ID: 903843320

View in Genome Browser
Species Human (GRCh38)
Location 1:26260517-26260539
Sequence TCCATGTGCACAGCTAGTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 130}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903843318_903843320 2 Left 903843318 1:26260492-26260514 CCGTCTCAGGAAAAAAAAAAAAA 0: 549
1: 3535
2: 89530
3: 68515
4: 108937
Right 903843320 1:26260517-26260539 TCCATGTGCACAGCTAGTTTGGG 0: 1
1: 0
2: 0
3: 11
4: 130
903843316_903843320 23 Left 903843316 1:26260471-26260493 CCTAGGTGATAGAGCAAGACTCC 0: 11
1: 944
2: 15315
3: 53580
4: 114518
Right 903843320 1:26260517-26260539 TCCATGTGCACAGCTAGTTTGGG 0: 1
1: 0
2: 0
3: 11
4: 130
903843315_903843320 27 Left 903843315 1:26260467-26260489 CCAGCCTAGGTGATAGAGCAAGA 0: 63
1: 2566
2: 34623
3: 87630
4: 163802
Right 903843320 1:26260517-26260539 TCCATGTGCACAGCTAGTTTGGG 0: 1
1: 0
2: 0
3: 11
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903843320 Original CRISPR TCCATGTGCACAGCTAGTTT GGG Intronic
900097651 1:946586-946608 TCCATGTGCACAGCTGGCCCAGG + Intronic
902154958 1:14477759-14477781 TCCAGGTGCACTGCCACTTTGGG - Intergenic
902708634 1:18223578-18223600 TTCATGGGCACAGGCAGTTTGGG - Intronic
903632264 1:24784457-24784479 TACATGTGAAGAGCTTGTTTTGG + Intronic
903843320 1:26260517-26260539 TCCATGTGCACAGCTAGTTTGGG + Intronic
904771833 1:32885226-32885248 TCCATGTGGACAGCTTCCTTGGG - Intergenic
907277400 1:53324459-53324481 TCTATGTGCACAGCCAGCGTTGG + Intronic
912842331 1:113049965-113049987 TCCAAGTGCCCATCTAGTATAGG - Intergenic
915919692 1:159965376-159965398 TCCCTGTACACAGTCAGTTTGGG + Intergenic
916026624 1:160838710-160838732 TCCCTGTAGACAGCTGGTTTGGG - Intronic
918691540 1:187486571-187486593 TCCTTGTGGACATCTAATTTGGG + Intergenic
922825012 1:228511848-228511870 TGCATGTGCACAGCTAGGGAGGG + Intergenic
923462957 1:234222959-234222981 TCCATATGCACTGCTAGTTATGG - Intronic
924572328 1:245248171-245248193 TCAATGTGCTCAGTTATTTTGGG - Intronic
1063503393 10:6574921-6574943 ATTATGTGCACAGCTAGATTTGG - Intronic
1063647969 10:7904831-7904853 TCCATGAGCTCAGCCAGTTACGG - Intronic
1065592010 10:27272341-27272363 TCCATGTGAACTGTTTGTTTTGG + Intergenic
1068483154 10:57621637-57621659 TCCTTGGGCACAGTTAGTTTAGG - Intergenic
1069250636 10:66261933-66261955 TCCATCTCCCCAGGTAGTTTGGG - Intronic
1069825956 10:71255236-71255258 TCCATGCTCACAGCTTGGTTGGG + Intronic
1070746482 10:78936819-78936841 GCCATGGGCACAGTTAGTTCAGG + Intergenic
1073572945 10:104596348-104596370 TCCAGGTGCCCTGCTGGTTTGGG - Intergenic
1074429341 10:113380304-113380326 TACATATGCACATCTATTTTAGG - Intergenic
1075039997 10:119100456-119100478 TCCATGTGGCCAGACAGTTTAGG + Intergenic
1076058950 10:127398345-127398367 TCCAAGGGCCCAGCTAGTCTTGG - Intronic
