ID: 903845978

View in Genome Browser
Species Human (GRCh38)
Location 1:26280215-26280237
Sequence CTTTCCCCCAGCGCCAGTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 5, 3: 27, 4: 229}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903845978_903845987 18 Left 903845978 1:26280215-26280237 CCCGGACTGGCGCTGGGGGAAAG 0: 1
1: 0
2: 5
3: 27
4: 229
Right 903845987 1:26280256-26280278 TGCTTTGGACCCTAGCGCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 69
903845978_903845986 17 Left 903845978 1:26280215-26280237 CCCGGACTGGCGCTGGGGGAAAG 0: 1
1: 0
2: 5
3: 27
4: 229
Right 903845986 1:26280255-26280277 GTGCTTTGGACCCTAGCGCCCGG 0: 1
1: 0
2: 1
3: 8
4: 123
903845978_903845983 3 Left 903845978 1:26280215-26280237 CCCGGACTGGCGCTGGGGGAAAG 0: 1
1: 0
2: 5
3: 27
4: 229
Right 903845983 1:26280241-26280263 AGGGCTGTATCCCGGTGCTTTGG 0: 1
1: 0
2: 1
3: 9
4: 104
903845978_903845982 -5 Left 903845978 1:26280215-26280237 CCCGGACTGGCGCTGGGGGAAAG 0: 1
1: 0
2: 5
3: 27
4: 229
Right 903845982 1:26280233-26280255 GAAAGCGCAGGGCTGTATCCCGG 0: 1
1: 0
2: 0
3: 10
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903845978 Original CRISPR CTTTCCCCCAGCGCCAGTCC GGG (reversed) Intronic
900400454 1:2470872-2470894 CTTGCCCCCAGCCACCGTCCAGG - Intronic
900493876 1:2967390-2967412 CTTGCCCCAAGCGCCACTCAAGG - Intergenic
901679240 1:10903691-10903713 CTTTCCCCCAGTCAGAGTCCAGG + Intergenic
901897818 1:12329558-12329580 CCTTCCCACAGTGCCAGCCCTGG - Intronic
902074924 1:13776804-13776826 CTTTCCCCCAGCCTCAGTCGTGG + Intronic
903141251 1:21340409-21340431 CTTTCTCCCAGGGCCACTTCAGG + Intronic
903845978 1:26280215-26280237 CTTTCCCCCAGCGCCAGTCCGGG - Intronic
904205745 1:28854176-28854198 CTTTCCCACAGTGCCATCCCGGG - Intronic
904599933 1:31667717-31667739 CATTCCCCCAGAGCCAGTCTGGG - Intronic
904664359 1:32108441-32108463 CCGTCCCCCAGCCCCAGTCTGGG - Intronic
904720250 1:32502129-32502151 CTTTCTCCCTGCCCCAGCCCTGG + Intronic
905175912 1:36135244-36135266 CTTTCCCTCAGCCCCAATCGTGG + Intergenic
906962082 1:50425057-50425079 CCTTCCCCCACCCCCATTCCTGG - Intergenic
910766901 1:90791126-90791148 CTTGCCCCCACCCCCATTCCAGG - Intergenic
912257593 1:108076793-108076815 CTTTCTCCCACCCCAAGTCCTGG + Intergenic
913697705 1:121343802-121343824 CTTTCCCCAAGCACCACACCAGG + Intronic
914139851 1:144936249-144936271 CTTTCCCCAAGCACCACACCAGG - Intronic
915034626 1:152911429-152911451 GTTTGCCCCAGCTCCAGGCCAGG + Exonic
915467557 1:156106327-156106349 CTCTCCTCCAGCTCCAGTCCTGG + Intronic
915914760 1:159934321-159934343 CTTTCCCCCAGACCCAGCCCAGG - Exonic
916569710 1:166014410-166014432 CTTTCTCCCAGGGCCACTCCTGG - Intergenic
917212190 1:172642515-172642537 CATTCCCCCAGCATCAGTCAAGG - Intergenic
919214503 1:194534862-194534884 CTTTCCCCCAGATTCTGTCCAGG + Intergenic
