ID: 903848662

View in Genome Browser
Species Human (GRCh38)
Location 1:26293358-26293380
Sequence GTTTTATGGACCCAAATCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903848659_903848662 -2 Left 903848659 1:26293337-26293359 CCTGGTTTTCAGAAATGGCCAGT 0: 1
1: 0
2: 1
3: 24
4: 194
Right 903848662 1:26293358-26293380 GTTTTATGGACCCAAATCTGTGG 0: 1
1: 0
2: 2
3: 12
4: 143
903848656_903848662 19 Left 903848656 1:26293316-26293338 CCATTCTTTGAAGAGAATGGGCC 0: 1
1: 0
2: 1
3: 17
4: 136
Right 903848662 1:26293358-26293380 GTTTTATGGACCCAAATCTGTGG 0: 1
1: 0
2: 2
3: 12
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903848662 Original CRISPR GTTTTATGGACCCAAATCTG TGG Intronic