ID: 903838743

View in Genome Browser
Species Human (GRCh38)
Location 1:26223255-26223277
Sequence CATAGAGAATAAAGGGCGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903838743_903838752 18 Left 903838743 1:26223255-26223277 CCGTCCGCCCTTTATTCTCTATG No data
Right 903838752 1:26223296-26223318 CCTTGCGGATGCAGAAGGTGTGG No data
903838743_903838750 13 Left 903838743 1:26223255-26223277 CCGTCCGCCCTTTATTCTCTATG No data
Right 903838750 1:26223291-26223313 AGTGACCTTGCGGATGCAGAAGG No data
903838743_903838748 3 Left 903838743 1:26223255-26223277 CCGTCCGCCCTTTATTCTCTATG No data
Right 903838748 1:26223281-26223303 ACCAGTGCTCAGTGACCTTGCGG No data
903838743_903838753 19 Left 903838743 1:26223255-26223277 CCGTCCGCCCTTTATTCTCTATG No data
Right 903838753 1:26223297-26223319 CTTGCGGATGCAGAAGGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903838743 Original CRISPR CATAGAGAATAAAGGGCGGA CGG (reversed) Intergenic
No off target data available for this crispr