920046645 1:203137096-203137118 CTTTCTCCCAGCCCCATTCTGGG - Intronic
920485097 1:206362452-206362474 CTTTCCCCAAGCACCACACCAGG + Intronic
921189924 1:212699933-212699955 GTGTCCCCGCGCGCCAGTCCCGG + Exonic
922240524 1:223752715-223752737 CTTTCCACCAACACCAGACCAGG - Intronic
924447337 1:244145508-244145530 CTTTCTCCCATCCCCACTCCAGG + Intergenic
924763372 1:247008990-247009012 GTTTGCCCCATGGCCAGTCCAGG - Intergenic
1064119089 10:12603828-12603850 CTTTCCCCCATCTCCAGCCCTGG + Intronic
1067017334 10:42768054-42768076 CTCTTCCCCACCGCCTGTCCTGG - Intergenic
1067435221 10:46272332-46272354 CCTGCCACCAGAGCCAGTCCTGG - Intergenic
1067781273 10:49209209-49209231 CTTTCCCCCAACCCCACTCCTGG + Intergenic
1067853071 10:49768088-49768110 CTTTCCACCAGCCCCAGTCCAGG + Intergenic
1067917637 10:50418152-50418174 CTTTCCGCCCGCGCCAGGGCTGG - Intronic
1069705401 10:70456388-70456410 CTTCCCCCCAGCTCCTGTCTTGG + Intergenic
1069716466 10:70524246-70524268 CTTGCCCCGATCCCCAGTCCTGG + Intronic
1070407077 10:76106611-76106633 TTCTCCCCCAGGCCCAGTCCTGG + Intronic
1072757471 10:98030553-98030575 CTTGCTCCCAGCCCCGGTCCCGG + Exonic
1073494309 10:103877799-103877821 TTTTCCCCCAGCACCTGTGCAGG + Intergenic
1073535751 10:104275230-104275252 CCAGCCCCCAGGGCCAGTCCCGG + Exonic
1074545239 10:114397258-114397280 CCTTCCCCCAGTCCCAGTCCTGG + Intronic
1075026964 10:118992563-118992585 CTTTGTCCCAGCACCAGTTCTGG + Intergenic
1076288020 10:129320431-129320453 CCTTCCCCCATCCCCATTCCTGG + Intergenic
1077128867 11:959228-959250 CTTTCCCCTAGGCTCAGTCCCGG + Intronic
1077378221 11:2215577-2215599 CTACCCCTCAGCGCCCGTCCCGG - Intergenic
1077378285 11:2215748-2215770 CTATCCCCCAGCGCCCGTCCCGG - Intergenic
1079284489 11:19116959-19116981 CGCTCCCCCAGCCCCAGCCCAGG - Intergenic
1080105267 11:28505074-28505096 CTTCCCACCAGGTCCAGTCCTGG - Intergenic
1081539250 11:44018128-44018150 CTGTCCCCCAGCCCCAGTGGGGG + Intergenic
1083265795 11:61546293-61546315 CTCTCCCCCACCGCCACCCCCGG - Intronic
1083431796 11:62617091-62617113 CTCTGCCCCGGAGCCAGTCCAGG + Exonic
1083616993 11:64031180-64031202 CCTGCTCCCAGCACCAGTCCTGG + Intronic
1083714663 11:64568505-64568527 CTGTCCCCCAACCCCAGCCCTGG + Intronic
1083897083 11:65625345-65625367 CTTCCCCCCGGCCCCAGTCACGG - Intronic
1083949706 11:65947244-65947266 CGTTCTCCCAGCGTCAGTCCAGG + Exonic
1084069884 11:66727608-66727630 CTTTCTCCCCGGGCCAGTTCCGG + Intronic
1084170863 11:67400452-67400474 CTTTCCCCCAGGGCCCTGCCTGG - Intronic
1084417579 11:69042337-69042359 CTTACCCCCAGCCTCAGTGCAGG + Intergenic
1089647026 11:119887007-119887029 CTTTCTCCCGCCGCCAGCCCAGG - Intergenic
1091550750 12:1533294-1533316 CTTTGCTCCAGCGCTAGTCCTGG + Intronic
1091597343 12:1886901-1886923 CCTTCCCCCACCGCCACTCAAGG - Intronic
1091943807 12:4515640-4515662 ATTTCCCCCCGCCCCAGCCCTGG - Intronic