1076620273 10:131782778-131782800 ACCATGTGCACTGCTTCTTTGGG + Intergenic
1078544992 11:12240829-12240851 TCCATGTGAACAGCAAGTCCTGG - Intronic
1081929479 11:46858797-46858819 TTCTTGTGCACAGGTAGTTATGG + Exonic
1082264076 11:50100780-50100802 TACATGTGAACAGCTACCTTTGG - Intergenic
1083488433 11:62997853-62997875 GCTATGTGCACAGCCCGTTTTGG - Intronic
1086241772 11:84702388-84702410 TCCATTTGCACAGTAAGTTTGGG - Intronic
1087169283 11:95034163-95034185 TCTATGAGCACAGCTTATTTTGG - Intergenic
1092032572 12:5300254-5300276 TGCATTTGCACAGCTTGTTATGG - Intergenic
1094066052 12:26361823-26361845 TCCATGTGCACTATCAGTTTAGG + Intronic
1094488445 12:30943253-30943275 TCCTTGTGCAGATCTAGTTTGGG - Intronic
1096279809 12:50243048-50243070 TCCATTTGAATAGCTAGCTTTGG - Intronic
1097543523 12:60970260-60970282 CCAATGTGGACAGCTACTTTAGG - Intergenic
1098252690 12:68586249-68586271 ACCATGTGCAGAGATAGTTAAGG + Intergenic
1103717293 12:122952348-122952370 TCCATGAGCAGAGCCAGGTTTGG + Intronic
1111589431 13:90324469-90324491 TCAATGTGCACAGGTAGCTAAGG - Intergenic
1121181139 14:91929890-91929912 TTCATGGGCACAGCTACTTTTGG + Intronic
1121539560 14:94714870-94714892 GCCATGTGCTCAGCTCATTTTGG + Intergenic
1130989707 15:88869066-88869088 TCCTGGTGCACAGCTCCTTTTGG - Intronic
1131255079 15:90856715-90856737 TCCATGTGGACAGGATGTTTGGG - Intergenic
1132761775 16:1512038-1512060 TCTGTGTGCAGAGCTAGCTTCGG + Intronic
1133386745 16:5376201-5376223 TCCAAGTTCACAGCTAGTAAGGG + Intergenic
1138375214 16:56558668-56558690 GCCAAGTGCACAGGTGGTTTGGG + Intergenic
1139610481 16:68053409-68053431 CCCATGTGCATAGTTATTTTTGG + Intronic
1147520787 17:41170731-41170753 TCCATGTGGACTGTCAGTTTTGG - Intergenic
1148964822 17:51426064-51426086 TCCATGTGGAAAGCAACTTTGGG - Intergenic
1149551922 17:57546852-57546874 TCCAGGTGCAATGCTAGTTCTGG + Intronic
1150014736 17:61542956-61542978 TCCATCTGCATATCTACTTTGGG + Intergenic
1151335316 17:73436203-73436225 TCCATGTGCAAAGCCGGTATGGG - Intronic
1151428213 17:74045008-74045030 TCCATGTGCACAGATAGCCAGGG - Intergenic
1153276912 18:3376559-3376581 TCCATCTTCACAGCTAGCCTTGG + Intergenic
1154388359 18:13915720-13915742 TCCATGAGCTCAGCTAGTCAAGG + Intergenic
1155377172 18:25172832-25172854 TTCATGTGCAAAGCTTGGTTTGG - Intronic
1156707698 18:39902912-39902934 TCCATGTTCACAGCTAATATAGG - Intergenic
1157376169 18:47167624-47167646 TCCATCTCCACAGCTAATTTAGG - Intronic
1158029368 18:52944406-52944428 AGCAATTGCACAGCTAGTTTTGG - Intronic
1158608003 18:58912955-58912977 CCCATGTCCCCAGCTGGTTTAGG + Intronic
1159888632 18:73934465-73934487 TCAATATGCACAGCTTCTTTGGG - Intergenic
1165908176 19:39206478-39206500 TTCATGTGCACAGCTTGTAGAGG - Intergenic
927720353 2:25378246-25378268 TGAATGTGCACAGTGAGTTTAGG + Intronic
