ID: 903852834

View in Genome Browser
Species Human (GRCh38)
Location 1:26318477-26318499
Sequence CTGTGGTTATGGAGGTGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 269}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903852827_903852834 2 Left 903852827 1:26318452-26318474 CCAGGAGATGTCCAAGTGGAGCC 0: 1
1: 0
2: 3
3: 9
4: 127
Right 903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG 0: 1
1: 0
2: 3
3: 23
4: 269
903852825_903852834 16 Left 903852825 1:26318438-26318460 CCTTTGGGGAGAGGCCAGGAGAT 0: 1
1: 0
2: 1
3: 35
4: 235
Right 903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG 0: 1
1: 0
2: 3
3: 23
4: 269
903852829_903852834 -9 Left 903852829 1:26318463-26318485 CCAAGTGGAGCCTGCTGTGGTTA 0: 1
1: 0
2: 0
3: 6
4: 136
Right 903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG 0: 1
1: 0
2: 3
3: 23
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903852834 Original CRISPR CTGTGGTTATGGAGGTGACA GGG Intronic
900134547 1:1109935-1109957 CTGTAGTTATGGCCGTGAAATGG + Intronic
900736153 1:4300712-4300734 CTGTGGTCATGGAGCTGAAGTGG + Intergenic
901129533 1:6953622-6953644 CTGGGCATAAGGAGGTGACAAGG - Intronic
901370608 1:8794456-8794478 CTGTGATTGTTGAGGTGGCAGGG + Intronic
902122890 1:14182984-14183006 CTGTGGGTATGGAACTGAGAGGG - Intergenic
902414235 1:16229736-16229758 CTGTGGTGATGGAGGTCCCGGGG + Intergenic
902697631 1:18150910-18150932 ATGTGGTAATGGACATGACAGGG - Intronic
903028529 1:20446371-20446393 CTGGGGTGATGGAAGTGACTGGG + Intergenic
903246924 1:22022983-22023005 CTGGGGTCATGGTGGTGACAGGG + Intergenic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
904030872 1:27532700-27532722 CTGTGTTTAGGGAGGGGAGAGGG - Intergenic
904265697 1:29317513-29317535 CTGAGGTTATGTGGGTGGCAAGG + Intronic
904783964 1:32971763-32971785 CTGTGGTATTGGAGGTGCCAAGG - Intergenic
904857690 1:33511350-33511372 ATCAGGTTATTGAGGTGACAAGG + Intergenic
906291474 1:44622340-44622362 TTGGGGTGATGGAGCTGACAGGG - Intronic
907520887 1:55022570-55022592 CTGCGTTTATGGAGGAGAGAAGG - Intergenic
909781969 1:79558854-79558876 CTGTGGTGGTGGTGGTCACATGG + Intergenic
909893956 1:81042473-81042495 CTGTGGTTATAAAGATGAAAAGG + Intergenic
911116571 1:94251782-94251804 CTGTTTTTATGGAGGAGTCAAGG - Intronic
911423160 1:97671760-97671782 CTGTGTTTGTGTGGGTGACAGGG + Intronic
911755634 1:101551349-101551371 CTGCAGATATGGATGTGACATGG + Intergenic
912878110 1:113383557-113383579 GTGGGGTTATGGAGGAGAGAAGG - Intergenic
912922029 1:113877959-113877981 CTGTGGGTATGGAATTGAGAAGG + Intergenic
913666956 1:121057560-121057582 CTGTGGTTGTGCAGCAGACAGGG + Intergenic
914018701 1:143844984-143845006 CTGTGGTTGTGCAGCAGACAGGG + Intergenic
914352820 1:146855077-146855099 CTGTGGTTAAGGAGGTGGTCAGG - Intergenic