1092165462 12:6339944-6339966 CTTTCCTCCAGCTCCAGGCCAGG + Intronic
1095198687 12:39356297-39356319 CTTGCCCCCAGCCCCAGTCATGG + Intronic
1095517025 12:43017197-43017219 CTTGCCCCCAGGGGCAGCCCTGG - Intergenic
1096472656 12:51889016-51889038 CTTTCCCCCTGGGCCACTCCAGG - Intronic
1096623746 12:52880287-52880309 CTGTCCCCCAGTGCCAATACTGG + Intergenic
1097245631 12:57606173-57606195 CCTTCCCCCACTCCCAGTCCTGG + Exonic
1098303396 12:69077579-69077601 ATTTCCCCCATCCCCAGCCCCGG - Intergenic
1100351078 12:93783175-93783197 TTTTCCCCCAGGGACTGTCCTGG + Intronic
1100811590 12:98344243-98344265 CTTTCCCTGAGAGCCAGTCGAGG + Intergenic
1101064119 12:101001785-101001807 CTTCTCCCCAGTGCCACTCCTGG - Intronic
1101131805 12:101697801-101697823 CCTGCCCCCAGCGCCAGGCGCGG + Exonic
1101766044 12:107700346-107700368 ATTTCCCCCACCCCCAGCCCTGG + Intronic
1102038821 12:109787679-109787701 GTTTCCCTCAGACCCAGTCCTGG + Intronic
1102172949 12:110855930-110855952 CTTTTCCCCAGCACCAACCCTGG + Intronic
1102500264 12:113347178-113347200 CCTTTCCCCAGCCCCTGTCCAGG - Intronic
1103147684 12:118609622-118609644 CTTTCTCCCTGCTCCACTCCAGG - Intergenic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1107978543 13:45713415-45713437 CATTTACCCAGCGCCCGTCCTGG - Exonic
1110301840 13:73937692-73937714 CTTTCCCTCAGGGCCTGCCCTGG - Intronic
1112345366 13:98584823-98584845 ATTTCCCCCATTGCCAGGCCTGG - Intergenic
1113581984 13:111436504-111436526 CGCTCCCCCACCTCCAGTCCAGG + Intergenic
1115765367 14:36617827-36617849 CTTTCCCTCTGCTCCAGCCCAGG - Intergenic
1119618330 14:76112988-76113010 CCTTCCCCCAGCTCCAGGCCCGG - Intergenic
1119653086 14:76397341-76397363 CAGTCCCCCAGGGCCAGTCTGGG + Intronic
1119702987 14:76767936-76767958 CATTCACCCAGAGCCAGGCCTGG - Intronic
1119845511 14:77826643-77826665 CTCTCCTCCAGCCCCATTCCTGG - Intronic
1120386710 14:83855637-83855659 CTGTCCCCAAGCAACAGTCCAGG - Intergenic
1121612258 14:95289685-95289707 CAATCCCCCAGCCCCATTCCTGG + Intronic
1122350629 14:101087863-101087885 CTGCCCCCCAGCCCAAGTCCAGG - Intergenic
1122969066 14:105145120-105145142 TGTACCCACAGCGCCAGTCCAGG - Intronic
1202856182 14_GL000225v1_random:53366-53388 CATTCCCCAAGCGCCAGTGTGGG - Intergenic
1125956466 15:43793944-43793966 CTCTCCCCCTGGGCCACTCCCGG + Exonic
1126972614 15:54134214-54134236 ATTTCCCCCACCCCCAGCCCTGG + Intronic
1128475849 15:67996288-67996310 CTTTCCCCAAGGGCCAGACCAGG + Intergenic
1128494153 15:68182390-68182412 CTATCCCCCAACCCCATTCCCGG + Intronic
1129742842 15:77998298-77998320 CTTTCCCCCTACGCCAGATCCGG - Exonic
1130957606 15:88638670-88638692 CATTCCCTGAGCTCCAGTCCTGG + Intronic
1131054657 15:89368317-89368339 CTATCCCCCAGCGCCGGAGCAGG + Intergenic
1131058311 15:89389640-89389662 CTTCCCCCCAGCTCCAAGCCAGG + Intergenic
