ID: 903848662 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:26293358-26293380 |
| Sequence | GTTTTATGGACCCAAATCTG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 158 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 12, 4: 143} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 903848659_903848662 | -2 | Left | 903848659 | 1:26293337-26293359 | CCTGGTTTTCAGAAATGGCCAGT | 0: 1 1: 0 2: 1 3: 24 4: 194 |
||
| Right | 903848662 | 1:26293358-26293380 | GTTTTATGGACCCAAATCTGTGG | 0: 1 1: 0 2: 2 3: 12 4: 143 |
||||
| 903848656_903848662 | 19 | Left | 903848656 | 1:26293316-26293338 | CCATTCTTTGAAGAGAATGGGCC | 0: 1 1: 0 2: 1 3: 17 4: 136 |
||
| Right | 903848662 | 1:26293358-26293380 | GTTTTATGGACCCAAATCTGTGG | 0: 1 1: 0 2: 2 3: 12 4: 143 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 903848662 | Original CRISPR | GTTTTATGGACCCAAATCTG TGG | Intronic | ||