914657254 1:149753187-149753209 CTGTGGTTGTGCAGCAGACAGGG + Intergenic
915084017 1:153372243-153372265 TGGTGGTAATGGTGGTGACAAGG - Intergenic
915146922 1:153800852-153800874 CTGGGGTCATGGAGGAGACTGGG - Intergenic
915538237 1:156550587-156550609 CTGTGGTTCTGGAGGTGCTGTGG - Intronic
915598345 1:156907829-156907851 CTGTGGTTATGGGGGTGTCAAGG + Intronic
919964640 1:202510362-202510384 TTCTGGATAAGGAGGTGACATGG + Intronic
920279727 1:204833757-204833779 TTGGAGTCATGGAGGTGACATGG + Intronic
921261692 1:213389925-213389947 CTGTGTTTATGGATGAGGCATGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924543632 1:245005018-245005040 CTGTGTCTATTGAGATGACATGG + Intronic
924783575 1:247173584-247173606 TTGTTATTATGGAGATGACAGGG + Intergenic
1062823004 10:548601-548623 CAAGGGTTATGGGGGTGACATGG + Intronic
1062866921 10:863560-863582 CCCTGGTTAGGGAGGTGCCATGG - Intronic
1063450725 10:6148282-6148304 CTGTGGTTAGGTTGGTGCCATGG + Intronic
1064323630 10:14329092-14329114 ATGAGTTTATGGAGGTGACTTGG - Intronic
1064913264 10:20427059-20427081 CTGCTGTGATGGAGGTGCCAAGG + Intergenic
1065370080 10:24975429-24975451 CTGTGGTTATGTTGTTGATATGG + Intergenic
1069052095 10:63805962-63805984 CTGTGGTGATAGAGGGGAGAAGG - Intergenic
1069277606 10:66612120-66612142 TTGTGATGATGGAGGTGAAAGGG - Intronic
1069751173 10:70745879-70745901 CTGGGGTCATGGAGGTGGCAGGG + Intronic
1070273071 10:74976665-74976687 CTGTGGCTGCAGAGGTGACATGG - Intronic
1072568947 10:96641948-96641970 CAGTGGCTCTGTAGGTGACAAGG - Intronic
1072664633 10:97384506-97384528 CTGAGGTTATGGAGTTCTCAGGG - Intronic
1073200101 10:101728304-101728326 CTGTGTTTATGGAGGACAGAGGG - Intergenic
1073453094 10:103621073-103621095 CTGTGGATATGTGGGTGTCAGGG + Intronic
1073700913 10:105925683-105925705 CTGTGCTGGTGGAGGTGGCAGGG - Intergenic
1074358614 10:112807340-112807362 CTGAAGTTAAGGAGTTGACAGGG + Intronic
1074508415 10:114091747-114091769 CTGGGGTTACCCAGGTGACAAGG - Intergenic
1077054005 11:581377-581399 CTGTGGCGGTGGATGTGACACGG + Intronic
1077762918 11:5123098-5123120 CTGTGGTTATCATGGTGACTAGG - Intergenic
1078606764 11:12784072-12784094 CAGAGGTTATGGGAGTGACAAGG + Intronic
1079488697 11:20963263-20963285 ATGTGGTTATGGTGGTAATAGGG - Intronic
1082101562 11:48177043-48177065 CTGGGGTTGTGGATGGGACATGG + Intergenic
1083397838 11:62403508-62403530 AGGTGGTGATGGAGTTGACAGGG - Intergenic
1084095166 11:66906603-66906625 CTGGGGGGATGGAGGTGACGTGG - Intronic
1084944288 11:72630560-72630582 CTGGGGTTGTGGAGGGGGCATGG + Intronic
1086607998 11:88720153-88720175 CTGTGATTTTGTACGTGACATGG - Intronic
1087251495 11:95905155-95905177 ATGAGGTTAAGGAGGTGAGATGG - Intronic
1087494738 11:98876719-98876741 ATGTGGATATGAAGTTGACAAGG - Intergenic
1088950891 11:114568757-114568779 TGGTGGTGATGGAGGTGACTAGG - Intergenic