1132660107 16:1057548-1057570 CTCTGCCCCAGCCCCAGTTCAGG + Intergenic
1133272605 16:4617839-4617861 CTCACCCCCAGGGCCAGTGCCGG - Intronic
1134746613 16:16593671-16593693 CTGTACCCCAGCTCCAGTCTGGG - Intergenic
1134998861 16:18760009-18760031 CTGTACCCCAGCTCCAGTCTGGG + Intergenic
1136344671 16:29666998-29667020 CTTTCCCCCATCTCCTGCCCAGG - Exonic
1136777621 16:32880148-32880170 CTTTCCCACAGGGCCGGGCCTGG - Intergenic
1136893003 16:33981366-33981388 CTTTCCCACAGGGCCGGGCCTGG + Intergenic
1137669700 16:50272001-50272023 CTTTCCCTCAGGCCCAGTCGTGG - Intronic
1137979204 16:53055362-53055384 CTGTCGCCCAGAGCCACTCCAGG + Intronic
1139480619 16:67228636-67228658 GTGTCCCCCACCGCCAGCCCAGG + Intronic
1139691704 16:68645729-68645751 CCTTTCCCCAGCGCCTGGCCGGG - Exonic
1141518062 16:84559573-84559595 CTGTCCTCCAGGGCCAGCCCTGG + Intergenic
1141832351 16:86516853-86516875 CTCACCCCCAGGGCCCGTCCAGG + Intergenic
1142239698 16:88939667-88939689 CTTTGCCCCCGCTCCAGTCTGGG - Intronic
1203080036 16_KI270728v1_random:1142257-1142279 CTTTCCCACAGGGCCGGGCCTGG - Intergenic
1142884567 17:2904621-2904643 CTCACACCCAGCCCCAGTCCTGG + Intronic
1143371953 17:6445802-6445824 CTTTCCCTCAGCTCTAGGCCTGG - Intronic
1145245868 17:21268991-21269013 CTTTCCCCCATCCTCAGCCCAGG + Intergenic
1145254696 17:21316216-21316238 CTGTCCTCCAGCCCCAGTCTGGG + Intergenic
1145321901 17:21771749-21771771 CTGTCCTCCAGCCCCAGTCTGGG - Intergenic
1146928594 17:36762144-36762166 CTTTCCCCCAGCCCAAGCCATGG - Intergenic
1150209044 17:63431728-63431750 CTATCCCCCACCCCCAGCCCTGG + Intergenic
1151334537 17:73432168-73432190 CTGTCCCCCAGCAGCAGCCCTGG + Intronic
1156236996 18:35215354-35215376 ATATCCCCCACCTCCAGTCCTGG - Intergenic
1156472762 18:37387907-37387929 GCTTCCCCCAGCCCCAGGCCAGG - Intronic
1156966055 18:43093950-43093972 CCTTACCCCAGTTCCAGTCCTGG - Intronic
1157293419 18:46425537-46425559 CTTTCCTCCAGAGCAAGTCCTGG + Intronic
1157542850 18:48524517-48524539 CTTTCCCCCATCACCAGTGTTGG + Intergenic
1157599281 18:48884316-48884338 CCTTCCCCCAGGCCCATTCCTGG - Intergenic
1160452420 18:78974401-78974423 CGCCCCCCCCGCGCCAGTCCGGG - Intergenic
1160674867 19:384590-384612 TTTTCCTTCAGGGCCAGTCCTGG + Intergenic
1161106745 19:2447575-2447597 CTTTTCCTCAGCGCCAGAGCCGG - Intronic
1161909768 19:7184443-7184465 AGTTCACACAGCGCCAGTCCTGG + Exonic
1162523020 19:11193126-11193148 CTGACCCCCAGCCCCAGGCCTGG - Exonic
1162523540 19:11195105-11195127 CCTTCCCCCCGACCCAGTCCAGG - Intronic
1163048370 19:14662197-14662219 CTTTCCCCCATGGTCTGTCCTGG + Intronic
1163275456 19:16281195-16281217 CTTTCCCTCGGCCCCAGCCCAGG - Intergenic
1165381992 19:35488259-35488281 GCTTCCCCCGGCGCCAGTCCTGG - Intronic
1165438872 19:35812545-35812567 CTGTCACCCAGCTCCAGGCCTGG - Exonic
1165472103 19:36009721-36009743 CTTTCCAGCAGCCCCAGCCCAGG - Intronic