928107067 2:28477395-28477417 GTCATGTGCCCAGCTTGTTTGGG - Intronic
928224393 2:29435499-29435521 TCCACGTTCTCATCTAGTTTTGG + Intronic
935579205 2:104741946-104741968 TGCATTTTCACAGTTAGTTTGGG + Intergenic
935925175 2:108060394-108060416 TTCATGTTGACAGGTAGTTTTGG - Intergenic
936529194 2:113263603-113263625 GGCATGTGCACAGCCAGTTAGGG + Intronic
939436092 2:142180178-142180200 TCCATCTGAACAGTTTGTTTGGG - Intergenic
939903247 2:147877122-147877144 TCCATGTTAAAAGCTACTTTTGG - Intronic
940737356 2:157468359-157468381 TGCATATGCATATCTAGTTTAGG + Intronic
943307945 2:186290242-186290264 TACATGTTTACATCTAGTTTGGG + Intergenic
945510435 2:210694965-210694987 TCTATGGCCACAGCTACTTTTGG - Intergenic
948641948 2:239380763-239380785 TCCATGTGAACAAGCAGTTTGGG - Intronic
1173444079 20:43102355-43102377 TAAATGTGTACAACTAGTTTTGG + Intronic
1182826630 22:33271084-33271106 TCCATGAGCATAGCAAGATTTGG + Intronic
1183341524 22:37284377-37284399 TCCATTTGCACAGCTGGGTCAGG - Intronic
1185298252 22:50064774-50064796 TCCATGGGCACAGAGGGTTTTGG - Intronic
950232505 3:11288719-11288741 TCCATGTGGACAGAAACTTTTGG + Intronic
950861157 3:16148659-16148681 TCCAGGTGCTCTGCGAGTTTGGG + Intergenic
952887955 3:38023048-38023070 TCACTGTGCACAGCTAGCCTGGG - Intronic
953752807 3:45622247-45622269 TCTCTGTGCACATCTATTTTGGG + Intronic
955892739 3:63667248-63667270 GAAATGTGCACAGCTATTTTTGG - Intronic
956904586 3:73752702-73752724 TGCATGGGCACAGCTTGTTCTGG + Intergenic
957543211 3:81603045-81603067 ACCATATGGATAGCTAGTTTAGG - Intronic
965902726 3:173662905-173662927 TTAATGTGCATAGTTAGTTTAGG - Intronic
969463107 4:7339198-7339220 TCCGTGTGCACAGCTACTCTTGG + Intronic
970375302 4:15451126-15451148 TCCAGGTGCCCAGATAGTCTTGG + Intergenic
970782814 4:19759180-19759202 TCCATGAGGACAGATACTTTTGG + Intergenic
970837243 4:20424673-20424695 TCAATGTGCACATCTGCTTTTGG + Intronic
971525343 4:27610400-27610422 TCCATTTGTCAAGCTAGTTTGGG - Intergenic
971981715 4:33759883-33759905 TCCATGTGCACTGCTGTTGTTGG + Intergenic
983457944 4:167987198-167987220 TCCATGTGGATAGCTAGTGGTGG + Intergenic
985069809 4:186156961-186156983 TGCATATGCACTGCTATTTTTGG - Intronic
989103102 5:37838602-37838624 TCCTGGGGCCCAGCTAGTTTCGG - Intronic
989105338 5:37857823-37857845 TCCATGTGCACAGATAGGCAGGG + Intergenic
991478934 5:67055841-67055863 TCTATGTGCACAGTGTGTTTTGG - Intronic
991716106 5:69452407-69452429 TCCATCTCCAGAGCTGGTTTCGG + Intergenic
992433313 5:76731007-76731029 TCCATGTGTTCACCTATTTTTGG + Intronic
992791806 5:80220624-80220646 CCCAAGTGGAGAGCTAGTTTGGG + Intronic
997063127 5:130530448-130530470 CCCATGTTCACAGCTTGTCTTGG + Intergenic
997114437 5:131111441-131111463 GCCATGAGCACAGTCAGTTTGGG - Intergenic