1089952854 11:122546367-122546389 CTGTTCTGGTGGAGGTGACAAGG + Intergenic
1090059157 11:123448815-123448837 CTATGGTGATGGAGCTGAGAAGG - Intergenic
1090170163 11:124594868-124594890 CAGAGCTAATGGAGGTGACATGG - Intergenic
1091610479 12:2003898-2003920 CTGTGGCTATGGGGGAGGCAGGG - Intronic
1091636438 12:2200569-2200591 CTGAGGATACGGTGGTGACAGGG + Intronic
1093982983 12:25495793-25495815 CTGTGGTGATGTAACTGACAAGG + Intronic
1098396950 12:70029060-70029082 ATGGGGTTAGGGAGGTGGCAGGG + Intergenic
1098745985 12:74237243-74237265 TTGTGGTTCTTGATGTGACAGGG - Intergenic
1099750892 12:86771187-86771209 CTGAGATCATGGTGGTGACAGGG - Intronic
1102805381 12:115774993-115775015 CTGTGGATATGGATGGGAGAAGG - Intergenic
1103328490 12:120137569-120137591 CTGTGGTTCTGGAGGAGAGCTGG - Exonic
1103750144 12:123152546-123152568 CTGTAGTCATAGAGATGACATGG + Intronic
1107295934 13:38907545-38907567 CTGTGTGTATGGAGTTTACATGG + Intergenic
1108757552 13:53522250-53522272 CTGTGGTTGTGAAAGTGAAAGGG + Intergenic
1113574186 13:111382582-111382604 CTGTGGTGATGGAGGTGGGGTGG + Intergenic
1116346760 14:43803547-43803569 TTGTTCTGATGGAGGTGACAGGG - Intergenic
1118268904 14:64323111-64323133 CATTGGTTACTGAGGTGACATGG + Intronic
1118324679 14:64772976-64772998 ATGTGGTTATGGGGGGCACAGGG + Intronic
1120697498 14:87660059-87660081 CTGTGGTGGTGGTGGTCACAAGG + Intergenic
1122181508 14:99958450-99958472 CTGTGAATATGTAGGTTACATGG + Intergenic
1124466043 15:29940896-29940918 CTGTGGTTATGGTGGTCATCGGG - Intronic
1125249478 15:37683106-37683128 CTGTCTTTGAGGAGGTGACATGG + Intergenic
1126178968 15:45766214-45766236 TTGTGGTCATGGAGGTATCAAGG - Intergenic
1126568566 15:50126129-50126151 GTGTGGGTGTGGAGGTGTCACGG + Intronic
1128469685 15:67941744-67941766 CTGTGGATATGGAGTGGTCAGGG + Intergenic
1130596794 15:85254680-85254702 CTGTGGGTAGGCAGGTGCCAAGG + Intergenic
1131056096 15:89376030-89376052 CTGGGGTAATGGAGAGGACAAGG - Intergenic
1132072848 15:98794929-98794951 CTGGGGTTGGGGAGGTGTCAAGG - Intronic
1132763189 16:1520932-1520954 GGGTGGGTATGGAGGGGACAAGG + Intronic
1133066381 16:3210345-3210367 CTTTGGTTATGGAGGTGATGTGG + Intergenic
1133319580 16:4904656-4904678 CTGTGGATAGGGAGGAAACAGGG + Intronic
1133523544 16:6581724-6581746 CTGTGTTTATGGAGGTCACCTGG + Intronic
1133840232 16:9401535-9401557 TGGTGATGATGGAGGTGACAAGG - Intergenic
1135509336 16:23068766-23068788 CTGTGGCGAAGGAGATGACACGG + Exonic
1136418419 16:30117286-30117308 CTGTGGATAAGGAGGTGACTTGG + Intronic
1136790510 16:32965370-32965392 CTGTGGTAAGGAAGGTGCCATGG - Intergenic
1136879304 16:33888562-33888584 CTGTGGTAAGGAAGGTGCCATGG + Intergenic
1136922337 16:34343619-34343641 TTGTGGCTCTGGGGGTGACAAGG + Intergenic
1136982236 16:35068187-35068209 TTGTGGCTCTGGGGGTGACAAGG - Intergenic
