTGGCCCTGTGCTGGGG - Intergenic
1076919056 10:133441910-133441932 GCGTGGCAGGCGGTGTGTTGGGG + Intergenic
1077036496 11:497979-498001 GCCAGCCTGGCTCTGTGCTGCGG - Exonic
1077245402 11:1534602-1534624 GTGTACCAGGCTCTGTGCTGGGG - Intergenic
1077406867 11:2386646-2386668 GAGTGCCAGGCACTGGGCAGAGG - Intronic
1077443368 11:2578910-2578932 GCTGGGCAGTCACTGTGCTGAGG - Intronic
1077574772 11:3374351-3374373 GGGTGTAAGGGACTGTGCTGGGG - Intronic
1077605792 11:3610846-3610868 TTGTGCCAGGCTCTGTGCTAGGG + Intergenic
1077651557 11:3977817-3977839 ACGTACCAGGCATTGTGCTAGGG - Intronic
1078020514 11:7652657-7652679 GGGTGCCAGCAGCTGTGCTGAGG + Intronic
1078059426 11:8033656-8033678 CCGTGCCAGGCCCTGGGTTGGGG - Intronic
1078102138 11:8336268-8336290 CCGTGCCAGGCACCAGGCTGTGG + Intergenic
1078469246 11:11573844-11573866 GGGTGCTGAGCACTGTGCTGGGG + Intronic
1078535595 11:12170890-12170912 CTGTGCCAAGCCCTGTGCTGGGG - Intronic
1078645883 11:13141113-13141135 TCGTGCTGGGGACTGTGCTGTGG + Intergenic
1078659344 11:13274509-13274531 GTATGCCAGGCACTGTGTTAAGG + Intergenic
1078700568 11:13677680-13677702 GCTTGACAGGCACTGTTCTAAGG - Intronic
1078740799 11:14064628-14064650 GTGTGCCACACCCTGTGCTGGGG + Intronic
1078746540 11:14120771-14120793 GTGTGCCAGGAACTGTGCTAAGG + Intronic
1078937486 11:15964615-15964637 ATGTGCCAAGCACTGTGTTGGGG + Intergenic
1079005021 11:16785453-16785475 GTGTGCCAGGCCCTGTGCCAGGG + Intronic
1079025014 11:16940183-16940205 ATGTGCCAGCCACTGTGCTAGGG - Intronic
1079131635 11:17750185-17750207 ATGTGCCAGCCACGGTGCTGGGG - Intronic
1079331275 11:19534996-19535018 ATGTCCCAGGCACTGTGCTAAGG - Intronic
1079390214 11:20015686-20015708 GTGTGCCAGGCATTGTGCTGGGG - Intronic
1079470050 11:20769537-20769559 CTGTGCCAGGCTCTGTACTGTGG - Intronic
1079621576 11:22562023-22562045 CTGTGCCAGGTACTGTGCTAAGG + Intergenic
1079670881 11:23169482-23169504 TTGGGCCAGGCACTGTTCTGAGG + Intergenic
1079743322 11:24092593-24092615 ATGTGCCTGGCACTGTTCTGTGG - Intergenic
1079941616 11:26687599-26687621 GCGTGCCAGGCACTGTTCTTGGG - Intronic
1080025484 11:27609615-27609637 CTGTGCCAGGCATTGTGCTCAGG + Intergenic
1080127605 11:28755475-28755497 GTGTACCAGGCACTGTGCTATGG - Intergenic
1080494229 11:32799962-32799984 ATGTGCCAAGCACTGCGCTGAGG - Intergenic
1080571314 11:33559552-33559574 GTGTGCCAGGCAGGGTGCTAAGG - Intronic
1080609386 11:33891076-33891098 TTGTGCCAGGTACTGTGCTTGGG - Intronic
1080646022 11:34188291-34188313 ACATGCCTGGGACTGTGCTGAGG + Intronic
1080700224 11:34638383-34638405 AGGTACCAGGCACTCTGCTGTGG + Intronic
1080758926 11:35228992-35229014 GTGTGCCAAGCACTGTGCTAGGG - Intronic
1081049123 11:38315688-38315710 GGGTGCCAGGCAGAGTCCTGAGG + Intergenic
1081237277 11:40660209-40660231 GTGTGCCTGGCAGTGTGCAGTGG + Intronic
1081569980 11:44284327-44284349 GCGGGCTGGGCTCTGTGCTGTGG + Intronic
1081651408 11:44826543-44826565 GTGTGCCAGGCACTGCTCTCAGG + Intronic
1081737550 11:45414491-45414513 AAATGCCAGGCTCTGTGCTGAGG + Intergenic
1081792354 11:45797208-45797230 GTGTGCAAGGTACTGTGCTAGGG + Intergenic
1081812480 11:45921883-45921905 GCGTGCCAGGCCCTGTGCTAAGG - Intronic
1081849693 11:46266378-46266400 GTGTGCCAGGCTCAGTGCTGAGG - Intergenic
1082004245 11:47410890-47410912 CTGTGCCAGGCACTGGGCTGAGG + Intronic
1082661791 11:55920696-55920718 GCATGCCTGGCAGTGTGCAGTGG + Intergenic
1082928048 11:58571743-58571765 ACATGCCAGGCACTGTGCTCAGG + Intronic
1083184108 11:61007685-61007707 GTGTGCCGAGCACTGGGCTGCGG + Exonic
1083213927 11:61206769-61206791 ACGTGCCAAGCACTGGGCTCAGG + Intronic
1083216811 11:61225598-61225620 ACGTGCCAAGCACTGGGCTCAGG + Intronic
1083219693 11:61244424-61244446 ACGTGCCAAGCACTGGGCTCAGG + Intronic
1083244141 11:61412734-61412756 GTGTGCCTGGCACTGTGCTAAGG - Intronic
1083581216 11:63826793-63826815 TCATGCCAGGCACTGGGCTGTGG + Intronic
1083603386 11:63962339-63962361 GGGTGCCAGGCACTGAGCCCTGG - Intergenic
1083669098 11:64290702-64290724 GTGTGCCAGGCTCTGTTTTGAGG + Intergenic
1083679654 11:64345245-64345267 GGGTGCCCAGCACTGAGCTGGGG + Intronic
1083713110 11:64560662-64560684 CAGAGCCAGGCACTGTGATGAGG - Intronic
1083965157 11:66039303-66039325 GTGTGCCAGGCCCTGTACTAGGG + Intergenic
1084114490 11:67033841-67033863 GCGTGCCAAGCGCGGTGCTGGGG + Intronic
1084418972 11:69050771-69050793 GCCCGCCGGGCCCTGTGCTGAGG - Intronic
1084433080 11:69122342-69122364 GTGTGCCAGGCACTGGGTAGGGG - Intergenic
1084445535 11:69201515-69201537 TTGTGCCAGGCACTTTGCTGGGG + Intergenic
1084471125 11:69359502-69359524 GTGAGCCAGCCACTGTTCTGAGG - Intronic
1084541161 11:69788037-69788059 GCTTGCCTGGAACTGTGCAGGGG - Intergenic
1084590533 11:70087600-70087622 ACGGGCCAGGCACTGTCCTAGGG - Intronic
1084598129 11:70129274-70129296 GGGTGCCAGGCACTGTTCCAAGG + Intronic
1084956558 11:72694640-72694662 GAGTGCCAGGCACTGGGCTAGGG - Intronic
1085029777 11:73264137-73264159 ATGTGCCAAGCACTGTGCTAAGG - Intergenic
1085043273 11:73339234-73339256 AGATGCCAAGCACTGTGCTGGGG - Intronic
1085215107 11:74822886-74822908 GTATGCCAGGCACTGTGTTAGGG + Intronic
1085295077 11:75426911-75426933 GTGTGCCAGGCTCTGTGCTCAGG + Intronic
1085321100 11:75574586-75574608 GGGTTCCAGGCACTGTGTTAGGG - Intergenic
1085450404 11:76628802-76628824 GTGTGTCAGGCCCTGGGCTGAGG + Intergenic
1085479587 11:76810192-76810214 GTGTGCCAGGCCCTGTGACGGGG - Intergenic
1085532980 11:77202706-77202728 GCGTGCCCAGCACTGTGATGAGG + Intronic
1085775961 11:79366657-79366679 GACTGCCAGGCACTGTACAGTGG - Intronic
1085816148 11:79739340-79739362 ATGTGCCAGACCCTGTGCTGGGG - Intergenic
1086262961 11:84962571-84962593 GCATGCCTGGCATTGTGCTAGGG - Intronic
1086270001 11:85051486-85051508 ACGTGCCAAGCACTATGCTAAGG + Intronic
1087062948 11:94000017-94000039 GTGTACCAGGCACTGTGCAATGG + Intergenic
1087693334 11:101347362-101347384 GTGTACCAAGCACTGTGCTAGGG + Intergenic
1087831242 11:102821787-102821809 GATTGCCAGGCACTGCGCTATGG - Intergenic
1087915841 11:103809930-103809952 ACGTGCCAGAGACTGTTCTGGGG + Intergenic
1087958410 11:104318538-104318560 AAGTGCCGGGCACTGTGCTAAGG + Intergenic
1088882774 11:113984510-113984532 CTGTGCCAGGCCCTGTGCTGGGG - Intronic
1089049447 11:115533740-115533762 GTGTGTCAGGCACTGTGCCAGGG + Intergenic
1089098699 11:115941552-115941574 GTGTGCCCAGCACTTTGCTGCGG - Intergenic
1089181585 11:116586984-116587006 ATGTGCCAGGAACTGTGCTAAGG - Intergenic
1089582689 11:119491290-119491312 ATGTTCCAGGCACTGTGCTGAGG + Intergenic
1089598959 11:119601589-119601611 GGGTGCCAGACACTGTTCTAAGG + Intergenic
1089654325 11:119935836-119935858 AAGTGCCAGGTGCTGTGCTGGGG + Intergenic
1089669180 11:120040593-120040615 ACTTGCCAGGGACTATGCTGGGG + Intergenic
1089701689 11:120248435-120248457 ATGTGCCAAGCACTGTGCTAAGG - Intronic
1089745496 11:120614121-120614143 GCAGGCCAGGCACTGCACTGAGG - Intronic
1089787320 11:120917367-120917389 ATGTGCCAGTCACTGTGCTGGGG + Intronic
1089921399 11:122212956-122212978 AGGTGCCAGGCATTGTGCTGAGG - Intergenic
1090277081 11:125427849-125427871 GGGTGCCAGGCACAGGGCTGTGG + Intronic
1090363951 11:126191014-126191036 GCGAGCCAGGCACGGTGCTGGGG - Intergenic
1090410883 11:126508853-126508875 CTATGACAGGCACTGTGCTGAGG - Intronic
1090422280 11:126583728-126583750 GCGTGCCAGGCACCGTACTGAGG - Intronic
1090607557 11:128437134-128437156 GCTTGCCAGGCACTCTGTTCTGG + Intergenic
1090992742 11:131834428-131834450 ATGTGGTAGGCACTGTGCTGGGG + Intronic
1091690365 12:2592294-2592316 ATGTGCCAGGCACCGTTCTGAGG + Intronic
1091845104 12:3649712-3649734 CCATGCCAGGCACTGTGTTGAGG - Intronic
1091964298 12:4724902-4724924 GCTTGCCAAGCCATGTGCTGTGG + Intronic
1092119404 12:6033653-6033675 GAGAGGCAGGCAGTGTGCTGGGG - Intronic
1092289751 12:7152681-7152703 ATGTGCCAGGCACTGTGCTCGGG + Intronic
1093348155 12:18065850-18065872 ATGTGCCAGACACTGTGCTAAGG + Intergenic
1093823669 12:23653905-23653927 GTGTGTCAGGCATTGTGCTAGGG - Intronic
1093867560 12:24247141-24247163 CCGTGCCAAATACTGTGCTGTGG + Intergenic
1094033650 12:26043081-26043103 CTGTGCCAGCCACTATGCTGAGG + Intronic
1094544994 12:31396318-31396340 GCTGGCCAGGCATTATGCTGAGG - Intronic
1094854468 12:34396804-34396826 GAGATCCAGGCACTGTGTTGTGG + Intergenic
1095597711 12:43978215-43978237 GTGGGCCAGGCAGTGAGCTGTGG + Intronic
1095886378 12:47192754-47192776 GTGTAACAGGCACTGTGCTGAGG + Intronic
1095947665 12:47763023-47763045 TCATGCCAGACACTGTGCTGGGG - Intronic
1095969384 12:47891314-47891336 GTGTGCCAGGCACCCTTCTGAGG - Intronic
1096240962 12:49960195-49960217 CTGTGCCAGGCACTGTGCTAAGG + Intergenic
1096638720 12:52977392-52977414 GTGTGTCAGACACAGTGCTGGGG + Intergenic
1096639425 12:52982312-52982334 GTGTGGCAGGTACTGTGCTAAGG + Intergenic
1096684569 12:53279494-53279516 ATGTGCCAGGCACTGTGCCCAGG - Intronic
1097087935 12:56482588-56482610 GTGTGCTAGGGACTTTGCTGAGG - Intronic
1097105568 12:56621643-56621665 GGATGACAGACACTGTGCTGGGG - Intronic
1097181155 12:57172803-57172825 GTGTGCCAGGCGCTGTCCTGGGG - Intronic
1097636639 12:62130625-62130647 ATGTGGCAGGCACTGTGCTAGGG + Intronic
1097691943 12:62741763-62741785 ACGTGCCAGGCACTGAGCACTGG - Intronic
1098056926 12:66517012-66517034 ACGTGCTAGGGACTGTTCTGAGG - Intronic
1098369333 12:69739562-69739584 ACGCGCGAGGCACCGTGCTGAGG + Exonic
1098551280 12:71764031-71764053 ATGTGCCAAGCACTGTGCTTGGG - Intronic
1098595244 12:72266642-72266664 CAGTGCCAGGCACTGTGCTAGGG - Intronic
1098854360 12:75635592-75635614 GTGAGCCAGGCACTGTTCTAAGG - Intergenic
1099295529 12:80823502-80823524 GCATGCCTGGCTCTGTGCAGTGG + Intronic
1099503889 12:83448241-83448263 TCTTGCCAGGCACTGTTCTAGGG + Intergenic
1099705246 12:86143984-86144006 ATGTGCTAGGCACTGTGCTAGGG - Intronic
1099857115 12:88181549-88181571 GTGGGCCAGGCAGTGAGCTGTGG + Intronic
1099981870 12:89613459-89613481 GAATGCCAGGCACTGTGCTTAGG + Intronic
1099982086 12:89616187-89616209 GTGTGCCAGGCACTATCCTAAGG - Intronic
1100461745 12:94806620-94806642 GTGTGCCAAGCACTGTGCTAAGG - Intergenic
1100596038 12:96072954-96072976 ATGTGCCAGGCACTGTTCTTGGG - Intergenic
1100635249 12:96429295-96429317 GAGTGCCAGGCACTGTTATGAGG + Intergenic
1100656933 12:96656887-96656909 ATGTGCTGGGCACTGTGCTGAGG + Intronic