1166329082 19:42068509-42068531 CTTTCCCCCAGATCCACTCTGGG - Intronic
1166345296 19:42161830-42161852 CTTCCCCCCAGCCCCCGCCCTGG + Intronic
1166871508 19:45873660-45873682 CTTTCCCCCAACTCTGGTCCAGG + Exonic
1167134426 19:47608662-47608684 CCCGCCCCCAGCCCCAGTCCCGG - Intronic
1167510894 19:49894903-49894925 CTTGCCTCCAGCGCCAGCCCTGG - Intronic
926127078 2:10278240-10278262 CCCTCCCCCAACCCCAGTCCAGG - Intergenic
926217859 2:10916106-10916128 CTTTTCCCCAGAGCCTGTGCTGG + Intergenic
928190122 2:29157326-29157348 CTTTCATCCAGAGCCAGTGCTGG + Exonic
928272940 2:29873469-29873491 CTGTCCCCCATCACCATTCCAGG - Intronic
932239620 2:70146437-70146459 CTTCCCCCCAGCACCACTCCAGG - Intergenic
936236041 2:110743628-110743650 CCTTCCGCCAGCCTCAGTCCTGG - Intronic
936434684 2:112494049-112494071 CTTTCCCCCAGAGACTTTCCGGG - Intronic
937197122 2:120167969-120167991 CTCTCCCCCAGCGCCATTCTTGG + Exonic
937429309 2:121825183-121825205 CTGTCCCTCGGTGCCAGTCCAGG + Intergenic
939820266 2:146948583-146948605 CTGACCCCCAGCCCCAGGCCAGG + Intergenic
944971796 2:205001776-205001798 CTTTCCACCAGTGCAAGTGCTGG - Intronic
946461977 2:219876942-219876964 CTTTCCCCCAGCTGCAGGCAGGG + Intergenic
947624754 2:231612686-231612708 CTTGTCCCCAGGGCCCGTCCAGG + Intergenic
948865167 2:240771490-240771512 CTTTCCCACAGCTGCACTCCAGG + Intronic
1169143935 20:3240430-3240452 CCCTCCCCCAGCGCGACTCCAGG + Intergenic
1170599603 20:17831254-17831276 CTAGCCCCCAGCCCCAGTGCGGG - Intergenic
1171250151 20:23640389-23640411 CTTTCCACCCTCGCCACTCCTGG - Intergenic
1172463111 20:35134973-35134995 CTATCCCCCTGCTCCTGTCCGGG - Intronic
1172526077 20:35601231-35601253 CTTTCCCCGACCCCCAGGCCTGG - Intergenic
1173062141 20:39672766-39672788 TTATCCCCCTGCGCCACTCCAGG + Intergenic
1175261673 20:57678479-57678501 CCCTCCCCCAGTGCCAGGCCTGG - Intronic
1175424777 20:58856273-58856295 CTTTCCCCCATCCCCCGACCAGG - Intronic
1175957888 20:62620964-62620986 CTTCCCCCCACCCCCAGGCCTGG - Intergenic
1179218312 21:39385757-39385779 CTTTGACCCCGCGCGAGTCCTGG - Intronic
1179505381 21:41836407-41836429 CCCACCCCCAGCCCCAGTCCTGG + Intronic
1179876622 21:44272140-44272162 CTTTCTCCCAGCGTCTGCCCAGG - Intergenic
1180824705 22:18854521-18854543 CTGTCTCCCAGGGCCAGGCCTGG + Intronic
1181125124 22:20697672-20697694 CTGTCTCCCAGGGCCAGGCCTGG + Intergenic
1181188025 22:21120026-21120048 CTGTCTCCCAGGGCCAGGCCTGG - Intergenic
1181211173 22:21290467-21290489 CTGTCTCCCAGGGCCAGGCCTGG + Intergenic
1181398331 22:22636421-22636443 CTGTCTCCCAGGGCCAGGCCTGG - Intergenic
1181501069 22:23315784-23315806 CTGTCTCCCAGGGCCAGGCCTGG - Exonic
1181706297 22:24651100-24651122 CTGTCTCCCAGGGCCAGGCCTGG - Intergenic
1182783752 22:32889284-32889306 TTTGCCCCCAGCTCCATTCCTGG + Intronic
1183930401 22:41232823-41232845 CTTTCTCCCTGCGTCAGCCCCGG - Intronic