997196476 5:131983642-131983664 TCCAAGTGCACAGCCAGATGGGG + Intronic
997466125 5:134089301-134089323 TCCCAGTGCCCAGCTGGTTTCGG - Intergenic
998699476 5:144681588-144681610 GCCATACGCCCAGCTAGTTTGGG + Intergenic
1001574425 5:172752800-172752822 TCCATAGGCCCAGCTAGTCTGGG - Intergenic
1002419325 5:179137532-179137554 TCCATGTCCTCAGCTACTCTGGG + Intronic
1002585823 5:180247157-180247179 TCTATGTGTCCAGCTATTTTTGG + Intronic
1003606077 6:7562351-7562373 TGCCTGTGCACAGGTAGATTTGG + Intronic
1004179439 6:13368200-13368222 TCCACGTGCACATCTAGTTCTGG + Intronic
1005252853 6:23967233-23967255 TCCATGTGCACATGAATTTTGGG + Intergenic
1008113023 6:47513992-47514014 TCCTTGTGTACAGCTTGTTCAGG + Intronic
1008952692 6:57177730-57177752 CCCATTTGCACAGCTAGTAGTGG + Intronic
1008976745 6:57435823-57435845 CCAATGTGCACAGGTGGTTTGGG + Intronic
1008981746 6:57491675-57491697 TCCTTTAGCTCAGCTAGTTTTGG + Intronic
1009169822 6:60384498-60384520 TCCTTTAGCTCAGCTAGTTTTGG + Intergenic
1012319513 6:97825484-97825506 TCCTTGTGCACATCTAATTCTGG - Intergenic
1012539725 6:100348016-100348038 TTCATGTGCCCAGCCAGCTTTGG - Intergenic
1013972094 6:116032802-116032824 TCCATGTTTACAGCTTTTTTGGG + Intronic
1015531526 6:134225953-134225975 CCACTGTGCACAGCTAATTTGGG - Intronic
1020448690 7:8297664-8297686 TCCATGTGTGCGGATAGTTTGGG - Intergenic
1022429980 7:30308539-30308561 TTCATGTGGAGAGCTTGTTTCGG - Intronic
1023427466 7:40053501-40053523 TTCAAGAGCACAGCAAGTTTAGG - Intronic
1023626828 7:42123716-42123738 TACATTTGCACAGCTAGTTGTGG - Intronic
1037643965 8:20773488-20773510 TCCATGTGCACAGCTGGACCTGG + Intergenic
1038461651 8:27722384-27722406 TTCATGTTCACAGCTACTCTGGG + Intergenic
1040944756 8:52873047-52873069 TCCATGTTGACAGCTGTTTTGGG + Intergenic
1042911692 8:73834487-73834509 TCACTGTGCTCAGCTATTTTTGG - Intronic
1045979334 8:108166466-108166488 TCCATGTGCACAGGAAGGTGTGG - Intergenic
1047654718 8:126964612-126964634 TGCATGTGCACAGCTGGCTTTGG + Intergenic
1052766711 9:32648969-32648991 TCCGTGTGAAGAGCTAGTTAGGG + Intergenic
1056112290 9:83407955-83407977 TCCATGTGTGTAGCTAGCTTGGG + Intronic
1057671583 9:97094848-97094870 TCAATGTTCACAGGTAATTTTGG + Intergenic
1059554428 9:115265049-115265071 GCCATGTGCTCAGCTAGTAATGG + Intronic
1060452310 9:123754594-123754616 TCCATCTCCCCAGCTAGTCTGGG + Intronic
1062286829 9:135777080-135777102 TCCATGTGAACATGTGGTTTTGG - Intronic
1062573236 9:137195013-137195035 TGCCTGTGCACACCTAGCTTTGG + Intronic
1187573459 X:20529669-20529691 TGCTTGTGCACAGCGAGGTTAGG + Intergenic
1198145016 X:133846862-133846884 TCTATGAGCAAAGCTGGTTTAGG - Intronic
1198767902 X:140096938-140096960 TGCATATGCACTGATAGTTTGGG + Intergenic
1200090746 X:153634822-153634844 TCCAGGTGGACAGATATTTTGGG - Intergenic