1100789992 12:98119890-98119912 GTGTGCCTGCCACTGTGCTAAGG + Intergenic
1100888043 12:99094128-99094150 ATGTGCCAGGCACTGGGCTGTGG + Intronic
1101836802 12:108301538-108301560 ATGTGCCAGGCACTGAGCTGGGG - Intronic
1101845228 12:108358177-108358199 ATGTGCCAGGCACTGGGCTGGGG + Intergenic
1101886262 12:108665715-108665737 GTGTGTCTGGCTCTGTGCTGAGG - Intronic
1102347087 12:112167292-112167314 GAGTGCAAGGCACAGTTCTGGGG - Intronic
1102499120 12:113339099-113339121 AAGTGCCAGGCACTATGCTATGG - Intronic
1102507255 12:113391446-113391468 ACATGCCAGGCACTGTTATGAGG + Exonic
1102532865 12:113559581-113559603 GCATGCCAAGGACTGTGGTGGGG - Intergenic
1102594044 12:113978755-113978777 GGGACCCAGGCAGTGTGCTGGGG + Intergenic
1102762582 12:115401354-115401376 CTCTGGCAGGCACTGTGCTGGGG - Intergenic
1102859753 12:116325559-116325581 GTGTGCCAGGCCCTGTGCTAAGG + Intergenic
1103193794 12:119024919-119024941 GTGTGCCAGGGCCTGTTCTGGGG + Intronic
1103418854 12:120763634-120763656 GAGAGCCTGGCCCTGTGCTGTGG - Exonic
1103444424 12:120984891-120984913 GTGAGCCAGGCACCGTGCTGAGG - Intronic
1103673828 12:122640315-122640337 ATGTGCCAGGAACTGTTCTGGGG + Intergenic
1103837071 12:123830125-123830147 CCGTGCCAGGCAGTGGACTGGGG - Intronic
1103853182 12:123946621-123946643 GGGTGCCAGGCACTGTGCTAGGG - Intronic
1103972507 12:124680957-124680979 GCGTGGAGGGGACTGTGCTGGGG - Intergenic
1103978009 12:124716320-124716342 GTGTGCCCAGCACAGTGCTGGGG + Intergenic
1104512939 12:129398072-129398094 GTTTGCTAAGCACTGTGCTGAGG + Intronic
1104787820 12:131461226-131461248 CACTGCCAGGGACTGTGCTGAGG - Intergenic
1104827622 12:131724841-131724863 GTGAGCCAGGAACTGTGCAGGGG + Intronic
1105356307 13:19663192-19663214 CACTGCCAGGCACTGTGCTGGGG + Intronic
1105435955 13:20378518-20378540 TTGCGCCAGGCAGTGTGCTGGGG - Intergenic
1105830996 13:24162649-24162671 GTGTGCCAAGCACTGTTCTGAGG + Intronic
1105849715 13:24323182-24323204 TCTTGGCAGGCACTGTGGTGGGG - Intergenic
1106154444 13:27139817-27139839 GTGTGCCAGGAACTATGCTAAGG + Intronic
1106234494 13:27850730-27850752 GCTTGCCAACCACTGTGCTGAGG + Intergenic
1106322555 13:28655767-28655789 GTATGCAAGGCACTGTGCTGTGG + Intergenic
1106510581 13:30409046-30409068 GGGTGCCAGGCGCTGTCGTGGGG + Intergenic
1106698558 13:32204821-32204843 ACATGCTAGGCACTGTGCTTGGG + Intronic
1107456797 13:40562913-40562935 GTGTGCCCTGTACTGTGCTGGGG - Intronic
1108364348 13:49694911-49694933 CCGTGCCAGGTACTGTGCTATGG - Intergenic
1108380125 13:49847202-49847224 TCATGCAAGGCTCTGTGCTGTGG - Intergenic
1108604202 13:52020969-52020991 ATGTGTCAGGCACTGTTCTGGGG + Intronic
1109228812 13:59730243-59730265 GCGTGCCAGGCAGAGGCCTGAGG - Intronic
1109756451 13:66767201-66767223 GACTTCCCGGCACTGTGCTGGGG + Intronic
1111055168 13:82938954-82938976 GCATGCCTGGCTGTGTGCTGTGG + Intergenic
1112275360 13:98012925-98012947 TCTTGCCAGGCACAGTGCTCAGG - Intronic
1112433943 13:99377157-99377179 GTGTGTCAGGCTCTGTGTTGGGG + Intronic
1112716981 13:102198211-102198233 TCTTGCCTAGCACTGTGCTGTGG - Intronic
1112758728 13:102669812-102669834 GGGGGCCAGGCAGTGAGCTGTGG + Intronic
1113104770 13:106760098-106760120 ACATGCCAGGCTCTGAGCTGAGG - Intergenic
1113190750 13:107742808-107742830 GGGTGCCAGACCCTCTGCTGGGG - Intronic
1113406476 13:110045567-110045589 TCGTTCCAGGCACAGTTCTGCGG + Intergenic
1113406556 13:110046299-110046321 GCATTTCAGGCACTGTCCTGTGG + Intergenic
1113415588 13:110126054-110126076 CCGTCTCAGGCACTGTGCTGGGG + Intergenic
1113435048 13:110284876-110284898 AAGTGCCAGACAATGTGCTGTGG + Intronic
1113476931 13:110590612-110590634 ACCTGCCAGGCATTGTGCTGAGG - Intergenic
1113543039 13:111123703-111123725 GTATGCCAGGCACTGTTCTAAGG + Intronic
1113606646 13:111612626-111612648 GGGTGCCAGGCACATTGCTGTGG + Intronic
1113682010 13:112251131-112251153 GTGTGCCAGGCACATGGCTGGGG - Intergenic
1114267437 14:21081259-21081281 GAGTGGCAGGCTCTGTGCTAAGG - Intronic
1115114976 14:29869680-29869702 GTGTGCCAAGCACTATGCTATGG + Intronic
1116393210 14:44417929-44417951 AAGTGCCAGGCAGTGAGCTGTGG - Intergenic
1117273871 14:54172607-54172629 GGGTACCTGGCACTGTGCTCTGG - Intergenic
1117717748 14:58598204-58598226 CTGTTCCAAGCACTGTGCTGAGG - Intergenic
1117718012 14:58600417-58600439 GCCTGCCAGGCTATGTGTTGTGG - Intergenic
1118060406 14:62131801-62131823 ATGAGCCAGGCACTGTGCTAGGG + Intergenic
1118349063 14:64960633-64960655 GCGTGCCAGACCCTGTGTTATGG - Intronic
1118455849 14:65945338-65945360 TGCTGCCAGGCACTGGGCTGCGG - Intergenic
1118608789 14:67523427-67523449 ATGTGCCATGCACTGTGCTAAGG + Intronic
1118912937 14:70077043-70077065 GTATGCCAGTTACTGTGCTGTGG - Intronic
1119027604 14:71166419-71166441 GCCTGCCAGGCCCTCTGATGTGG + Intergenic
1119537439 14:75413934-75413956 GTGTGCCAGGCACTGTGTGGGGG + Intergenic
1119552384 14:75524326-75524348 ATGTGCCAGGCATTGTGCTGGGG + Intronic
1119616041 14:76099700-76099722 ATGTGCCAGGCGCTGTGCTGAGG + Intergenic
1119675557 14:76550878-76550900 GCATGCCAGGACCTGTGCTCTGG - Intergenic
1121295044 14:92813729-92813751 GAATACCAGGCACTGTGCTGGGG - Intronic
1121327323 14:93028804-93028826 GCGTCCCAGGCACGATGATGGGG + Intronic
1121425915 14:93851967-93851989 GTGTGTCAAGCACTGTGCTAGGG - Intergenic
1121488735 14:94342725-94342747 GTGTGCCAGGCACAGTTCTAGGG - Intergenic
1121521908 14:94591881-94591903 CTGCCCCAGGCACTGTGCTGGGG - Intronic
1121568901 14:94931669-94931691 GCAGACCAGGCCCTGTGCTGAGG - Intergenic
1121693911 14:95897124-95897146 TTGTGCCAGGCACTGTTCTGGGG + Intergenic
1121805801 14:96821205-96821227 ATGTGCCAGGAACTGTGCTAGGG - Intronic
1122014685 14:98784701-98784723 CCATGCCAGGCACTGTACTAGGG - Intergenic
1122105894 14:99454627-99454649 GTGTGCTAGGCACAGTGCTAAGG + Intronic
1122204596 14:100142285-100142307 GCCTGCCTGGCCCTGGGCTGGGG + Intronic
1122295671 14:100704412-100704434 TTGCGCCAGGCACTGTGCTGTGG - Intergenic
1122353866 14:101112167-101112189 GAGTGCCAGGCACCGTTCTGGGG - Intergenic
1122372084 14:101234447-101234469 GCGAGCCACTCCCTGTGCTGGGG + Intergenic
1122470502 14:101962891-101962913 GCGTGCTAGGCACCATGCAGAGG - Intergenic
1122772461 14:104103487-104103509 GAGGGCCAGGCACTGGGCTGGGG + Intronic
1122848876 14:104515989-104516011 GGGGGCCAGGCACTGTTCTAAGG + Intronic
1123088652 14:105731620-105731642 GCGTGGCAGGCATTGTTGTGTGG + Intergenic
1202924256 14_KI270724v1_random:9247-9269 GCGTCACAGGCACTCAGCTGGGG + Intergenic
1123777111 15:23590870-23590892 GCATGCCTGGCACTTTCCTGAGG + Intronic
1124031712 15:26018106-26018128 GTGTGCCAGGCATTGGGCTAAGG + Intergenic
1124504877 15:30264083-30264105 CAGTGCCAGGCCCTGTGCTGAGG + Intergenic
1124558080 15:30746258-30746280 GTGTGCCAGGCACTGTGGGCAGG + Intronic
1124636448 15:31367759-31367781 ACGTGCCAGGCGCTGTGCTGAGG + Intronic
1124673168 15:31659391-31659413 GTGTGCCAGGCACTGTGAGCAGG - Intronic
1124738675 15:32274552-32274574 CAGTGCCAGGCCCTGTGCTGAGG - Intergenic
1124988586 15:34648095-34648117 ATGTGCCAGGCACTGTGTTAGGG - Intergenic
1125183303 15:36902122-36902144 ATGTGCCAGGCATTGTGCTAAGG - Intronic
1125252540 15:37721947-37721969 ATTTGCCAGGCACAGTGCTGAGG - Intergenic
1125786998 15:42327964-42327986 GTGTGCCAAGCACTGTGCTAAGG + Intronic
1125796303 15:42406470-42406492 ACATTCCAGGCACTGTGCTTGGG + Intronic
1125862191 15:43009376-43009398 GCGTGCCTGGCTGTGTGCAGTGG + Intronic
1126070334 15:44860370-44860392 ATGTGCCAGGCACTGGGCTGAGG - Intergenic
1126087281 15:45022380-45022402 TCGTGCCAGGCCCTTTCCTGGGG + Intergenic
1126087701 15:45024747-45024769 ATGTGCCAGGCACTGGGCTGAGG + Intronic
1126135197 15:45383076-45383098 CTGTGTCAGGCACTGTGCTAGGG - Intronic
1126376878 15:48005876-48005898 GTGTGCCAGGCACTGTGCTAGGG - Intergenic
1126541784 15:49831950-49831972 GTATGCCAGCCACTGTGCTAAGG + Intergenic
1126865452 15:52932318-52932340 AAATGCCAGGCACTTTGCTGGGG + Intergenic
1127568560 15:60217367-60217389 ATGTGCCAGGCACTTTGCTAAGG - Intergenic
1127826531 15:62708793-62708815 GCTGGTAAGGCACTGTGCTGTGG + Exonic
1128136873 15:65270280-65270302 TTGTGCCAGAAACTGTGCTGGGG + Intronic
1128183681 15:65626122-65626144 CTCTGCCAGGCACTGTGCTGGGG + Intronic
1128325548 15:66721728-66721750 GTGTTCCAGGCACTGTGCATAGG + Intronic
1128358143 15:66942846-66942868 ATGCGCCTGGCACTGTGCTGGGG + Intergenic
1128801440 15:70499598-70499620 GCATGCCAGGCCCTGGGCTAAGG + Intergenic
1129468754 15:75738661-75738683 GAGTGGCTGGCACTGGGCTGGGG - Intergenic
1129542582 15:76363033-76363055 CTGTGGCAGGCACAGTGCTGGGG - Intronic
1129659900 15:77547731-77547753 GCGTACCAGGCCCTGCTCTGGGG + Intergenic
1129819349 15:78586900-78586922 GTGTGCCAGACACTGTTATGGGG + Intronic
1130150756 15:81309776-81309798 ACATGCCAAGCACTGTGCTCAGG + Exonic
1130232947 15:82110364-82110386 GCTTGCCAGTGTCTGTGCTGGGG - Intergenic
1130233469 15:82113939-82113961 GTGTGCCGGGCACTGTGCTAAGG - Intergenic
1130275178 15:82472664-82472686 GTGTGGCCGGCACTGCGCTGGGG + Intergenic
1130467537 15:84200059-84200081 GTGTGGCCGGCACTGCGCTGGGG + Intergenic
1130496728 15:84473483-84473505 GTGTGGCCGGCACTGCGCTGGGG - Intergenic
1130516267 15:84628284-84628306 ATGCGCCAGGCACTGTGCTAAGG + Intergenic
1130589829 15:85204657-85204679 GTGTGGCCGGCACTGCGCTGGGG + Intergenic
1130913254 15:88285201-88285223 ACGTGCCAGACATTGTGTTGAGG + Intergenic
1130925060 15:88379160-88379182 ACTTGCCAGGCACTGTGCTATGG - Intergenic
1130938823 15:88491203-88491225 GCATGGCAGTCACTGTGCTGGGG + Intergenic
1130969364 15:88720155-88720177 GCATGCCAGGCTCTGTGCTATGG + Intergenic
1130969708 15:88722275-88722297 ACATGCCAAGCACTGTGCTAAGG - Intergenic
1131083299 15:89554786-89554808 GAGTCCCTGGCATTGTGCTGAGG - Intergenic
1131160493 15:90102076-90102098 CCGTGCCAGGCGCTGGGGTGGGG - Intronic
1131224000 15:90608701-90608723 CTGTGCCGGGCACTGTGCTAGGG - Intronic
1131338093 15:91569988-91570010 ACGTGGCGGGCACTTTGCTGAGG - Intergenic
1131794501 15:96001051-96001073 CTGTGCCAGGCACTGTGCTGGGG + Intergenic
1132104404 15:99052300-99052322 AGGTGCCAGGCAGGGTGCTGGGG - Intergenic
1132235225 15:100215098-100215120 ACCTGCCAGGCACAGTGCAGGGG - Intronic
1132457138 16:30165-30187 GGGCACCAGGCCCTGTGCTGGGG - Intergenic