1184654116 22:45932572-45932594 GTTTCCCCCATCTCCAGGCCAGG + Intronic
1184693080 22:46126164-46126186 CCTTCCCCAAGTGCCCGTCCCGG + Intergenic
1203215775 22_KI270731v1_random:4964-4986 CTGTCTCCCAGGGCCAGGCCTGG - Intergenic
1203274851 22_KI270734v1_random:80427-80449 CTGTCTCCCAGGGCCAGGCCTGG + Intergenic
950652131 3:14413703-14413725 CCTTCCCCCAGCCCCACCCCCGG - Intronic
952164778 3:30735618-30735640 CTTCCCCTCAGCCCAAGTCCTGG - Intronic
954134417 3:48575448-48575470 CTCTCCCCAAGGGCCAGACCAGG + Exonic
956837035 3:73103931-73103953 CTTTCCTCCAGCCTCGGTCCTGG + Intergenic
958619104 3:96533532-96533554 CTTAACCCCAGCCCCAGTCTAGG - Intergenic
961073639 3:123961520-123961542 GTTTTCCCCACCGCAAGTCCTGG - Intergenic
961971870 3:130976744-130976766 CTTTCTCCCAGCGTCATTTCTGG + Intronic
961993662 3:131218435-131218457 CTCTGCCCCAGGGGCAGTCCTGG - Intronic
964790956 3:160452889-160452911 CTCTGCCCCGGAGCCAGTCCAGG - Intronic
967880672 3:194299082-194299104 CTTGCTCCCAGGGCTAGTCCTGG - Intergenic
967967483 3:194973538-194973560 CTTTCCCCCAGGACCAGTCTCGG + Intergenic
968292041 3:197546591-197546613 GTTCCACCCAGCTCCAGTCCTGG + Intronic
968451992 4:680259-680281 CTCACCCCCAGCTCCAGGCCTGG + Intronic
968591658 4:1462704-1462726 CTTTTCCCCAGCTCCAGGGCTGG - Intergenic
969439183 4:7207393-7207415 CGTTCACCCAGCGCCTGGCCAGG + Intronic
973740059 4:53911018-53911040 CTTTCTCTGAGCACCAGTCCTGG - Intronic
974501888 4:62715582-62715604 GTTTCCCCCAGTACCAGTCAAGG - Intergenic
979690165 4:123551021-123551043 ATTTCCCCAAGCTCCAGTCCTGG - Intergenic
984822677 4:183896235-183896257 ATTTCACCCAGCGCTGGTCCTGG - Intronic
988573381 5:32394539-32394561 ATCTCCCCCAGCCCCAGCCCTGG - Intronic
989412776 5:41139797-41139819 CTTCCCTCCAGTGCCAGTGCTGG + Intergenic
990260768 5:54020204-54020226 CATTCCCCCAGTGCCAGTCCAGG - Intronic
991359160 5:65802320-65802342 CTTGCCTCCAGCGCCTGTGCTGG - Intronic
991620448 5:68539656-68539678 CTTTCGTCCTGTGCCAGTCCTGG + Intergenic
991977529 5:72197817-72197839 CTTTCATCCAGAGCCAGTGCTGG - Exonic
993343853 5:86758121-86758143 CTTTCCAGCAGAGCCAGTCTTGG - Intergenic
998146163 5:139729853-139729875 CTTCCCCACAGGACCAGTCCAGG + Intergenic
998151531 5:139760160-139760182 CATTCCCCCTACCCCAGTCCTGG + Intergenic
998372270 5:141669709-141669731 CTTGCCCACAGCACTAGTCCAGG + Exonic
999685436 5:154098473-154098495 CTTTCCCCCAGCTCCAGCTATGG - Intronic
1001574305 5:172751877-172751899 GTTTCTCCCAGCACCAGCCCAGG - Intergenic
1002759838 6:192721-192743 TTTTCTCCCAGCCCCTGTCCTGG - Intergenic
1002921304 6:1575272-1575294 CCTTCCCCCAGTGCCTGCCCTGG + Intergenic
1002924506 6:1597240-1597262 CCTCCCCCCAGCTCCAGTTCTGG + Intergenic
1003874590 6:10424475-10424497 CAGTTCCCCAGCGCCACTCCTGG + Intergenic
1007257453 6:40538779-40538801 CTTCCCCCCAGCCCCAGTCCTGG - Intronic
