ID: 903836232

View in Genome Browser
Species Human (GRCh38)
Location 1:26204828-26204850
Sequence GCATCCTTGGCAAACTGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903836224_903836232 11 Left 903836224 1:26204794-26204816 CCCTATGAGTCCATAACTTTTAC No data
Right 903836232 1:26204828-26204850 GCATCCTTGGCAAACTGTCCAGG No data
903836225_903836232 10 Left 903836225 1:26204795-26204817 CCTATGAGTCCATAACTTTTACC No data
Right 903836232 1:26204828-26204850 GCATCCTTGGCAAACTGTCCAGG No data
903836228_903836232 1 Left 903836228 1:26204804-26204826 CCATAACTTTTACCAGGGACAGG No data
Right 903836232 1:26204828-26204850 GCATCCTTGGCAAACTGTCCAGG No data
903836223_903836232 23 Left 903836223 1:26204782-26204804 CCTCTGGGGACTCCCTATGAGTC No data
Right 903836232 1:26204828-26204850 GCATCCTTGGCAAACTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903836232 Original CRISPR GCATCCTTGGCAAACTGTCC AGG Intergenic