1138037085 16:53619059-53619081 CTTGGGTTTTGGAAGTGACACGG + Exonic
1138053883 16:53812188-53812210 CTCTGGTTGTAGAGGTGTCAGGG - Intronic
1139198120 16:64944697-64944719 CTGGGTTTCTGGGGGTGACAGGG - Exonic
1139981206 16:70860441-70860463 CTGTGGTTAAGGAGGTGGTCAGG + Intronic
1140543935 16:75788384-75788406 AACTGGTTATGGTGGTGACATGG + Intergenic
1141768546 16:86074711-86074733 CTGGGGTGCTGGAGGTGACTGGG + Intergenic
1141785263 16:86195456-86195478 CTGTGGTTTTGGAGAGGACCTGG - Intergenic
1141892592 16:86936514-86936536 CTCTGGACATGGACGTGACATGG + Intergenic
1203092713 16_KI270728v1_random:1226828-1226850 CTGTGGTAAGGAAGGTGCCATGG - Intergenic
1142562688 17:820201-820223 CTGTGATGATGGTGGTAACATGG + Intronic
1143017127 17:3896798-3896820 CTTTCCCTATGGAGGTGACATGG + Exonic
1143589799 17:7875821-7875843 CTGTGGTTGTGCAGGTTTCAGGG - Intronic
1143592432 17:7893732-7893754 CTGGAATTATGGAGGTCACAGGG - Intronic
1144511810 17:15883480-15883502 CTGTGGTTCTGGAGGAGAGGAGG + Intergenic
1146820825 17:35982645-35982667 CTCTGTTTATGGAGGTGACAAGG + Intergenic
1147152776 17:38527954-38527976 CTGTGGTAAGGAAGGTGCCATGG - Intergenic
1149141242 17:53435747-53435769 CTGTGGTTGTTGAGATGAGATGG + Intergenic
1150887577 17:69105286-69105308 CTCTGATTTTGGAGATGACAGGG - Intronic
1151774895 17:76193896-76193918 CTGTGGATGTGGAGGTGGGAGGG - Intronic
1151869984 17:76830064-76830086 CTGTGGTTAGGGAGTTGGCTGGG + Intergenic
1152016728 17:77755900-77755922 CTGTGGCTCTGGTGGGGACAGGG - Intergenic
1152441632 17:80313407-80313429 CTGTGGTGATGGAGGTGTGGAGG + Intronic
1154268333 18:12898029-12898051 GTCTGGTGATGGACGTGACAAGG + Intronic
1158906054 18:62012910-62012932 CTGTGGTTATGGAGAGAGCAGGG - Intergenic
1159679109 18:71325482-71325504 TTGTGATTATGAAGGTGACGTGG + Intergenic
1160123917 18:76153529-76153551 TGGTGGAAATGGAGGTGACAGGG + Intergenic
1160663983 19:314348-314370 CTGTGGTGAGGGACGTGACTGGG + Intronic
1161347162 19:3774193-3774215 GTGTGGGTATGGAGGTGCAAGGG + Intergenic
1161639449 19:5411850-5411872 CTGTGTTTTTGGTGGAGACAGGG - Intergenic
1161644454 19:5444536-5444558 CTGTGGGGATGGGGGTGGCAGGG - Intergenic
1162068234 19:8138363-8138385 CTGTGGGTGAGGAGGGGACAGGG - Intronic
1162239235 19:9335455-9335477 CTGGGGGTATGGGGGAGACAGGG - Intronic
1162779201 19:12997788-12997810 CTGTGGATACGCCGGTGACATGG + Intronic
1162848417 19:13412097-13412119 CTGTGGTCATGGAGGTGGGGAGG - Intronic
1163013683 19:14440917-14440939 CTGTGGTGGTGGGGGTGACAAGG + Intronic
1163817567 19:19476062-19476084 CTCTGGTCATGGAGGGGACTCGG + Intronic
1165424543 19:35738681-35738703 ATGTGGGCATGCAGGTGACAAGG + Exonic
1165784609 19:38453545-38453567 CTGTCCTTATGGAGTTGACATGG + Intronic
1166103876 19:40588200-40588222 ATGAGGGTATGGAGGTGACAAGG + Intronic