1132630652 16:915678-915700 GCTGGCCAGGCAGAGTGCTGGGG + Intronic
1132761728 16:1511801-1511823 ATGTGCCAGGCGCTGTGCTGGGG + Intronic
1132907341 16:2289523-2289545 GCGCGCCAGCGACTGGGCTGTGG - Exonic
1133097483 16:3457694-3457716 GCCTGCCAGGGCCTGTGCGGGGG + Intronic
1133386671 16:5375664-5375686 ATGTGCCAGGCACTGTGCCAGGG + Intergenic
1133715976 16:8449069-8449091 TTGTGCCAGGCACTGGACTGGGG + Intergenic
1133804440 16:9114003-9114025 AAGTGCCAGGCACTGTGCTTAGG + Intronic
1133893958 16:9907931-9907953 ACATGCCAGACACTGTGCAGGGG - Intronic
1134017380 16:10898592-10898614 GTGTGCCAGGCCTTGGGCTGGGG - Intronic
1134051891 16:11143142-11143164 GTGTGCCACGCCCTGTGCTTGGG + Intronic
1134077248 16:11300447-11300469 GTATACCAGGCACTGTGCAGGGG + Intronic
1134211553 16:12281627-12281649 TAGATCCAGGCACTGTGCTGGGG + Intronic
1134291466 16:12905110-12905132 GGGAGCCAGGCACTGTACTGGGG + Intronic
1134907421 16:17992486-17992508 TTGTGCCAGGCACTGTGCTCAGG - Intergenic
1135063267 16:19288693-19288715 GGGTGCCAGACACTGTTCTGAGG - Intronic
1135156104 16:20054097-20054119 GTGTGTCAGGTACTGTGCTAGGG - Intronic
1135160899 16:20095350-20095372 ACGTGCCAGGCACAATGCTTAGG - Intergenic
1135195025 16:20387115-20387137 ATGTGCCAGGCACTGTCCTAGGG + Intronic
1135407991 16:22211867-22211889 GTGTGCCAGGCATTGTGCTTTGG + Intronic
1135905815 16:26510844-26510866 ACGTGCCAGGCACTATCCTATGG - Intergenic
1136374490 16:29857263-29857285 GCATGCCAGACTCTGTGCTGCGG - Intergenic
1136396632 16:29996102-29996124 GCGCGGCAGCCACTGCGCTGGGG - Exonic
1136541954 16:30932666-30932688 ACCCTCCAGGCACTGTGCTGCGG - Intronic
1136612788 16:31377438-31377460 GTGTGCCAGGCAGGGTGCTGTGG + Intronic
1137308412 16:47229075-47229097 ATGTGTCAGGCACTGTGCTGGGG + Intronic
1137476503 16:48814081-48814103 TTGTGCTAGGCACTGTGCTAGGG + Intergenic
1137522628 16:49208085-49208107 TTGTGCCAGGCACTGTGCTGAGG + Intergenic
1137563260 16:49516427-49516449 GTGTGCCAGCCACTGTGCCAAGG + Intronic
1137584843 16:49658271-49658293 TCTGGCCAGGCACGGTGCTGGGG - Intronic
1137606526 16:49790370-49790392 CTGAGCCAGGCACTGTGCTGGGG + Intronic
1137737724 16:50737304-50737326 GCATACCAGGCACATTGCTGAGG + Intergenic
1138444222 16:57053381-57053403 CCCTGCCAGTCACTGTGCTCTGG - Intronic
1138607570 16:58098746-58098768 CTGTGCCAGGCACTGTCCTGGGG + Intergenic
1138991526 16:62395867-62395889 AAGTGCCAGGCACTATGCTAGGG + Intergenic
1139349832 16:66327976-66327998 GGGTGGCAGGCACTGGGCTGGGG + Intergenic
1139359747 16:66390160-66390182 GTATGCCAGGCACTTTGCTAGGG - Intronic
1139612407 16:68068545-68068567 ACATGCCAGGCACTGTGCCAAGG - Intronic
1140133994 16:72189097-72189119 ATGTGCCAGGCACCGTGCTATGG + Intergenic
1140266089 16:73422449-73422471 GTGTGCCAGTCACTGTGCTTGGG - Intergenic
1140304324 16:73788595-73788617 GCGTGCTAAGCACTGGGCTGGGG - Intergenic
1140313313 16:73869897-73869919 TTGTTCCAGGCACTGTCCTGGGG - Intergenic
1140477921 16:75248283-75248305 ATGTGCGAGGCTCTGTGCTGGGG - Intronic
1140813131 16:78597315-78597337 GTGTGCCGGGCACTGTACTTGGG + Intronic
1140951570 16:79823460-79823482 ATGTGCCAGACACTGTGCTCAGG - Intergenic
1140967502 16:79981166-79981188 CTGCGCCAGGCTCTGTGCTGGGG + Intergenic
1141136426 16:81468599-81468621 GGGTACCAGGCATTGTGCTAAGG + Intronic
1141141044 16:81497079-81497101 GCCTCCCAGGCACAGTGATGGGG + Intronic
1141159369 16:81618825-81618847 ACGTGCCAGGCACCGTGCTGAGG + Intronic
1141174228 16:81708637-81708659 GCCTGCCTGGCACTGAGCAGAGG - Intronic
1141179265 16:81741230-81741252 GTGTGCCAGGTATTGTGCTGGGG + Intronic
1141274033 16:82568781-82568803 TTGGGCCAGACACTGTGCTGGGG - Intergenic
1141339769 16:83192301-83192323 GTGTGTCAGGGACTGTGCTGTGG + Intronic
1141617504 16:85218461-85218483 GAGTGCCAGGCACACTTCTGGGG + Intergenic
1141680161 16:85539024-85539046 GCGGGGCTGGCACTGTGCAGGGG - Intergenic
1141791930 16:86242907-86242929 GCCTGCCTGGCACAGTGTTGGGG + Intergenic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1142882023 17:2889352-2889374 CAGTGCCAGGCCCTGTGCTGGGG + Intronic
1143281570 17:5758430-5758452 ACGCAGCAGGCACTGTGCTGGGG - Intergenic
1143331604 17:6140815-6140837 GCTTGCCAGGTCCTGTGCCGGGG + Intergenic
1143425748 17:6835987-6836009 ATGTGCCAGGCACTGTGCTTGGG + Intergenic
1143472776 17:7186269-7186291 ATGCGTCAGGCACTGTGCTGAGG + Intergenic
1143616709 17:8055890-8055912 GGGTTCTAGGCACTGTTCTGGGG - Intergenic
1143685828 17:8514866-8514888 GCGTGCCAGGCACTTGGATTTGG - Intronic
1143974665 17:10821082-10821104 CTGTGCCAGACCCTGTGCTGGGG - Intergenic
1144029896 17:11310222-11310244 GTGTGCCAGGCACTGTTTTAGGG + Intronic
1144771322 17:17761190-17761212 ATGTGCCAGTCCCTGTGCTGAGG - Intronic
1144789457 17:17849374-17849396 GAGTGACAGGCCCTGTGCTGTGG - Intronic
1144930148 17:18852389-18852411 TCATGCCAGGCCCAGTGCTGAGG - Intronic
1145889979 17:28407478-28407500 ACGTGCCAGGCACTGTGCTGGGG + Intergenic
1145902386 17:28497217-28497239 GCTTGGCAGGCACTGGGCTGTGG - Exonic
1146475739 17:33161250-33161272 GTATGCCAGGCAGTGTGCTAAGG + Intronic
1146481529 17:33208770-33208792 ATGTGCCAGGCCCTGTTCTGAGG - Intronic
1146635188 17:34498840-34498862 TTGTGCCAGGCATTGTGCTGTGG - Intergenic
1146894502 17:36531847-36531869 TGTTGCCAGGCACTGGGCTGAGG - Intronic
1146924655 17:36735999-36736021 GCATGCCAGGCCTCGTGCTGGGG + Intergenic
1147542055 17:41368600-41368622 GAGTGTTAGGCACAGTGCTGGGG - Intronic
1147653792 17:42077091-42077113 GTGTGTCAGGCACTGTTCTAGGG - Intergenic
1147870713 17:43585508-43585530 TTGTGCCAGGCATTGTCCTGGGG - Intergenic
1147916841 17:43892938-43892960 ACATACCAGGCACAGTGCTGGGG - Intronic
1147988065 17:44317912-44317934 CTGTGCCAGGCACCGTGCTGGGG - Intronic
1148143326 17:45343615-45343637 GTGTGCCAGGCACTGTGCCAAGG + Intergenic
1148194939 17:45706565-45706587 TTGTGCCAGGCACTGTTCTAGGG - Intergenic
1148552914 17:48561241-48561263 CCCTGCCAGGCACTGGGCTAAGG - Intronic
1148750102 17:49940690-49940712 GTGTGCCAGGCACTGTGCTGAGG + Intergenic
1149098891 17:52880044-52880066 AGGTGCCAGGCACTGTTCTAAGG + Intronic
1149153179 17:53594286-53594308 CAGTGCCAGGTACTATGCTGAGG - Intergenic
1149318556 17:55461462-55461484 GATTGCCAGGGACTGTGGTGGGG + Intergenic
1149329119 17:55563339-55563361 ATGTGCCAGGCACTGTCCTTGGG + Intergenic
1149549753 17:57531694-57531716 GTGTGTCAAGCCCTGTGCTGGGG + Intronic
1149600318 17:57889199-57889221 ACGTTCTAGGCAGTGTGCTGAGG - Intronic
1150291435 17:63984729-63984751 ACGTGCCAGGCACTGTCCCAGGG + Intergenic
1150521477 17:65871354-65871376 GCAGGCCGGGCACTGTGCTGTGG + Intronic
1150716140 17:67574094-67574116 ATGTGCCAGTCACTGTGCTGGGG + Intronic
1151296374 17:73189489-73189511 CCGGGCCAGGCACTGTGCCGGGG - Intergenic
1151311990 17:73298807-73298829 GCGTGCCAAGCACTGTACTGAGG + Intronic
1151347579 17:73511582-73511604 GGGTACCAGGCCCTGGGCTGGGG + Intronic
1151675954 17:75597529-75597551 CTGTGCCAGGAACTGTGCTAAGG + Intergenic
1151887954 17:76934192-76934214 ATGTGCCAGGCATTGTGCTAAGG + Intronic
1151961768 17:77409405-77409427 GCCTGCCAAGCACCGTGCAGTGG + Intronic
1152257342 17:79247934-79247956 GTGGGCCAGGCACTGTGCTAAGG - Intronic
1152257352 17:79247978-79248000 GTGGGCCAGGCACTGTGCTAAGG - Intronic
1152483188 17:80570113-80570135 CCGTGACAGTCACTGAGCTGAGG - Intronic
1152512693 17:80801237-80801259 TGGTGCCAGGCATCGTGCTGAGG + Intronic
1152656553 17:81522541-81522563 GTGTGCCAGGAACCGTGCTGGGG - Intronic
1152657488 17:81526814-81526836 ACGTGCCAGGCACCATCCTGGGG - Intergenic
1152782909 17:82234301-82234323 CTGTCCCAGGCACTGTGGTGGGG + Exonic
1152937412 17:83148489-83148511 TAGTGCTAGCCACTGTGCTGCGG - Intergenic
1152980026 18:268032-268054 GCGTGCCCGCCACTGCGCTGCGG + Intronic
1152992578 18:376806-376828 CCGTGCCTGACACTGTGCTAGGG - Intronic
1152998584 18:431861-431883 ATGTGCCAGGCACTGTGCTAAGG + Intronic
1153088576 18:1318143-1318165 GGGTTCCAGGCAGGGTGCTGAGG + Intergenic
1153436715 18:5075674-5075696 ACTTGCCTGGCACTCTGCTGGGG + Intergenic
1153608298 18:6855899-6855921 ACGTGCCTGGCTCTGTGCTGTGG + Intronic
1153632633 18:7086634-7086656 GCGAGCCAGACACTGTCCTAGGG - Intronic
1154151322 18:11908629-11908651 GCCTGCCAGGCACTTCGCGGAGG - Exonic
1154304941 18:13223727-13223749 GTGTGCCAGGCTCTGTTCTGAGG + Intronic
1155038073 18:22042114-22042136 CTGTGCCAAGCACTGTGCTAGGG - Intergenic
1155073955 18:22339174-22339196 TCATGCCAGGCACTTGGCTGAGG - Intergenic
1155095421 18:22550600-22550622 CTGTCCCAGGCACTGTGCTGAGG - Intergenic
1155422922 18:25675147-25675169 ACGTGCCAGGAACTGTGCGCTGG + Intergenic
1155518982 18:26650357-26650379 GTGTGCCAGGCACTGTATTAAGG + Intronic
1157047806 18:44123927-44123949 GTGTGTCTGGCACTGTTCTGAGG + Intergenic
1157220859 18:45827683-45827705 GAGGGCCAGGAGCTGTGCTGGGG - Intronic
1157584410 18:48791953-48791975 ACGTGCCAGGCCCTGGGCTATGG + Intronic
1157699885 18:49755538-49755560 ATGTGCCAGGCATTGTGCTGGGG + Intergenic
1157828189 18:50831443-50831465 ATGTGCCAAGTACTGTGCTGGGG - Intergenic
1159014333 18:63089121-63089143 GTGTCCCAGGCACTGTACTCTGG + Intergenic
1159923754 18:74248557-74248579 GTGAGCCAGGCTATGTGCTGAGG + Intergenic
1160060622 18:75526033-75526055 ATGTGTCAGGCACTGTGCTGGGG + Intergenic
1160794531 19:938779-938801 GCCTGGCAGGCACCGTGGTGAGG - Intronic
1161231510 19:3177123-3177145 GGATGCGAGGCCCTGTGCTGTGG - Intronic
1161309004 19:3583673-3583695 GTATGCCAGGCACTGTGCCCTGG + Intergenic
1161408099 19:4101643-4101665 GGGTCCCAGGGACTGTGCTAAGG + Intronic
1161455964 19:4369819-4369841 ACGGGCCAGGCACTGGGCAGGGG + Intronic
1161482763 19:4519021-4519043 GTATGCCAGGCACTGTTCTGTGG - Intergenic
1161609483 19:5233433-5233455 ATGTGCCAGGCACTGTGCCAAGG + Intronic
1161609634 19:5234680-5234702 GCGTGCCAGGCACTGTGCTAAGG + Intronic
1161609652 19:5234817-5234839 GTGTGCCAGGTGCTGTGCTGGGG + Intronic
1161673176 19:5625663-5625685 TGATGCCAGGCACTGTGCTGAGG + Intronic
1161933521 19:7356919-7356941 GTGTACCAGGCACTGTGCCGGGG + Intronic
1162104205 19:8360348-8360370 ATATGCCAGGCACTGTACTGGGG - Intronic
1162145847 19:8611586-8611608 GTGTGCCAGGCACGGTGCCCGGG + Intergenic
1163120434 19:15214028-15214050 TCGAGCCAGGCAGTGGGCTGTGG + Intergenic
1163333544 19:16657111-16657133 GCGTGCCAGGCAGTGTGCTAAGG - Intronic