1007752252 6:44077457-44077479 CTTTCCCCCACCCCCAGTCCTGG - Intergenic
1007855410 6:44850530-44850552 CTGTCCCTCAGGGCCAGTGCAGG + Intronic
1011783596 6:90818467-90818489 CTCACCCCCAGCACCAGTCCAGG - Intergenic
1017123811 6:151048184-151048206 CGTTCCTCCATCACCAGTCCTGG - Intronic
1019727184 7:2609490-2609512 CATTCCCACAGCAGCAGTCCAGG - Intronic
1023054991 7:36284052-36284074 CTCTGCCCCACCGCCAGCCCTGG + Intronic
1023832926 7:44050583-44050605 CTTTCCACCAGCACCAGTTCTGG - Intronic
1024494155 7:50023878-50023900 CTTTCCCCCAGCCCCACTGATGG - Intronic
1027546955 7:79539324-79539346 CTTTCTCCCACCCCCAGGCCTGG - Intergenic
1029303126 7:99600026-99600048 CTTTCCCTGGGCACCAGTCCAGG - Intronic
1029714508 7:102318641-102318663 CTGTCCCCCAGCTGCAGGCCTGG - Intronic
1029842166 7:103376587-103376609 CTTTCCTCCAACTCCAGTTCAGG + Intronic
1032130628 7:129224925-129224947 CTTTCTCCGCCCGCCAGTCCCGG - Intergenic
1032790365 7:135238217-135238239 ATTTCCCCCAGCTCCTGACCAGG + Intronic
1033134587 7:138773969-138773991 CTTCCCCGCAGCGCCCCTCCCGG + Intronic
1035285308 7:157802239-157802261 GCTTCCCCCAGCGCCAGACCCGG + Intronic
1035306588 7:157936893-157936915 CTTTCCGCCATGGCCAGTCATGG + Intronic
1035671662 8:1422739-1422761 CATTCCCCCACCCCCAATCCTGG - Intergenic
1037895595 8:22651645-22651667 CTTTCCCACAGCAGCAGTACTGG - Intronic
1038625677 8:29190676-29190698 CTTCCCACCAGCGCAGGTCCAGG - Intronic
1040531463 8:48269787-48269809 CCTTCCCCCAGCGCCTGCCCTGG - Intergenic
1042887009 8:73563442-73563464 CTTTCCCCTACCCCCAGCCCTGG - Intronic
1049351854 8:142168874-142168896 TGTTCCCCCACCGCCAGCCCTGG - Intergenic
1049437633 8:142595077-142595099 CTTTTCCCCAACACCAGCCCTGG + Intergenic
1049443368 8:142619169-142619191 CTTTTCCCCAGGCTCAGTCCTGG - Intergenic
1050687650 9:8190179-8190201 CTTTCCTCCATCACCAGTCTGGG + Intergenic
1050755622 9:8999731-8999753 TTTTCCACCAGAGCCAGGCCTGG + Intronic
1050871144 9:10571710-10571732 CCATCCCCCTGCCCCAGTCCCGG - Intronic
1056581290 9:87889386-87889408 CTCTCACCCAGGGCCAGTACAGG - Intergenic
1056661210 9:88544589-88544611 CTTTGCCCCAGCGTCGGTGCTGG - Intronic
1057941511 9:99289270-99289292 CTTTGTCCCAGCGCCTGTCCAGG + Intergenic
1060587558 9:124795927-124795949 CTTGTCCCCAGGGGCAGTCCTGG - Intronic
1061584214 9:131555722-131555744 CTTTCCCCCACAGGCAGCCCAGG - Intergenic
1062055363 9:134467189-134467211 ACTTCCCCCAGCCCCATTCCAGG + Intergenic
1062403585 9:136383110-136383132 CTATCCCCAAGCGTCAGCCCTGG + Intronic
1062556074 9:137114017-137114039 CGTTCCCCCAGCGCTACTACGGG - Exonic
1190184806 X:48224271-48224293 CTCTCCCCCTGCACCATTCCAGG - Intronic
1193057412 X:77168410-77168432 CTTTGCCCCACCACCAGCCCTGG - Intergenic
1195229724 X:102834030-102834052 CTTCCCCCCATCTCCACTCCTGG + Intergenic
1200102225 X:153693894-153693916 CTTTCCCACAGGGCCGGGCCTGG + Exonic