1166526237 19:43511809-43511831 CTCTGGTTAGGAAGGTGATATGG + Intronic
927214314 2:20658424-20658446 CTGTGGTTATATAGGTGATATGG - Intergenic
927349702 2:22094659-22094681 CTGTGGGTGTGCAGCTGACATGG + Intergenic
929375444 2:41281486-41281508 CTGTGGTTATAGAAGTGTTAGGG + Intergenic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
935832171 2:107011598-107011620 CTCTGGTTGTGGTGGTGATATGG + Intergenic
937986376 2:127639951-127639973 CTGGGGATATGGTGGGGACAAGG - Intronic
938671293 2:133588975-133588997 CAGTGGTTGTGGAGGTCACATGG + Intergenic
939410057 2:141813670-141813692 CTGTAGTTCTGCAAGTGACAGGG + Intronic
940105088 2:150090399-150090421 CTGTGGTTGTGGGAGTGAAAAGG - Intergenic
941070114 2:160945979-160946001 CTGTGGGTTTGGAAGAGACATGG + Intergenic
942040444 2:172056539-172056561 CAGTGGTGAATGAGGTGACAAGG - Intronic
942861018 2:180612205-180612227 ATGTGCTTCTGGAGGAGACAGGG + Intergenic
944042152 2:195367883-195367905 CTGTGGTTACCCAGGTGACCTGG + Intergenic
944546009 2:200799636-200799658 CTGTGACTATGTAGGTTACATGG + Intergenic
945233522 2:207613328-207613350 CTGTTGTTAAGGAGCTGACTTGG - Exonic
945996420 2:216440572-216440594 CTGTGTTTATGAAGGTGTCTTGG + Intronic
946105202 2:217363161-217363183 CTGTGGGAATTGAGGTGACTGGG - Intronic
947165732 2:227259948-227259970 ATGTGCTTATGGAATTGACATGG + Intronic
949031316 2:241798778-241798800 CTGGGGTTCGGGAGCTGACAGGG - Intronic
1169169604 20:3454208-3454230 CAGTGGTTATGGGGGTGAGGAGG - Intergenic
1170539141 20:17370791-17370813 CTGCAGTTATGGAGGAGGCAGGG - Intronic
1170567077 20:17613461-17613483 CTGAGGTCTGGGAGGTGACAAGG + Intergenic
1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG + Intergenic
1170913947 20:20604263-20604285 CTGTGCTTAAGGATGTGGCATGG - Intronic
1172883589 20:38217185-38217207 CTGGGGCTATGGTGGGGACAGGG - Intronic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1174087191 20:48017857-48017879 CTGGGCTTATGGAGGGGACTGGG + Intergenic
1175326199 20:58130009-58130031 ATGTGGTCATGGAGGCAACAGGG - Intergenic
1175616922 20:60407607-60407629 CTGAGGACATGGTGGTGACAAGG - Intergenic
1175844639 20:62051996-62052018 TTGTGGTTGTGGAGGTGACATGG - Intronic
1176131144 20:63497368-63497390 CTGTGGTGAGGGAGGTGACCTGG - Intronic
1178329706 21:31677247-31677269 CGGTTGTTATGTAGGTGAGAGGG - Intronic
1178643526 21:34365867-34365889 CTGTGGTCATGGAGCAGGCATGG + Intronic
1179123941 21:38575064-38575086 CTGAGGCTCTGGAGGTGAGAGGG - Intronic
1179188787 21:39106337-39106359 CTGTGGTTGTGCAGCTCACATGG + Intergenic
1181781193 22:25194748-25194770 CTGTGGTGCTGGAGGAGACAAGG - Exonic
1182255032 22:29031797-29031819 CTGTGGTCAGGGAGGGGAAAAGG - Intronic
949151591 3:774620-774642 CTGTGTGTTTGGAGGTGATAGGG - Intergenic
949369968 3:3324297-3324319 CTGTGTGTATGGCTGTGACATGG - Intergenic