1163738160 19:18994518-18994540 GCATGCCAGGCCCTGGGCTCAGG - Intronic
1163819410 19:19487501-19487523 GTGGGCCAGTCACTGGGCTGGGG + Intronic
1164437051 19:28239528-28239550 GCATGCCAAGCCCTGTGCTGTGG - Intergenic
1164714446 19:30381266-30381288 ATGTGCCAGGCACTGTGCTGGGG + Intronic
1164760596 19:30725698-30725720 AGGTGCCAGGCGCTGTGTTGAGG - Intergenic
1164811666 19:31162198-31162220 GTGGGCCAGGCACTGTGCTGGGG - Intergenic
1164925001 19:32123789-32123811 GCATGCCAGGTGCTGTGCTGTGG - Intergenic
1166127168 19:40722085-40722107 GTGTGCCAGGCCATGTGCTGGGG + Intronic
1166561974 19:43738894-43738916 GTGTGCCAGGCCCTGTGCAGGGG - Intronic
1166730190 19:45054848-45054870 CTGTGCCAGGCTCGGTGCTGGGG - Intronic
1166749468 19:45158133-45158155 GCGTGCCAGACCCTGTTCTAGGG - Intronic
1166750312 19:45161378-45161400 GTGCGCCAGGCCCTGAGCTGAGG - Intronic
1166838491 19:45681989-45682011 GCGTGCCAGGCCCAGTACGGAGG + Exonic
1166942765 19:46376701-46376723 GTGTGCCGGACACTGTGCCGAGG + Intronic
1166959669 19:46489922-46489944 GCGTGCCAGGCACGGTGTTGGGG + Intronic
1167015713 19:46839691-46839713 CTGTGCCTGGCCCTGTGCTGGGG + Intronic
1167232586 19:48294605-48294627 ACTTGCCAGGTACTGTTCTGAGG + Intergenic
1167491694 19:49796210-49796232 GTGAGCCAGGCACTGGGCAGGGG + Intronic
1167714917 19:51137102-51137124 ACGTGTCAGGCACTTTCCTGGGG - Intergenic
1167747737 19:51362600-51362622 GTGTGCCAGGCACTGTTCCAAGG + Intronic
1168231976 19:55038394-55038416 GTGTGCAAGTCACTGTACTGAGG - Intergenic
1168317606 19:55490888-55490910 GCCTGCCGGGAACTGGGCTGTGG + Exonic
925129386 2:1483631-1483653 TGGTGCCAAGCACTGTGCTATGG - Intronic
925743963 2:7029353-7029375 GGGTGCCAAGCACTGAGCTGGGG + Intronic
925801916 2:7609954-7609976 ATGTGCCAGACACTGTGCTAGGG - Intergenic
925976111 2:9143254-9143276 GTGTGCCAGGCCCTGTGCTGGGG + Intergenic
926049451 2:9735122-9735144 ATGTACCAGGTACTGTGCTGGGG + Intergenic
926061815 2:9809235-9809257 GCATGTCAGCCACTCTGCTGGGG - Intergenic
926197280 2:10771642-10771664 CAGGGCCAGGCTCTGTGCTGGGG - Intronic
926304388 2:11627597-11627619 GCATGCCAGGCAATGTGCCTAGG + Intronic
926947597 2:18204632-18204654 GTGTGCCAACCACTGTGCTAGGG - Intronic
927271625 2:21216345-21216367 TTTTGCCAGGCACTGTGCTAAGG + Intergenic
927515487 2:23669538-23669560 GTGTGCCGGGCCCTGTGCAGGGG - Intronic
927694172 2:25229267-25229289 CCTTACCAGGCCCTGTGCTGGGG - Exonic
927710718 2:25324216-25324238 ATGTGCCAAGCACTGTGCTAAGG + Intronic
927962847 2:27251260-27251282 TTGTGCAAGGCACTGTGGTGCGG - Intergenic
928035436 2:27818218-27818240 ATGTGCCAGGCACTGTTCTCAGG + Intronic
928200499 2:29244969-29244991 GTGTGCCAGGCACTGAGCCATGG - Intronic
928259866 2:29756843-29756865 ATGTGCCAGTCACTGTGCTAGGG + Intronic
928413973 2:31075961-31075983 AGGTGTCAGGCACTGTGCTCAGG - Intronic
928437007 2:31261228-31261250 AGGTGCCAGACACTGTGATGAGG - Intronic
928883855 2:36126774-36126796 ACGTGCCAGGAACTGCACTGAGG - Intergenic
929093411 2:38241660-38241682 ACATGCCAGGCACTATGCTAAGG + Intergenic
929562694 2:42965623-42965645 GCGTGCCAGGCGCCTTGCTAAGG + Intergenic
929594884 2:43169786-43169808 GAGTCACAGGCACTGTGCTCCGG - Intergenic
930123425 2:47778296-47778318 GCGTGCCAAGCACTGGGCTGAGG + Intronic
932191229 2:69742647-69742669 ATGTGCCGGGCACTGTGCCGAGG - Intronic
932700854 2:73990453-73990475 GTTTGCCAGCCTCTGTGCTGGGG + Intronic
932842968 2:75101381-75101403 GTGTACCAGACACTGTGCTAAGG + Intronic
932886630 2:75554718-75554740 GGGTGCCAGGCACTGTGTTAGGG - Intronic
933007920 2:77019559-77019581 GTGTGCCAGGTATTGTGCTAAGG - Intronic
933575150 2:84058829-84058851 GTGTGTCAGGCACTGTTCTAGGG + Intergenic
933989582 2:87624669-87624691 GTAGGTCAGGCACTGTGCTGGGG + Intergenic
935205724 2:100895279-100895301 TTGTGCCGGGGACTGTGCTGGGG + Intronic
935279763 2:101507161-101507183 ATGTGCCAGGCACTGTGCACAGG + Intergenic
935442909 2:103122911-103122933 GTGTACCAGGTCCTGTGCTGTGG - Intergenic
935528314 2:104200379-104200401 GCATGGTAGGCACTGTTCTGTGG - Intergenic
935587725 2:104816790-104816812 ATGGGCCAGGCACTGTGCCGGGG - Intergenic
935863514 2:107360163-107360185 CTGAGCCAGGCACGGTGCTGTGG - Intergenic
936105426 2:109620126-109620148 ACATGCCAGGCACTGTGCAAGGG - Intergenic
936142008 2:109948593-109948615 CTGTGCCAGGCACTGTGCCAGGG - Intergenic
936178696 2:110246541-110246563 CTGTGCCAGGCACTGTGCCAGGG - Intergenic
936202682 2:110422891-110422913 CTGTGCCAGGCACTGTGCCAGGG + Intronic
936503792 2:113088359-113088381 GTGTGCCTGGCTCTGTGCTAAGG - Intergenic
936797838 2:116228406-116228428 ATATGCCAGGAACTGTGCTGGGG + Intergenic
937077553 2:119118013-119118035 ACGTGCCAGGCACTGGTCTAAGG - Intergenic
937080930 2:119139230-119139252 GAGTGCCAGGCTGTGGGCTGTGG + Intergenic
937229194 2:120387551-120387573 TTGGGCCAGGCACTGTGCTCGGG - Intergenic
937301786 2:120847210-120847232 GCTCAGCAGGCACTGTGCTGAGG + Intronic
937803753 2:126112945-126112967 GTGTGACAGTCACTGTGATGAGG - Intergenic
937949658 2:127374346-127374368 GTGGGCCAGGCAGTGAGCTGTGG - Intronic
938196707 2:129334928-129334950 GAGTGGCAGTCACTGTGCAGTGG + Intergenic
938277349 2:130038048-130038070 GGGTGCCAGGCCCAGGGCTGTGG - Intergenic
938328322 2:130428851-130428873 GGGTGCCAGGCCCAGGGCTGTGG - Intergenic
938361625 2:130692643-130692665 GGGTGCCAGGCCCAGGGCTGTGG + Intergenic
938371054 2:130768537-130768559 GCCTGCTAGGCACCCTGCTGGGG + Intergenic
938438035 2:131299332-131299354 GGGTGCCAGGCCCAGGGCTGTGG + Intronic
938702504 2:133892276-133892298 GTGTGCCAGGAACAGTGCTAAGG - Intergenic
938772529 2:134512620-134512642 TTGTGCCAGGCACTGTTCTGGGG + Intronic
938978794 2:136506208-136506230 GTGTGCCAGGCACTGAACTAAGG + Intergenic
938986695 2:136583479-136583501 CTGTGCCAGGCACTGGGCTGTGG + Intergenic
939090717 2:137776957-137776979 CCCCGCCAGGCACTCTGCTGAGG - Intergenic
939504934 2:143033516-143033538 ATGTGCCAAGCATTGTGCTGGGG - Intronic
939953663 2:148505974-148505996 ATGTGCCAAGTACTGTGCTGAGG - Intronic
940044486 2:149394373-149394395 GTGTGTCAGGCACTGTGCCATGG + Intronic
940638720 2:156327433-156327455 TCCTTCCTGGCACTGTGCTGGGG - Intronic
941203566 2:162544384-162544406 GTGTGCCAGCCACTGTTATGAGG + Intronic
941310016 2:163915703-163915725 ATATGCCAGGCAATGTGCTGAGG - Intergenic
943191581 2:184685113-184685135 GCGTGCCTGGCTGTGTGCAGTGG - Intronic
943196694 2:184761600-184761622 GTGTGCCAGTCACTGTGCAATGG + Intronic
944064430 2:195603769-195603791 GAATGTCAGGCACTGTGCTAAGG + Intronic
944678448 2:202053850-202053872 ATGTGCCAGGCTCTGTGCTGGGG - Intergenic
944742528 2:202626347-202626369 GTGTACCAGGCACTGTGGTAAGG + Intergenic
944973009 2:205015779-205015801 GTGTGCCAGGCAAGGTGCTGAGG - Intronic
944976285 2:205055082-205055104 AAGTGCCAGGCACTGTGCCTGGG - Intronic
945406856 2:209459318-209459340 ATGTGCCAGGCACTGTTCTAGGG - Intronic
946148126 2:217746178-217746200 ATGTGCCAGGCACTGTCCTGTGG - Intronic
946189569 2:218001275-218001297 ACCTGCCAGGCACTGCCCTGGGG + Intronic
946921050 2:224582822-224582844 ATGTGCCAGGCACTGTTCTGGGG - Intronic
947015210 2:225611767-225611789 GAATGCCAGGCACTGTGATCTGG - Intronic
947073795 2:226319537-226319559 ATGTGCCAGGTACTGTTCTGGGG - Intergenic
947190194 2:227496472-227496494 GTGTGCCAGGAACTGTCCTTAGG + Intronic
947575538 2:231270726-231270748 TCGCGCCAGTCACTGTTCTGAGG + Intronic
947617793 2:231569384-231569406 GGGTGCCAGGCTCTGTCCTGAGG - Intergenic
948903871 2:240968758-240968780 ACATGCCAGGCTTTGTGCTGGGG + Intronic
1168778650 20:469769-469791 GTGGGCCAGGCAGTGAGCTGTGG + Intergenic
1168854437 20:998756-998778 CTGTGCCAGGCTCTGTGTTGGGG - Intronic
1168860467 20:1042879-1042901 GGTCTCCAGGCACTGTGCTGAGG + Intergenic
1168952589 20:1812571-1812593 GGGTGCCAGGTACTGTTTTGGGG + Intergenic
1168966853 20:1903969-1903991 GTGTGTCAGGCCCTGTGCTGAGG - Intronic
1168986869 20:2056490-2056512 CTGTGCCAGGCACTGTACTAAGG + Intergenic
1169421667 20:5465489-5465511 GCGTGCCTGGCTGTGTGCAGGGG + Intergenic
1169609280 20:7361176-7361198 GTGTGGCAGGTATTGTGCTGAGG + Intergenic
1170140982 20:13124702-13124724 GCAGGCCACACACTGTGCTGAGG + Intronic
1170374532 20:15685965-15685987 AAGTGCCAGGCACTGTGCAATGG - Intronic
1170510107 20:17067728-17067750 ATGTGCTAGGCACTGTTCTGGGG + Intergenic
1170907734 20:20530860-20530882 CTCTGCCAGGCGCTGTGCTGAGG - Intronic
1171448521 20:25220981-25221003 GGGTGCCAGGCACTGGGCCAAGG - Intronic
1171455572 20:25270081-25270103 GCCTGTCAGGCCCTCTGCTGAGG - Intronic
1171958422 20:31476541-31476563 GAGTGGAAGGCACTGTGCTCAGG - Exonic
1171992228 20:31705531-31705553 GTGTGTTAGGCACTGTGCTGGGG - Intronic
1172117219 20:32580270-32580292 GTGTGCCTGTCACTGGGCTGAGG - Intronic
1172145527 20:32755200-32755222 CTGTGCCAGGCACTGTGGTAAGG - Intergenic
1172155894 20:32824212-32824234 GCGTGCTAGGCACTGTTCTAGGG - Intronic
1172198423 20:33108159-33108181 GTGTGCCAGGCACTATGCAGGGG + Intronic
1172227561 20:33315243-33315265 ATGTGCCAGGCACCATGCTGAGG - Intergenic
1172270651 20:33653951-33653973 GGGTGCCAGGCCCTGTGCTAGGG - Intergenic
1172287847 20:33753503-33753525 GTGTGCCAGACACTGTGCTGGGG + Intronic
1172624912 20:36341418-36341440 ACATGCCAGGCACTTTGCTAGGG - Intronic
1172626052 20:36347480-36347502 ATGTGCCAAGCCCTGTGCTGGGG + Intronic
1172714510 20:36952648-36952670 GTGTGCCAGGCACGGTTCTAAGG + Intergenic
1172994981 20:39064136-39064158 CCATGCCTGGCCCTGTGCTGTGG + Intergenic
1173025751 20:39305889-39305911 ATGTGCCAGGTACTGTGCTGGGG + Intergenic
1173099832 20:40075587-40075609 ACATGCCAGGCACTATTCTGTGG + Intergenic
1173348120 20:42219625-42219647 GGGTGCCAGGCACTGGGCTCTGG + Intronic
1173351422 20:42248923-42248945 ATGTGCCAGGCACTGTGCTAAGG + Intronic
1173385683 20:42585572-42585594 ACATGCCAGGCACTTTTCTGAGG + Intronic
1173391156 20:42634967-42634989 GTGTTTCAGGCACTGTGCTTGGG - Intronic
1173446340 20:43122254-43122276 ACCTGCCAGGCACTGGACTGGGG - Intronic
1173551638 20:43936957-43936979 GTGTGCCAGGCACTGTGGCAGGG + Intronic
1173582585 20:44158070-44158092 ATGTGCCAGTCACTGTTCTGAGG - Intronic
1173606391 20:44335036-44335058 GTGTGCCAGCCACTGTACTAAGG + Intergenic
1173658834 20:44719211-44719233 GCATGCCAGGCCCTGTGCTGAGG + Intronic
1173939970 20:46902356-46902378 ATGTCCCAGGCATTGTGCTGTGG + Intronic
1174060259 20:47827355-47827377 CTGTGCCAGGCACTGCGCTCAGG - Intergenic
1174071638 20:47904015-47904037 CTGTGCCAGGCACTGCGCTCAGG + Intergenic
1174152411 20:48494620-48494642 CTGTGCCAGGCACTGCGCTCAGG - Intergenic
1174169876 20:48609604-48609626 GCCTGCCAGGCCCTGGCCTGGGG + Intergenic
1174224470 20:48985736-48985758 GTGTGCCAGGCACTGTGCTAAGG + Intronic
1174357704 20:50009607-50009629 TCGTGCCAGGCACTGCTCTAGGG - Intergenic
1174523511 20:51153529-51153551 ATGTGCCAAGCACTGTGCTGAGG + Intergenic
1174570574 20:51498350-51498372 ATGTGACAGGCACTGTGCTTGGG + Intronic
1174622492 20:51886652-51886674 ATGTGCCTGGCACTGTCCTGGGG - Intergenic
1174634521 20:51987539-51987561 ATGTGCCAGGCACTGTTCTATGG + Intergenic
1174663648 20:52237248-52237270 GCATGCCAAGCACTGTGCCAAGG - Intergenic
1174929962 20:54802762-54802784 ATGTGCCAGGCATTGTGCTGGGG - Intergenic
1175031932 20:55963325-55963347 ATGTGCAAGGCACTGTGCTATGG + Intergenic
1175078372 20:56395289-56395311 GTATGCCAGGCACTGTGCTCAGG + Intronic
1175105214 20:56610233-56610255 GATTCCCAGGCCCTGTGCTGGGG - Intergenic
1175131979 20:56796250-56796272 GGGTGCCAGGCACAATGCTAGGG - Intergenic
1175373479 20:58508714-58508736 ATGTGCCAGGCACTGTTCTAGGG + Intronic
1175415361 20:58797266-58797288 GAGTGCCAGGCACAGTGCTGGGG - Intergenic
1175580004 20:60091147-60091169 GGATGCCAGGCTCTGTGCTAGGG - Intergenic
1175640720 20:60628030-60628052 ATGTGCCAGGCACTGTGCTAAGG - Intergenic
1175755275 20:61525624-61525646 GTGTGCTCGGCTCTGTGCTGCGG + Intronic
1175871652 20:62212113-62212135 GTGTGCCAGGCATGGTGGTGGGG - Intergenic
1176128249 20:63485469-63485491 GCCTGCCATGGTCTGTGCTGGGG - Intergenic
1176244083 20:64089109-64089131 GCATGCCAGGGTCTGTGCTGGGG + Intronic
1177193334 21:17876007-17876029 ATGGACCAGGCACTGTGCTGTGG + Intergenic
1178319719 21:31596145-31596167 GCCTGCCAGGTACCGTTCTGTGG + Intergenic
1178366674 21:31994112-31994134 GGGTGCCAGACACTGCACTGAGG - Intronic
1178411899 21:32370909-32370931 ATGTGCCAGGCACTGTCCTAGGG + Intronic
1178461587 21:32807217-32807239 ATGTGCCAGGCCCTGTGCTAAGG - Intronic
1178533926 21:33397230-33397252 GCTTCCCAGGCCCTGGGCTGTGG + Intergenic
1178678071 21:34647673-34647695 GGTTGCCAGCCACTGTGCTGGGG - Intergenic
1179189831 21:39114395-39114417 CCGGGCCAGGCACTGCACTGGGG + Intergenic
1179472305 21:41619864-41619886 GGGTGCCAGGCACTATTCTGGGG + Intergenic
1179564733 21:42240161-42240183 GCGTGGCAGGCACCGTGGTCTGG - Intronic
1179599056 21:42463696-42463718 GTGTGCCAGGCACTGTGCCTGGG - Intergenic
1180135421 21:45859198-45859220 GAATGCCCGGCACTGTGCTGTGG + Intronic
1180867427 22:19127423-19127445 GCTTGCCAGCCACTGCCCTGAGG - Intergenic
1181094822 22:20497730-20497752 GGGAGCCAGCCACAGTGCTGTGG + Intronic
1181544655 22:23595083-23595105 GTGTGCCCGGCCCTGTCCTGTGG + Intergenic
1181613888 22:24038473-24038495 GCAGGCCAGGCAGTGTGCCGTGG + Intronic
1181750066 22:24983016-24983038 GTGGGCCAGGCTCTGTGCTGGGG + Intronic
1181766126 22:25093395-25093417 GAGTGCCTAGCACTGTGCTCAGG + Intronic
1181769401 22:25114351-25114373 GTGTGCCTGGCACTGTGCTGGGG - Intronic
1181815658 22:25434812-25434834 GTGTGCCCGGCCCTGTCCTGTGG - Intergenic
1181909466 22:26227110-26227132 ATGTGCCAGACACTGCGCTGGGG - Intronic
1182007961 22:26977227-26977249 CTGTGCCAGGCACTGTGATAAGG - Intergenic
1182022035 22:27089515-27089537 CCATGCCAGGCACTGTCCTAGGG + Intergenic
1182058216 22:27377955-27377977 GTGTGCCAGGCACCACGCTGGGG + Intergenic
1182091734 22:27600442-27600464 GAGTGCCAGGCACTGTGCTAGGG + Intergenic
1182114337 22:27746694-27746716 CTGTGCCTGGCACTGTGCTCAGG + Intergenic
1182323158 22:29491452-29491474 ATGTGCCAGGCAGTGTGCTAGGG + Intergenic
1182392529 22:30010927-30010949 GTATGCTAGGCACTGTGCTGGGG + Intronic
1183067382 22:35372364-35372386 ACGGGCCAGGCGCTGTGCTGGGG + Intergenic
1183157695 22:36087834-36087856 ACGTGCCAGGCACTGTTCTAAGG + Intergenic
1183224222 22:36538290-36538312 TTATGCCAGGCACTGTGCTATGG + Intergenic
1183247962 22:36708606-36708628 CTGTGTCAGGCCCTGTGCTGAGG + Intergenic
1183251979 22:36736844-36736866 TGGTGCCAGGCACTGTGCTGGGG - Intergenic
1183270040 22:36856197-36856219 GTGGGCCAGGCACTGTACTAAGG + Intergenic
1183314978 22:37132060-37132082 GCGTGCCAGGCAATGTACTCAGG + Intronic
1183370574 22:37429462-37429484 GAGTGGCCGGCACTGTGCTGGGG - Intergenic
1183429561 22:37757513-37757535 GTGTGCCAGGCCCTGTGCCAGGG - Intronic
1183516739 22:38271261-38271283 ATGTGCCAGGCACTATGCTGGGG - Intronic
1183563977 22:38599653-38599675 GTGTGCCAGGCGCTGTGCTAAGG + Intronic
1183786005 22:40029603-40029625 GCCTGCCCTGCCCTGTGCTGTGG + Exonic
1184003698 22:41693733-41693755 GCTTTCCAGGAACTGTTCTGAGG - Exonic
1184008906 22:41732012-41732034 AAGTGCCAGGGACTGTGCTATGG + Intronic
1184234580 22:43176221-43176243 ACGTGCCAAGCACTGTTCTGGGG + Intronic
1184372585 22:44091994-44092016 ACGTGCCATGCTCTGGGCTGGGG + Intronic
1184377492 22:44123902-44123924 CTGTGCCAGGCACTGTGCCAGGG - Intronic
1184451339 22:44584489-44584511 TGGTGCCAGGCACTGTTCTGGGG - Intergenic
1184507796 22:44914607-44914629 GTGTCTCAGGCACTGTGGTGTGG - Intronic
1184537247 22:45095509-45095531 GAGAGTCAGGCAGTGTGCTGAGG + Intergenic
1184563449 22:45276826-45276848 ACGTGTCAGGGACTGTGCTAGGG - Intergenic
1184710481 22:46246719-46246741 GTGTGCCAGGTCCTGTGCTTGGG - Intronic
1184877146 22:47283097-47283119 CCCTGCCAGGCACAGTTCTGGGG - Intergenic
1185114871 22:48926944-48926966 GTGTACCAGACACTCTGCTGTGG + Intergenic
1185184755 22:49392317-49392339 GAGTGCCAGGCACTTGGCTAAGG - Intergenic
1185332367 22:50257492-50257514 GCGTGCCAGGCTAGGGGCTGAGG + Intronic
949202790 3:1399764-1399786 ATGTGCCAGGCACTGTGCTAGGG + Intronic
949305833 3:2639617-2639639 GTGTGCCAGGCACTATTCTCAGG - Intronic
949501663 3:4686020-4686042 GGGTGCCAGGCGCCATGCTGAGG + Intronic
949541692 3:5037482-5037504 CTGTGCCAGGCACTATGCTCAGG - Intergenic
949566731 3:5252121-5252143 TCGTGCCAGGCACTGGGCCAAGG - Intergenic
949734937 3:7160918-7160940 GTGTCCCAGGCACTGTTCTAAGG - Intronic
949838415 3:8293821-8293843 CTGTGCCAGGCATTGTTCTGGGG - Intergenic
949951197 3:9230131-9230153 GAGTGCCAGGCACTGTGCTAAGG + Intronic
949988022 3:9554429-9554451 TCATGCCAGGCGCTGAGCTGGGG - Intergenic
950105208 3:10384286-10384308 GCATACCAGGCACTGGGCTGTGG - Intronic
950121264 3:10483880-10483902 GGGTGCCCGGCCCTGTGCCGGGG - Intronic
950121482 3:10484968-10484990 CAGTGCCAGGCACTGTGCCCAGG - Intronic
950180979 3:10912888-10912910 GCGTACCAGGCACTGAGTTCAGG - Intronic
950436568 3:12983803-12983825 TTGTGCCAGGCGCCGTGCTGAGG - Intronic
950563529 3:13749820-13749842 CACGGCCAGGCACTGTGCTGTGG + Intergenic
950580892 3:13861402-13861424 ATGTGCCAGGCACTGTTCTAGGG + Intronic
950651735 3:14411437-14411459 ACGTGCCAGGCACTGTTAAGAGG - Intronic
950708918 3:14801572-14801594 GTGTGCCAGGCACTGGGCTAAGG + Intergenic
950769948 3:15303347-15303369 GTGTGGCAGGCTCTGGGCTGGGG - Intronic
950914884 3:16634295-16634317 GTGTGCCAGGCACTGTGCTAAGG - Intronic
950966934 3:17152967-17152989 ATGTGCCAAACACTGTGCTGGGG - Intergenic
952180817 3:30914653-30914675 GTGTGCCAGGCACTGCTCTAAGG - Intergenic
952206682 3:31187363-31187385 GTATGCCAGGCACTGTGCTGAGG + Intergenic
952333130 3:32383012-32383034 ATGTGCCAGGCACTGTGCTGAGG + Intergenic
952512293 3:34069594-34069616 ATGTGTCAGGCACTGTGTTGGGG + Intergenic
952721153 3:36534282-36534304 GGTGGCCAGGCACTGTGCTAAGG - Intronic
952758730 3:36894944-36894966 CAGTGCCAGGCATTGAGCTGAGG - Intronic
953236919 3:41115023-41115045 ACGTGCCAGGAACTGTGCTAAGG + Intergenic
953481502 3:43256125-43256147 CTGTGCCAGGCACTGTGAGGGGG + Intergenic
954143874 3:48624490-48624512 AGGTGCCAGGCTCTGTGCAGGGG - Intergenic
954895090 3:53968288-53968310 CAGAGCCAGGCACTCTGCTGAGG - Intergenic
955060960 3:55491046-55491068 AAGTGCCAGGCATTGTTCTGAGG - Intergenic
955339702 3:58116001-58116023 TAGGGCCAGGCTCTGTGCTGGGG - Intronic
955350055 3:58186684-58186706 TAGAGCCAGGCACTGTGCTAAGG - Intergenic
955378070 3:58414658-58414680 CTCTGCCAGGCATTGTGCTGGGG - Intronic
955492727 3:59499364-59499386 CCGTGCACGGCACTGGGCTGAGG + Intergenic
955662617 3:61317252-61317274 GCATGGCAGGCACTAGGCTGGGG - Intergenic
955679855 3:61489093-61489115 GTGTGCCATGCACTGTGCTTGGG + Intergenic
955889136 3:63631959-63631981 GTGTGCCAGGCACTGTGCCAAGG - Intergenic
955919009 3:63935044-63935066 ACATACCAGGCACTGTGCTCAGG - Intronic
956050286 3:65240687-65240709 TCATGCCAGGCCTTGTGCTGAGG + Intergenic
956087305 3:65625914-65625936 GTATTCCAGGCATTGTGCTGGGG + Intronic
956291295 3:67662763-67662785 GTCTTCCAGGCACTGTACTGTGG - Intergenic
956345797 3:68277058-68277080 ATGTGCCAGGCACTGTGCTAAGG + Intronic
956354221 3:68373106-68373128 ATGTGCCAGGCACTGTGTTAGGG - Intronic
956617952 3:71192012-71192034 TGGGGCCAGGTACTGTGCTGGGG - Intronic
956747982 3:72324463-72324485 ATGTGCCAGGCACTATGCTAGGG + Intergenic
957573184 3:81975342-81975364 CTGTGCCAGGCACTGCGCTTGGG + Intergenic
958920431 3:100099708-100099730 GTGTGCCAGACACTGTCCTAGGG + Intronic
960691881 3:120354745-120354767 AAGTGCCAGGCACTGTCCTAGGG + Intergenic
960997246 3:123348368-123348390 ATGTGCCAGGCACTATTCTGGGG + Intronic
961047373 3:123718877-123718899 CAGTGCCAGGCATTGTTCTGGGG - Intronic
961115217 3:124323456-124323478 GTGGGCCAGGCTCTGTGTTGGGG - Intronic
961270586 3:125684757-125684779 CAGTGCCAGGCATTGTTCTGGGG + Intergenic
961516399 3:127440137-127440159 ATGTGCCAGGCACTGTGCGTGGG - Intergenic
961519927 3:127461202-127461224 CTGTGCTAGGCCCTGTGCTGGGG + Intergenic
961621073 3:128225578-128225600 ATGTGCCAGGCACGGTGCTGGGG - Intronic
961635503 3:128330354-128330376 ATGTGGCAGGCACTGTGCTGAGG + Intronic
961637088 3:128340536-128340558 GTGTGCCAGGCACTGTTCTAGGG - Intronic
961651922 3:128421071-128421093 GCGTGGCAGGCTTTGTCCTGTGG + Intergenic
961802451 3:129462342-129462364 GTGTGCTAGGCACTGTTCTAAGG + Intronic
962209911 3:133468930-133468952 AACTGCCAGGCACTGTGCTAAGG - Intronic
962239849 3:133743231-133743253 ATGTGTCAGGCACTGTCCTGGGG - Intergenic
962266183 3:133945881-133945903 TCGTGCCAGGCACTGTGCCCGGG + Intronic
962352215 3:134664346-134664368 GTGTGCCTGGCTGTGTGCTGAGG - Intronic