949801820 3:7912495-7912517 CTCTGGTTTTGGGGGTGATAGGG - Intergenic
950758469 3:15198384-15198406 CTGGAGTTATGGGGGTGACAAGG - Intergenic
950918487 3:16668964-16668986 CTGTGGGTTTGGAGTTGGCAGGG + Intronic
951626586 3:24671267-24671289 CTGTGGTTATAGTGGTGAGTAGG + Intergenic
955525087 3:59811872-59811894 CTGTGATTGTGAAGGTGACAAGG + Intronic
958757277 3:98264641-98264663 CTGTGGTTACAGTGGTTACAAGG - Exonic
963769912 3:149379071-149379093 CTGTGGTTAGTGATGTGGCATGG + Intergenic
963829613 3:149992844-149992866 CTATGGATATGGAGATGAAAGGG - Intronic
966576940 3:181512546-181512568 CAGTAGTTATGAAGGTGAGAGGG + Intergenic
969323236 4:6425686-6425708 CTGTGGTGATGGGGATGGCAGGG - Intronic
973834213 4:54792866-54792888 CTGTGGTGATGAAAGTGACAGGG - Intergenic
975661654 4:76694926-76694948 CTGAGGGCATGGAGGTGCCAGGG + Intronic
977583173 4:98746914-98746936 CAGTGGATAGGGAGGTGAAAAGG - Intergenic
979210974 4:118102359-118102381 CTGTGGTCATGGAGGAGGTAAGG - Intronic
979923161 4:126525963-126525985 TTGTGGTAATGCAGGTGATATGG - Intergenic
979984322 4:127295618-127295640 CTGTGGTTTTGCAGGGTACAGGG + Intergenic
980251336 4:130319648-130319670 CTGTGGTTATGAAGAAGAGAGGG + Intergenic
982313563 4:154009577-154009599 CTCTGGCTCTGGAGGTGACTGGG + Intergenic
982979569 4:162115592-162115614 CTGTGAAGATGGAGGTTACAAGG - Intronic
983074784 4:163312739-163312761 CTGTGTGTATGGGGGTGGCAAGG - Intergenic
986214679 5:5708285-5708307 CTGTGACTATGTAGGTTACATGG - Intergenic
986834251 5:11617073-11617095 CTGTGGCTATGCATGTGCCAAGG + Intronic
987200994 5:15578021-15578043 GTGTGGTCATGGATGTAACACGG + Intronic
987823156 5:22991742-22991764 CTGTGGTGATGGTGGCTACAGGG + Intergenic
989129762 5:38095342-38095364 CTGAGGTTTAGGAGGTGGCAGGG - Intergenic
992327115 5:75671134-75671156 CTATGATGATGGTGGTGACAGGG + Exonic
994580928 5:101641027-101641049 CTGTGTTTATGGAAGGGAGAGGG - Intergenic
995355585 5:111234460-111234482 CAGTGGTCATGGAGTTGAGAGGG + Intronic
998523931 5:142825427-142825449 CTGAGGTTATGGAGATGAGAAGG + Intronic
999499226 5:152130171-152130193 CTGTGGTTATTGTGGTGGGAGGG - Intergenic
1001880450 5:175239344-175239366 CTGTGGTTAGGGAAGTGCCTGGG - Intergenic
1004741057 6:18461601-18461623 CTCTGGTTCTGGAGATGAAATGG + Intronic
1005691465 6:28311090-28311112 CTGCTGTTGTGGAGGTGGCAGGG + Intergenic
1006516707 6:34549535-34549557 CTGTGGTTCGGGAGCTGTCAGGG - Intronic
1006808299 6:36803225-36803247 CCGTGGTAGTCGAGGTGACAAGG - Intronic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1007718888 6:43873679-43873701 CTGAGGTCAGGGAGGTAACAGGG + Intergenic
1010634114 6:78235323-78235345 CTGTGATTCTAGAGGTGACAAGG - Intergenic
1011262463 6:85483672-85483694 CTGTGGTTATTGAGCTGAAAGGG + Intronic
1012204428 6:96442871-96442893 CTGCTGTGATGGAGGTGGCAGGG - Intergenic