962629642 3:137263291-137263313 ATGTGCCAGGCTCTGTGTTGGGG - Intergenic
962713946 3:138111136-138111158 GGGTGCCAGGTAATGGGCTGGGG - Intronic
962745722 3:138396211-138396233 TTGTGCCAGGCACTGCACTGAGG + Intronic
962844762 3:139264386-139264408 TTGTGGCAGGCATTGTGCTGGGG + Intronic
962869542 3:139476147-139476169 GTGGGCCAGGCACTGTGCTAAGG + Intronic
963227533 3:142877524-142877546 TTGTGCCAAGCACTGTGCTAAGG + Intronic
963727185 3:148935786-148935808 GCTTGCCAGACACTGTTCAGTGG + Intergenic
964216408 3:154289396-154289418 ACGTGCCAGGCACTGTTCTAAGG + Intronic
964623476 3:158737460-158737482 GTGTGCCAGTCACTGTTCTAGGG - Intronic
964687723 3:159415809-159415831 ATGTGCCAGGCACTGTACTAGGG - Intronic
964704609 3:159604496-159604518 CTGTGCCAGGCACTGTGCCAGGG + Intronic
965341122 3:167492566-167492588 GGGTATCAGGCACTGTGCTTAGG + Intronic
965488207 3:169304905-169304927 ACGTGCAAGGCACTGTGCTAGGG + Intronic
965754902 3:172015813-172015835 CCGTGTCAAGCACTGTGCTGGGG - Intergenic
966416863 3:179698087-179698109 GTGTGCCAGGCACAGTACAGGGG + Intronic
966424708 3:179768659-179768681 ATGGGCCAGGCACAGTGCTGGGG - Intronic
966538669 3:181064318-181064340 GTGTCCTAGGCACTGTGCTATGG - Intergenic
966883971 3:184364643-184364665 CTATGCTAGGCACTGTGCTGAGG - Intronic
967090203 3:186128432-186128454 CCGTGTCAAGCACTCTGCTGGGG + Intronic
967141893 3:186568494-186568516 CCATGCCAGGCACTGTTCTAAGG + Intronic
967284229 3:187853189-187853211 GTGAGCCGGGCACTGTACTGAGG + Intergenic
967473381 3:189888924-189888946 CTGTGCCAGGCACTGTGCTAGGG + Intronic
967935071 3:194720720-194720742 CTGTGCCAGGCATTGTGCCGAGG - Intergenic
967935794 3:194726381-194726403 CTGTGCCAGACACTGTCCTGGGG - Intergenic
968132907 3:196202476-196202498 AAGTTCCAGTCACTGTGCTGGGG + Intronic
968451903 4:679826-679848 GCCTGCCTGGCCCTGTGCTGGGG + Intronic
968596344 4:1487879-1487901 GCATGCCTGGCATTGTGCTGGGG - Intergenic
968718288 4:2178230-2178252 GTGTGCTGGGCACTGAGCTGGGG - Intronic
969124442 4:4936001-4936023 AGGTGCCAGGCACTGTTCTATGG - Intergenic
969212745 4:5700438-5700460 GCTTGTTAGGCACTGTGCTAGGG + Intronic
969258685 4:6020533-6020555 GTGTGCCAGGTGCTCTGCTGAGG - Intergenic
969282301 4:6178909-6178931 CCGAGCCAGGCACTGTGCCGGGG - Intronic
969286842 4:6207897-6207919 GTGTGCCAGGTACTGGGCTGAGG + Intergenic
969415533 4:7055514-7055536 GCGTGCCCGGGGCTGCGCTGGGG - Exonic
969452594 4:7283394-7283416 GAGTGCCAGGCACTTTGCCCCGG - Intronic
969482324 4:7453334-7453356 TGGGGTCAGGCACTGTGCTGGGG + Intronic
969482424 4:7453822-7453844 TGGGGCCAGGCACTGTGTTGGGG + Intronic
969482468 4:7454034-7454056 TGGGGCCAGGCACTGTGTTGGGG + Intronic
969492110 4:7505311-7505333 GGGAGCCAGGCACGGGGCTGGGG + Intronic
969586625 4:8097701-8097723 GTGTGCTAGACTCTGTGCTGGGG + Intronic
970201463 4:13612553-13612575 GTCTTCCAGGCACTGTGCTAAGG - Intronic
970425378 4:15940953-15940975 GCGTGCCAGGCACTGTGCTAAGG + Intergenic
970603720 4:17660155-17660177 ACGTGCCAGCCACTGTGCCTGGG + Intronic
970884721 4:20974960-20974982 GTGTGATAGGCACTGTGCTAAGG + Intronic
971218051 4:24680346-24680368 GTGTGCCAGGCACTGTACCCAGG - Intergenic
971750133 4:30636323-30636345 ATGTGCCAGGCACTATTCTGGGG + Intergenic
972708270 4:41567326-41567348 ACATGCCAGGCATTGTTCTGAGG - Intronic
973107430 4:46357570-46357592 ATGTGCCAGGCACTGTTCTAGGG + Intronic
973177763 4:47228989-47229011 TATTGCCAGGCACTGTGCTGGGG + Intronic
973647876 4:52968200-52968222 GTGTGCCAGGCACTGTGCTAGGG + Intronic
973701795 4:53544755-53544777 ATGCGCCAGGCACTGTACTGGGG + Intronic
973705709 4:53577949-53577971 ATGCGCCAGGCACTGTGCTAGGG + Intronic
973735633 4:53868998-53869020 GTGTGCCAGGTGCTGTCCTGGGG - Intronic
973774158 4:54230234-54230256 GCCTGCCGGGCAGTGTGCTCGGG + Intronic
973968375 4:56186596-56186618 ACATGCCAGACATTGTGCTGAGG + Intronic
975359075 4:73445625-73445647 ATGTGCCAGGCATTGTGCTATGG - Intronic
975673092 4:76801662-76801684 GAGGGCCAGGCACAGTGCAGGGG - Intergenic
976495157 4:85720441-85720463 GGGTGACAGTCACTGAGCTGGGG + Intronic
976613558 4:87053680-87053702 GTGTGCCAGGCCTGGTGCTGGGG + Intronic
976836042 4:89375081-89375103 ATGTGCCAGGCACTGGGCTAAGG - Intergenic
977563301 4:98555593-98555615 GTATTCAAGGCACTGTGCTGGGG - Intronic
977565657 4:98577878-98577900 ATGTGCCGGGCACTGTGCTGAGG - Intronic
978189091 4:105893028-105893050 TTGTGCCAGGCATTGTGCTGGGG + Intronic
978195379 4:105965941-105965963 GTGTGCCAGCCTCTGTGCTAAGG - Intronic
978198727 4:106000139-106000161 GTGTGCCAGGCAATGTGTTAAGG + Intronic
978203799 4:106054731-106054753 GTGTGTCAGGCACTATGCTAGGG + Intronic
978208987 4:106112734-106112756 GTGGGCCAGGCAGTGAGCTGTGG - Intronic
978338093 4:107691272-107691294 ACATGCCAGGCACTGTGCTGAGG + Intronic
978944048 4:114472752-114472774 GAGTGCCAGCTACTGTGGTGAGG - Intergenic
978955061 4:114602566-114602588 GTGTGCCAAGCACTGTGCTCTGG + Intronic
979471690 4:121106573-121106595 GTGGCACAGGCACTGTGCTGGGG + Intergenic
982036795 4:151353871-151353893 GAGTGCCAAGCACTGGGCAGGGG - Intergenic
982118731 4:152118989-152119011 TCCTGCCAGGCTCTGTGCAGTGG + Intergenic
983069598 4:163253453-163253475 GCGTGTCTGGCAGTGTGCAGTGG - Intergenic
984090821 4:175373199-175373221 GTATGCCAGGCACTGTGCTATGG - Intergenic
984929477 4:184834104-184834126 AAGTGCCAGGCACTGTATTGGGG - Intergenic
986535139 5:8778644-8778666 AGGTGCCAGGCACTGTCCAGGGG - Intergenic
986741562 5:10710022-10710044 GATTGCCAGGCTCTGTGATGAGG + Intronic
987351167 5:17023591-17023613 ACGTGCCAGACATTGTTCTGAGG + Intergenic
987600571 5:20063680-20063702 GAGTACCAGGCACTGTCTTGAGG + Intronic
988180819 5:27789405-27789427 TCGTGCCAGTCACTGAGTTGTGG + Intergenic
988412047 5:30898975-30898997 ATGTGCCAGGCACTGTGGTAGGG + Intergenic
988609128 5:32709320-32709342 GGTTGCCAGGCACTGTGCTGGGG - Intronic
988609245 5:32710248-32710270 GCGCTCGAGGCACTGTGCTGGGG - Intronic
989363658 5:40631952-40631974 ATGTGCCAGGCACTCTTCTGAGG + Intergenic
990007088 5:50956179-50956201 GTGTTCCAGGCACTGTCCTAGGG + Intergenic
990801725 5:59611608-59611630 GTGTACCAGGCACTGTGCTAGGG - Intronic
990915682 5:60902031-60902053 ACGTGCCAAGCATTGTGCTAGGG - Intronic
990943587 5:61228289-61228311 ATGTGCCAGGCACTGTGGTAGGG - Intergenic
991423142 5:66462162-66462184 CAATGCCAGGCACTGTGCTAGGG + Intergenic
991441809 5:66658691-66658713 GGGTGCCAGACACTGTACTCTGG + Intronic
992000266 5:72429509-72429531 ACATGGCAGGCACTGTGTTGGGG - Intergenic
992062854 5:73073500-73073522 ATGTGCCAGGCACTTTGCTAGGG - Intronic
992197671 5:74355831-74355853 ACATGCCAGACACTGTACTGAGG - Intergenic
992584631 5:78223665-78223687 TGGTGTTAGGCACTGTGCTGAGG + Intronic
993082765 5:83322400-83322422 CTGTGCCAGGCAATATGCTGTGG + Intronic
995038026 5:107557207-107557229 ACGTACCAGGCATTGTGCTGGGG - Intronic
995521179 5:113007080-113007102 GAGAGCCAAGCACTGTGCTCCGG + Intronic
995735484 5:115296298-115296320 GCGTGCCAGGCCCCGAGCAGGGG + Intronic
995903947 5:117100911-117100933 GCCTGCCAGGAAGTGTGGTGGGG - Intergenic
996589451 5:125129532-125129554 GTGTGCCAAGCTCCGTGCTGGGG + Intergenic
997276342 5:132595301-132595323 ATGTGCCAGGCACTGTTCTAAGG - Intronic
997525421 5:134549910-134549932 CCTTGCCAGGTCCTGTGCTGGGG + Intronic
997735839 5:136212203-136212225 GTGTACCAGGCACTGTGCTCGGG - Intergenic
997929947 5:138064292-138064314 CCAGGCCAGGCACTGTGTTGAGG + Intergenic
998039597 5:138943980-138944002 ACGAGCCAGGCACTGTTCTAGGG - Intergenic
998190114 5:140016510-140016532 ACGTGCCAGGCATTGTGCTAGGG + Intronic
998216431 5:140241398-140241420 AAGTGCCAGGCCCTGTGCTGAGG - Intronic
999042690 5:148432595-148432617 GTGTGTCAGGCACTGTTCTAAGG - Intronic
999099316 5:149009528-149009550 CTGTGCCAGGCACTGAGCTAGGG - Intronic
999112366 5:149133033-149133055 GTGTGCCAGGCACTGTGCAAAGG - Intergenic
999265856 5:150266485-150266507 CTGTGCCAAGCACTGTGCAGAGG + Intronic
999479229 5:151930244-151930266 GTGTGTCTGACACTGTGCTGAGG + Intergenic
999743751 5:154576376-154576398 GTGTGCCAGGCACTGGGTTAGGG - Intergenic
1000262893 5:159605802-159605824 GAGTGACAGCAACTGTGCTGTGG + Intergenic
1000365445 5:160486491-160486513 ATGTGCCAAGCACTGTGCTCAGG + Intergenic
1001133074 5:169080344-169080366 ATGTGCCAAGCACTGTGCTAGGG + Intronic
1001154092 5:169257974-169257996 ACGCACCAGGTACTGTGCTGAGG + Intronic
1001203750 5:169742889-169742911 ACCTGCAAGGCACTGTTCTGGGG - Intronic
1001210991 5:169810071-169810093 AAGAGCCAGGCATTGTGCTGGGG - Intronic
1001525394 5:172425252-172425274 GCATGCCAGGCCCTCTGCTAGGG + Intronic
1001545181 5:172566596-172566618 GTGTGCCCAGCCCTGTGCTGAGG - Intergenic
1001580960 5:172798073-172798095 GGGTGCCTGGTACTGTGATGGGG - Intergenic
1001756451 5:174173980-174174002 GCGAGCCTGGCACAGTGCAGTGG - Intronic
1001781876 5:174375807-174375829 CTGTGCCAGACACTGTGCTAAGG + Intergenic
1001930302 5:175668199-175668221 GTGGGCCAAGCACTGTGGTGTGG + Intronic
1001962539 5:175888423-175888445 ATGTGCCTGGCACTGTGCTAGGG - Intergenic
1001967497 5:175921532-175921554 TGGTGCCAGGCTCTGTGCTAGGG - Intronic
1002021738 5:176368006-176368028 ATGTGCCAGGCATTGTGCTGAGG + Intronic
1002077775 5:176719283-176719305 ACGCGCCAGGCTCTGTGCTTGGG - Intergenic
1002088252 5:176789448-176789470 GTGTGGCAGCCACGGTGCTGGGG + Intergenic
1002156120 5:177281467-177281489 ATGTGCCAGGTATTGTGCTGGGG + Intronic
1002325184 5:178399947-178399969 GGGTTCCTGGCACTGTGCTGGGG + Intronic
1002337202 5:178488080-178488102 GTGTGCCAGGCACCCTGCCGTGG - Intronic
1003050093 6:2772431-2772453 GTGTGCCAGGCACTGTGCTGGGG - Intronic
1003273860 6:4631515-4631537 ATGTGCCAGACACTATGCTGAGG + Intergenic
1003333639 6:5150526-5150548 GTGTACTAGGCACTGTGCTCAGG - Intronic
1003515972 6:6818959-6818981 GGGTGCCAGGCACTGTTCTGAGG - Intergenic
1003617981 6:7672708-7672730 GCGGGCCAGGATCTGTGCTAAGG + Intergenic
1003632305 6:7798669-7798691 GCTTGCCACACACTGTGCTTTGG + Intronic
1004174985 6:13331683-13331705 GTGTGCCAGGCGCTGTTCTATGG - Intergenic
1004323364 6:14650972-14650994 ATGTGCCAGGCATTGTGCTAAGG + Intergenic
1004360714 6:14968288-14968310 GTGTGCCAAGCACTGGGCTAGGG + Intergenic
1004395814 6:15245697-15245719 GCGTGCCATGCATTGAGCTAGGG + Intergenic
1004464500 6:15871984-15872006 GTGTGCCAGGCACTATTCTAAGG + Intergenic
1004775055 6:18834787-18834809 GCCTGGCAGGCACTGTGGAGGGG + Intergenic
1005164885 6:22908466-22908488 GCATCCCAGGCACTGTGGTGTGG + Intergenic
1005273973 6:24196781-24196803 GAGTGCCAGGCACTGGACTAAGG - Intronic
1005348820 6:24914419-24914441 AGGTGCCAGGCACTCTGCTAAGG + Intronic
1006375040 6:33667367-33667389 CTGTGCCAGGCACTGTTTTGGGG + Intronic
1006453707 6:34120275-34120297 GAGCCCCAGGCCCTGTGCTGAGG - Intronic
1006466504 6:34197732-34197754 TTGTGCCAGGCCCTCTGCTGGGG + Intergenic
1006525488 6:34601226-34601248 ATGCGCCAGGCACTGTGCTGAGG - Intronic
1006643326 6:35499502-35499524 ATGTGCCAGGCACTGTTCTCAGG - Intronic
1006749573 6:36368244-36368266 GATTGCCAGGCACTGCCCTGAGG - Intronic
1006749810 6:36369724-36369746 GTATACCAGGCACTGTGCTGAGG - Intronic
1006801497 6:36762831-36762853 GTGAGCCATGCACTGGGCTGGGG - Intronic
1006964286 6:37966381-37966403 AAGTGCCAGGCATTGTGCTAAGG + Intronic
1006979579 6:38136249-38136271 GTGTCACAGGCACTGTACTGGGG - Intronic
1007122732 6:39396735-39396757 ATGTGCCAGGCACTGTGCTGGGG - Intronic
1007159580 6:39778203-39778225 GTGTGCCAAGCGCTGTGCTAGGG - Intergenic
1007164937 6:39822412-39822434 TTGTGCCAGGCTTTGTGCTGGGG + Intronic
1007304470 6:40893309-40893331 GTGTTCCTGGCACTGTTCTGGGG - Intergenic
1007664267 6:43505294-43505316 GGGTGCTGGGCACTGGGCTGGGG - Exonic
1007725870 6:43915252-43915274 ACATGCCAGGCACTGGGCTAGGG + Intergenic
1007836756 6:44679902-44679924 GAATGCCAGGCACTGTGCATGGG + Intergenic
1008013649 6:46493177-46493199 GTGTGCCAGGCACTGTGCTTAGG - Intergenic
1008051448 6:46903854-46903876 CTGTGCTAGTCACTGTGCTGTGG + Intronic
1008055847 6:46945461-46945483 ATGTGCCAGGTACTGTGCTAGGG + Intronic
1008589011 6:52974902-52974924 GCCTGCCATGCAATGTTCTGAGG + Intergenic
1009243254 6:61204274-61204296 GCATGCCTGGCTCTGTGCAGTGG - Intergenic
1009857257 6:69280718-69280740 GTGTGCCAGGCATTGTGCTGAGG - Intronic
1010643229 6:78356157-78356179 AAGTGCCAGGTACAGTGCTGGGG + Intergenic
1011471682 6:87714314-87714336 GTGTGCCAGGCACTGTTCTGAGG + Intergenic
1012200576 6:96401430-96401452 ATGTGCCAGACACTGTGCTAAGG - Intergenic
1012864874 6:104606845-104606867 ATGTGCAAGGCACTGTCCTGTGG - Intergenic
1012987732 6:105892930-105892952 ATGTCCCAAGCACTGTGCTGGGG - Intergenic
1013454962 6:110322292-110322314 GCTTTGCAGGCAGTGTGCTGAGG - Intronic
1013604457 6:111734862-111734884 ATGTGACAGGCACTGTGCTAAGG + Intronic
1013948818 6:115754412-115754434 GTGTACCAGGCACTATGCTAGGG - Intergenic
1014199628 6:118594149-118594171 GCATGTTAAGCACTGTGCTGGGG - Intronic
1015466021 6:133549599-133549621 GGGTGCCTGGAACTGAGCTGGGG - Intergenic
1015570999 6:134621438-134621460 GGCTGCCAGGCAGTGTGCAGTGG + Intergenic
1015608266 6:134984323-134984345 ATGTGCCAGGCACTGGGCTAGGG + Intronic
1015870342 6:137769840-137769862 ATATGCCAGGCTCTGTGCTGAGG - Intergenic
1015941397 6:138456020-138456042 CTGTGCCAGGCACTGTGCTAAGG + Intronic
1016349095 6:143147889-143147911 GTGGGCCAGGCACTGTGCTAAGG + Intronic
1016358314 6:143241585-143241607 GTGTGTCAGGCACTGTTCTAAGG + Intronic
1016511710 6:144850038-144850060 GGGTTCCAGGCATTGTACTGAGG - Intronic
1016651244 6:146463464-146463486 ATGTGCCAGACACTGTGCTGAGG - Intergenic
1016731265 6:147430890-147430912 GCATGCCAAGCGCTGTGCTAAGG + Intergenic
1017692231 6:156978256-156978278 GTGTTCCAGGCAGTTTGCTGGGG + Intronic
1017693692 6:156992760-156992782 GGGTTGCAGGCACTGTGCGGTGG + Intronic
1017796473 6:157849394-157849416 GTGTTCCAGGCATTGTGCTTGGG + Intronic
1018101501 6:160445050-160445072 GCCTGCCTGCCACTGGGCTGTGG - Intronic
1018569127 6:165188261-165188283 ATGTGCCAGGCACTGGGCTGGGG + Intergenic
1019131905 6:169883122-169883144 GGGTGCCAGGCGCTGGGCTCAGG - Intergenic
1019599126 7:1872716-1872738 CCGTGTCTGGCCCTGTGCTGGGG - Intronic
1019664701 7:2245997-2246019 GTGCGACAGGCTCTGTGCTGGGG + Intronic
1019737516 7:2658048-2658070 GAGTGCCAGGCCCTGTACTGCGG - Intronic
1019744862 7:2694001-2694023 GGGTGCTGGGCCCTGTGCTGGGG - Intronic
1019746082 7:2701046-2701068 CCATCCCAGGCACTGTGCTGCGG + Intronic
1019860022 7:3649606-3649628 GAGTGCCAGGCACTGTTTTAAGG + Intronic
1020263591 7:6545697-6545719 ATGTGCCAGGCGCTGTGCTTGGG - Intronic
1021402945 7:20230866-20230888 GTGTGCCAGGCACTGTTTTAGGG - Intergenic
1021975769 7:26009804-26009826 GCTAGCCAGGCACTGTTCTAGGG + Intergenic
1022038532 7:26557334-26557356 GTGAGGCAGACACTGTGCTGGGG + Intergenic
1022226866 7:28372006-28372028 GTGTGCCAGGCTCTGTTCTGGGG + Intronic
1022289248 7:28985422-28985444 GTGTGCCTGGCACTCTGCTGGGG + Intergenic
1022473150 7:30694058-30694080 GTGTGCCAGGCTCTGAACTGGGG - Intronic
1022801437 7:33780807-33780829 GTGTGCCAGGCACAGTGGTAAGG + Intergenic
1022828523 7:34041300-34041322 TTGTGCCAGGTACTGTGCTTAGG - Intronic
1022838272 7:34137479-34137501 GTGTTCACGGCACTGTGCTGGGG + Intronic
1022923921 7:35041807-35041829 GTGTGCCAGGCACTGAGCAAGGG - Intergenic
1023474372 7:40561508-40561530 ATGTGCCAGGCATTGTGCTTGGG + Intronic
1023628053 7:42136454-42136476 ATGTGCCAAGCACTGGGCTGAGG - Intronic
1024222168 7:47297489-47297511 AGGTGCCGGGCACTGTCCTGTGG + Intronic
1024633832 7:51270419-51270441 ACGTGCCAGGCACTGTTCTCAGG + Intronic
1025106543 7:56175439-56175461 GCGTGCCCAGCACTGGGCTCCGG - Intergenic
1025996394 7:66530041-66530063 GCGTGCCAGATCCTGTGCTGCGG + Intergenic
1026033908 7:66817400-66817422 CAGTGCCAGGCACAGAGCTGGGG + Intergenic
1026535812 7:71237725-71237747 GTGTGCTAAGCTCTGTGCTGGGG - Intronic
1026630191 7:72031378-72031400 ATGTGCCAGGCACTGAGCTCAGG + Intronic
1026846544 7:73701982-73702004 CCTTGGCAGGCAGTGTGCTGGGG - Intronic
1026985683 7:74553956-74553978 CAGTGCCAGGCACAGAGCTGGGG - Intronic
1026988410 7:74569258-74569280 GCGTGCCAGACCCTGTGCTGTGG + Intronic
1027429574 7:78096404-78096426 ATGTGTCAGGCACTGTGCTAAGG - Intronic
1027570620 7:79861406-79861428 GGGTGCCAGGCACAGTGCAGTGG - Intergenic
1028266621 7:88733824-88733846 GGGTGCCAGGCAGAGTTCTGAGG - Intergenic
1028600811 7:92598446-92598468 ATGTGCCAGGCACTGTCCTTAGG - Intergenic
1028995320 7:97093666-97093688 ATGTACCAGGCACTGTGCTCAGG - Intergenic
1029104761 7:98166003-98166025 CAGTGCCCGGCCCTGTGCTGGGG + Intronic
1029655147 7:101919261-101919283 ACAGGCCAGGCACTGAGCTGAGG - Intronic
1029661482 7:101965255-101965277 GTGGGCGAGGCACTGTGCGGCGG + Intronic
1030218941 7:107077271-107077293 GTGTGTCAGGTACAGTGCTGGGG + Intronic
1030298344 7:107951249-107951271 GAGTGCCAGGAACTCTTCTGGGG - Exonic
1030323635 7:108196154-108196176 TTGTGCCAGACACTGTGCTGGGG - Intronic
1030980994 7:116185584-116185606 GCGTGCCTGGCTGTGTGCAGTGG - Intergenic
1031432037 7:121683612-121683634 ACGAGCCAGTTACTGTGCTGAGG - Intergenic
1032497402 7:132373014-132373036 ATGTGCCAGGCACTTTTCTGAGG + Intronic
1032791088 7:135242975-135242997 GTGTGCCAGGAACTGTGCTTGGG + Intronic
1033192843 7:139297948-139297970 TCGTCCCAAGCACTGTGGTGAGG + Exonic
1033210184 7:139454385-139454407 GGGTGCCAGGTTCTGTGCTCAGG + Intronic
1033259527 7:139830682-139830704 GCATGTCAGACACTGTGCTTCGG - Intronic
1033877709 7:145842733-145842755 GGGTGCCAGGCACATTCCTGAGG - Intergenic
1034288866 7:149911434-149911456 ATGTGCCAGTCACTGTGCCGGGG - Intergenic
1034662210 7:152781432-152781454 ATGTGCCAGGCACTGTGCCGGGG + Intronic
1034762581 7:153686919-153686941 GTGTGCCAGGAACTGTGGTAAGG + Intergenic
1035018056 7:155783520-155783542 GCATGCCAGGCACTGCTCAGGGG - Intergenic
1035051724 7:156002760-156002782 GCATGCCATGCACTGAACTGTGG - Intergenic
1035663904 8:1366091-1366113 GAAGGCCAGACACTGTGCTGGGG + Intergenic
1035898966 8:3436451-3436473 GTGTGCCAGGCACTATTTTGAGG - Intronic
1036102278 8:5800427-5800449 GTGGGCCAGGCAGTGAGCTGTGG + Intergenic
1036163198 8:6407280-6407302 GTGTGCCAGGCGCTGTGCTTAGG + Intronic
1036442469 8:8793635-8793657 GAGTGGGAGGGACTGTGCTGAGG + Intronic
1036549293 8:9802774-9802796 GGGGGCCAGGCAGTGAGCTGTGG - Intergenic
1036635810 8:10548836-10548858 GTGTGTCAGGCACTGTGCTGGGG + Intronic
1036700512 8:11010524-11010546 GTGTGCTAGGCATTGTGCTAGGG - Intronic
1037414369 8:18633367-18633389 GGATGCCAGGCACAGTGCTTTGG + Intronic
1037506869 8:19539452-19539474 ATATGCCAGGCCCTGTGCTGAGG - Intronic
1037630182 8:20648874-20648896 ATGTGCCAGGCATTGTGCTATGG - Intergenic
1037864610 8:22433273-22433295 GTGTGCCAGGCACTGTGTTAAGG - Intronic
1038486599 8:27939718-27939740 CAGTGCCAGGCAATGGGCTGGGG + Intronic
1038970979 8:32635219-32635241 CTGTGACAGGCATTGTGCTGGGG - Intronic
1039054504 8:33524724-33524746 GAGCACCAGGCACTCTGCTGAGG + Intergenic
1039431427 8:37528289-37528311 GCATGCCTGGCTCTCTGCTGTGG - Intergenic
1039437233 8:37568038-37568060 GCATGCCAGGCACTGTGCTGGGG + Intergenic
1039835562 8:41253722-41253744 ATGTGCAAGGCACTGTACTGAGG + Intergenic
1039869051 8:41529819-41529841 TAGTGCCAGGCACTGAGCAGAGG + Intronic
1039889459 8:41674250-41674272 ACATGCCAGGCACTGTGCTATGG + Intronic
1039969166 8:42306957-42306979 CTGTGTCAGGCACTGTGCTCAGG + Intronic
1040039607 8:42902842-42902864 TCGTATCAGGCATTGTGCTGAGG + Intronic
1040336140 8:46416959-46416981 GCCTGCCAGGGACAGTTCTGGGG - Intergenic
1041361732 8:57061828-57061850 GTGTGCCAGGCACTGTGTTAAGG - Intergenic
1041390459 8:57343122-57343144 ATGTGCCAGGCCCTGTGCTGGGG - Intergenic
1041694432 8:60720822-60720844 ACATGCCAGGCCCTGTGCTAAGG - Intronic
1042183664 8:66115855-66115877 ATGTGCCAGGCACTGTACTAAGG - Intergenic
1042769985 8:72369020-72369042 ATGTGCCAGGCACTGTTCTAAGG - Intergenic
1042863497 8:73336184-73336206 GTGTGCCAGGCATGGGGCTGTGG - Intergenic
1042977578 8:74487104-74487126 ATGTGCCAGGCACTGTGCCATGG - Intronic
1043167073 8:76916397-76916419 ACGTGCCAGGCACTGAGCTATGG + Intergenic
1043340824 8:79236908-79236930 CTGTGCCTGGCACTGTGCTAGGG + Intergenic
1043750216 8:83925730-83925752 CAGTGCCTGGCTCTGTGCTGTGG - Intergenic
1043969956 8:86517819-86517841 GTGTGTCAGGCACTGTTCTAAGG - Intronic
1044379693 8:91520071-91520093 ACATTTCAGGCACTGTGCTGGGG - Intergenic
1044608740 8:94071431-94071453 AAGGGCCAGGCACTGTGCTAAGG + Intergenic
1044756498 8:95468045-95468067 GGGTCCCAGGCACCATGCTGGGG + Intergenic
1045135842 8:99217221-99217243 GTGTGCCTGGCACTGTTCTAAGG + Intronic
1045252491 8:100493526-100493548 GTGAGCCAGGCACTGTGCCTGGG + Intergenic
1045456826 8:102388364-102388386 GTGTGTCAGGCATTGTACTGGGG - Intronic
1045471684 8:102518319-102518341 GTGTGCCAAGCACTGTGCTAAGG + Intergenic
1045955651 8:107902694-107902716 AAGTGCCAGTCACTGTGCTAGGG - Intronic
1046913821 8:119658793-119658815 GTGTGCCAGGGACAGTGCTGGGG - Intronic
1047315158 8:123726454-123726476 TCCTGCCATGCACTGAGCTGTGG + Intronic
1047416148 8:124666284-124666306 ACATGCAAGGCACTGTGCTCAGG + Intronic
1047516014 8:125555465-125555487 GCAGGCCAGGCAGTGTGCTGGGG + Intergenic
1047527386 8:125645218-125645240 GTGTGCCAGGCACCATGCTAAGG + Intergenic
1047622816 8:126625084-126625106 GAGTGTCAGGCACTTTGCGGGGG - Intergenic
1047632104 8:126719219-126719241 ACGTGCCAGACACTGTAATGAGG + Intergenic
1047751064 8:127880929-127880951 GCGTGTCCGGCACAGTGCTTGGG - Intergenic
1047770589 8:128027290-128027312 GAGTGCCAGGCTCTGTGCTCAGG + Intergenic
1047772884 8:128044581-128044603 GTGTTGCAGGCACTGTGCTGAGG - Intergenic
1047784721 8:128142602-128142624 TTGTGCCAGGCACTGTGCTTAGG - Intergenic
1047788634 8:128179054-128179076 GTGTGCCACACAGTGTGCTGAGG - Intergenic
1047819837 8:128506756-128506778 CTGTGCCAAGCACTATGCTGGGG - Intergenic
1047991033 8:130287204-130287226 TAGTTCCAGGCACTGTGCTTTGG - Intronic
1048013387 8:130476636-130476658 GGGCCCCAGGGACTGTGCTGAGG - Intergenic
1048161696 8:132027416-132027438 GCAGTCCATGCACTGTGCTGAGG + Intronic
1048233509 8:132667351-132667373 GTATACCAGGCACTGTGCTAAGG - Intronic
1048278833 8:133089718-133089740 GAGTTCCAGGCCCTGTCCTGGGG + Intronic
1048284518 8:133131317-133131339 ATTTGCCAGGTACTGTGCTGCGG + Intronic
1048366825 8:133745601-133745623 CTGTGCCAGGCACCATGCTGAGG - Intergenic
1048502723 8:134993519-134993541 ACGTGCCAGGCACTGTTCTATGG + Intergenic
1049012744 8:139898198-139898220 GCCTGCCAAGTGCTGTGCTGGGG - Intronic
1049022216 8:139965194-139965216 ACGTGCAAAGCACTGTGCTAGGG - Intronic
1049095831 8:140547593-140547615 GCGTGGGAGACACGGTGCTGGGG - Exonic
1049151711 8:141039208-141039230 GGGTGCCAGGGACTGTGGAGAGG - Intergenic
1049225445 8:141448560-141448582 GTGTGCCAGCCACAGAGCTGAGG - Intergenic
1049230051 8:141477268-141477290 GTGTGCCAGGCACCATTCTGGGG - Intergenic
1049245558 8:141560443-141560465 ACGTGCCAGGCTCTGTGCTGAGG + Intergenic
1050684768 9:8155574-8155596 ATGTGCCAGGCCCTGTGCTGGGG - Intergenic
1050711293 9:8467410-8467432 GAGTGCCAGACACTGTTCTAGGG + Intronic
1050925429 9:11257678-11257700 ATGGGCCAGGCACTGAGCTGTGG + Intergenic
1051070139 9:13156122-13156144 ATGTGCCAGGCACTCTGCTAAGG + Intronic
1052287771 9:26806367-26806389 GTGTGTCAGGCACTGTGCCAAGG - Intergenic
1052691567 9:31821726-31821748 GCGTGCCTGGCTGTGTGCAGTGG + Intergenic
1053114825 9:35490917-35490939 ATGTGCCAGGCACCGTGCTGGGG - Intronic
1053887794 9:42657767-42657789 GCCCGCCCGGCTCTGTGCTGAGG - Intergenic
1054226814 9:62465217-62465239 GCCCGCCCGGCTCTGTGCTGAGG - Intergenic
1054459428 9:65454869-65454891 GCGCCCCAGTCAGTGTGCTGGGG + Intergenic
1056991743 9:91419673-91419695 ATGTGCCAGGCACAGTGTTGAGG - Intronic
1057110884 9:92469744-92469766 GCGAGGCAGGAGCTGTGCTGAGG + Intronic
1057311607 9:93946560-93946582 GCGTGCCAGACACTGTGCTGGGG - Intergenic
1057829751 9:98397372-98397394 ACGTGCCAGGCTCTGGGCTAGGG + Intronic
1057955774 9:99406706-99406728 GCCTGGCAGCCCCTGTGCTGGGG - Intergenic
1058000189 9:99856944-99856966 CAGTGCCAGGCACTGTGCCAAGG + Intronic
1058422659 9:104847415-104847437 ATGTGCCAGGCACTGTGCGAGGG - Intronic
1058434262 9:104947850-104947872 GCGTGCCTGGCCCTGAGCTGAGG + Intergenic
1058606442 9:106728568-106728590 GTGTGCCAGTCCCTGTGCTAAGG - Intergenic
1058881027 9:109286079-109286101 GCCAGCCAGGCACTGTGCTTTGG - Intronic
1059332240 9:113542886-113542908 GAGGGCCAGGGACTGGGCTGGGG + Intronic
1059388221 9:113981841-113981863 GTGGGCCAGGCATTGTGCTAGGG + Intronic
1059463407 9:114449854-114449876 ATGTGCCAGGCACTGGGCTAGGG + Intronic
1059472009 9:114512390-114512412 GTGTGCCAGGCACTGTGTGTGGG + Intergenic
1059637606 9:116186101-116186123 GCAGGCCAGGCATTGTGCTAAGG - Intronic
1059954456 9:119501163-119501185 CTTTGCCAGGCACTGTGCTATGG - Intronic
1060243721 9:121926493-121926515 GGGTGCCAGGCGCTGGGCTGAGG + Intronic
1060290052 9:122293727-122293749 ATGTGCCAGGCTCTGTGCTGGGG + Intronic
1060433157 9:123568384-123568406 GTGTGCCAGGCACTGTGCTAGGG - Intronic
1060437033 9:123602548-123602570 ACTTGCCAACCACTGTGCTGAGG - Intronic
1060521625 9:124297322-124297344 ATGTGCCAGGCTCTGTGCTAAGG + Intronic
1060587271 9:124794466-124794488 ACGTGCCAGGCGCTGTGCTAGGG - Intronic
1060730844 9:126036059-126036081 ATGTGCCAAGCACTGTGCTAAGG + Intergenic
1060757362 9:126223299-126223321 GGCTGCCAGGCCCTGCGCTGCGG - Intergenic
1060824611 9:126680817-126680839 ATGTGCCAGGCACTGTGCGAAGG - Intronic
1060872119 9:127050891-127050913 ACGAGCCAGGCACCATGCTGTGG + Intronic
1061061028 9:128250634-128250656 GCGTGGCCAGCACTGGGCTGGGG + Intronic
1061149338 9:128820140-128820162 TAGTGCCAGGCACTGTGCACTGG + Exonic
1061192095 9:129087970-129087992 CTGTGCCAGGCTGTGTGCTGGGG + Intronic
1061203275 9:129149212-129149234 ATGTGCCAGGCCCTGAGCTGAGG - Intergenic
1061218711 9:129236701-129236723 GTGTCTCAGGAACTGTGCTGGGG - Intergenic
1061224656 9:129273856-129273878 GTGTGCCAGGCCCCATGCTGGGG - Intergenic
1061243191 9:129386320-129386342 GGGTGCCTGGCACTGTGCCGAGG - Intergenic
1061252180 9:129432854-129432876 GTGTGCCAGGCTCTGTCCAGTGG - Intergenic
1061389859 9:130311443-130311465 GTGTGCCAGGCCCTGTGCTGGGG + Intronic
1061455294 9:130693014-130693036 GTGTGCCAGGCGCTGTTCTAAGG - Intergenic
1061617939 9:131792451-131792473 GCGTGCCGGGCACTGAGCCATGG + Intergenic
1061707019 9:132461114-132461136 TTGTGCCAGGCACTGTGCGGAGG - Intronic
1061940108 9:133879260-133879282 GCGTACCAAGCACTGTGCTAGGG + Intronic
1062060442 9:134492659-134492681 GGGTGCCCTGCACGGTGCTGAGG + Intergenic
1062167163 9:135113640-135113662 GCCTCCCAGGCACTGCTCTGTGG - Intronic
1185778665 X:2826864-2826886 GGATACCAGGCACTGTGCTGAGG - Intergenic
1186273961 X:7919983-7920005 GTGTGGCAGGTACTGGGCTGCGG + Intronic
1186561056 X:10614032-10614054 GTGTGCCAGACACTGGGCTTGGG + Intronic
1186670868 X:11765789-11765811 CAGTGCCAGGCATGGTGCTGAGG + Intronic
1187135349 X:16542528-16542550 GTGGGCCAAGCATTGTGCTGGGG + Intergenic
1187144945 X:16628942-16628964 CTGTGCCAGGCACTGTTCTAAGG + Intronic
1187238738 X:17493523-17493545 ATATGCCAGGCACTGTGCTGGGG - Intronic
1187545101 X:20243351-20243373 GTGTGCCAGGCATTTTGCTAGGG - Intronic
1187963601 X:24589023-24589045 ATGTGCCCGGCACTGTGCTAAGG - Intronic
1188022023 X:25169656-25169678 GTGTACCAGGCATTGTGCTTAGG - Intergenic
1188684490 X:33053166-33053188 AAGTGTCAGGCATTGTGCTGGGG + Intronic
1189085699 X:38021303-38021325 GCTTGTCAGGCCCTGTGGTGAGG + Intronic
1189316101 X:40057650-40057672 CTGTGCCAGGCACTGAGCTAAGG - Intronic
1189393473 X:40598458-40598480 GAGTGGCAGTCACTGTGCTAGGG + Intronic
1189695277 X:43655972-43655994 GAGTGTCAGGCACTGAGGTGGGG - Intronic
1190070042 X:47272171-47272193 GCATACCAGGCCCTGGGCTGGGG + Intergenic
1190266111 X:48827892-48827914 TCGTGCCAGGCATTGTGATATGG - Intergenic
1190380844 X:49838488-49838510 GTGTGCCAGGCACTGTTCCAAGG - Intergenic
1190484643 X:50912346-50912368 GAGTGCCAGGCAGTGTGTTTGGG + Intronic
1190571612 X:51788333-51788355 GGGTGTCAGGCACTGTGATGAGG - Intergenic
1190816706 X:53935999-53936021 GGGTGCCAGGCATTGGGCTAGGG - Intergenic
1191666025 X:63703596-63703618 ATGTACCAGGCACTGTGCTGGGG + Intronic
1191773034 X:64783164-64783186 GTGGGCCAGGCAGTGAGCTGTGG + Intergenic
1192201746 X:69070745-69070767 ATGTGCCAGACACTGTTCTGGGG + Intergenic
1192331152 X:70176260-70176282 GTTTGCCAGGCACTGTGTTTAGG - Intergenic
1192344647 X:70290859-70290881 ATGTGCCAAGCACTGTGCTTGGG + Intronic
1192497312 X:71624456-71624478 ACGTGCTAGGCACTGTTCTCAGG + Intergenic
1193159759 X:78215198-78215220 GTGGGCCAGGCAGTGAGCTGTGG + Intergenic
1193505982 X:82345552-82345574 TGGTGCAAGGCACTATGCTGTGG + Intergenic
1195161616 X:102177149-102177171 GTGGGCCAGGCAGTGAGCTGTGG + Intergenic
1195616783 X:106918675-106918697 AGGTGCCAGGCACTGTGCTGAGG - Intronic
1196013814 X:110916272-110916294 CTATGCCAGGCACTGTGCTATGG + Intergenic
1196825574 X:119737780-119737802 GGGGACCAGGCTCTGTGCTGTGG + Intergenic
1197659130 X:129150768-129150790 GTGGGTCAGGCATTGTGCTGAGG + Intergenic
1197944561 X:131824773-131824795 GCGCGCCTAGCATTGTGCTGAGG - Intergenic
1198077443 X:133207320-133207342 GTGTCCCAGGCCATGTGCTGGGG + Intergenic
1198235031 X:134729135-134729157 GTGTGCCTAGCATTGTGCTGGGG - Intronic
1198300381 X:135328547-135328569 GCTTGCCAGGCACTTCTCTGAGG - Intronic
1198428491 X:136542899-136542921 GTGTGCCAGGCCCTTTGCTAGGG + Intronic
1198639844 X:138744483-138744505 AAATGCCACGCACTGTGCTGAGG - Intronic
1199267769 X:145848282-145848304 ACTTGCCAGGCACTGTTCTAAGG - Intergenic
1199618578 X:149678874-149678896 GTGGGCCAGGCAGTGAGCTGTGG + Intergenic
1199624064 X:149724375-149724397 GTGGGCCAGGCAGTGAGCTGTGG - Intergenic
1199681729 X:150229411-150229433 CTGTGCCAAGCCCTGTGCTGAGG - Intergenic
1199694744 X:150335888-150335910 GTATGCCAGGCATTGTGCTCTGG - Intergenic
1199780949 X:151059041-151059063 GTACGCCAGGCACTGTGCAGAGG - Intergenic
1199822300 X:151461487-151461509 ACATGCTAGGCACTGTGCTGAGG - Intergenic
1199976395 X:152897349-152897371 GTGTGCAAGGCCCTGGGCTGGGG - Intergenic
1199988809 X:152972310-152972332 GTGTGCCAAGCACTGTGCAGAGG + Exonic
1200082515 X:153585295-153585317 ACGTGCATGGAACTGTGCTGTGG - Intergenic
1200092830 X:153643882-153643904 GCGTGCCAGGCCCTGCACTGGGG + Intronic
1200181154 X:154151453-154151475 GCGTGCCAGGCTCTGTGCTAAGG + Intronic
1200186799 X:154188567-154188589 GCGTGCCAGGCTCTGTGCTAAGG + Intergenic
1200192450 X:154225705-154225727 GCGTGCCAGGCTCTGTGCTAAGG + Intronic
1200198205 X:154263509-154263531 GCGTGCCAGGCTCTGTGCTAAGG + Intronic
1200398072 X:156002885-156002907 GCCTGCAAGGGACTGGGCTGAGG - Exonic
1200399221 X:156009561-156009583 GGGCACCAGGCCCTGTGCTGGGG + Intronic
1201979419 Y:19891262-19891284 TTGTCCCAGCCACTGTGCTGTGG + Intergenic