1012240047 6:96860908-96860930 ATGAGGTTTTGGAGGGGACAGGG + Intergenic
1014119977 6:117713333-117713355 TTGTGGTTTTGGAAGAGACAGGG + Intergenic
1015404415 6:132821059-132821081 GCGTGGTTAAGGAGGTGACCTGG + Intergenic
1016154044 6:140781182-140781204 CTGTGGTGGTGGAGGCCACAAGG + Intergenic
1016376594 6:143427447-143427469 CTGTAGTCATGGAGGTGAACTGG + Exonic
1016425575 6:143933028-143933050 CTGTTCTGATGGAGGTGGCAGGG + Intronic
1017769938 6:157637194-157637216 CTGTGGCTTTGGAGGTGGCATGG + Intronic
1018371634 6:163173843-163173865 CTTTGGCTATGGAGAGGACAAGG - Intronic
1018938149 6:168287516-168287538 CTGTTCCCATGGAGGTGACAGGG + Intergenic
1019352693 7:562365-562387 CTGTGGAGCTGGAGGCGACAGGG - Intronic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1019613080 7:1946748-1946770 CTAGGGTTCTGGAGATGACAGGG + Intronic
1019953301 7:4390855-4390877 CTGTGATTCTTCAGGTGACAGGG + Intergenic
1020786045 7:12573709-12573731 CTTAGGTTAGGGATGTGACAGGG - Intronic
1020809423 7:12833376-12833398 ATGAGGTTTTGGAGGTGCCAGGG - Intergenic
1024210353 7:47197946-47197968 CTGATGCTAGGGAGGTGACAAGG - Intergenic
1026541027 7:71280159-71280181 CTGAGGTTGTGGAAGAGACAGGG + Intronic
1027235334 7:76294582-76294604 CAGTGGTGATGGGGGTGGCATGG + Intergenic
1027313515 7:76970263-76970285 CTGTTGTCAGGGAGGTGCCATGG + Intergenic
1027764267 7:82320416-82320438 CTGTGGTTTTGAGGGAGACAGGG + Intronic
1028658230 7:93235481-93235503 CTGTGGTAATCCAGGTGAGAGGG + Intronic
1028795506 7:94897302-94897324 CTGGGGTTGGGGAGGTGAGAAGG - Intergenic
1028855617 7:95589273-95589295 CTGTGGGGGTGGAGGTAACAAGG + Intronic
1029510661 7:100992825-100992847 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029511150 7:100996074-100996096 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029511878 7:101000745-101000767 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029512370 7:101003994-101004016 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1031084580 7:117289907-117289929 CCGGGATGATGGAGGTGACAAGG + Intronic
1031401420 7:121329386-121329408 ATGTGAGTATGGAGGTGGCAGGG + Exonic
1031761281 7:125716159-125716181 CTGTGCTGTTGGAGGGGACACGG - Intergenic
1032991052 7:137395484-137395506 CTGTGCTTATGGAAGTGCCTGGG - Intronic
1035153708 7:156895267-156895289 CTGGGGTGATGGAGGTGACCAGG - Intergenic
1035983623 8:4401596-4401618 TTGTGGTGACCGAGGTGACAGGG - Intronic
1037556726 8:20032187-20032209 TGGTGGTTATGAGGGTGACATGG - Intergenic
1037921775 8:22811666-22811688 CTCTGGTTCAGGAGGTCACAGGG + Intronic
1039306067 8:36264396-36264418 ATGAGGATATGGAGATGACAGGG - Intergenic
1047721815 8:127647584-127647606 CTGTGCTAATGAAGCTGACAGGG + Intergenic
1047724323 8:127670923-127670945 GTGTGGTCATGGAGCTGCCAGGG + Intergenic
1048340028 8:133531555-133531577 CTGGGGTCAGGGAGGTGGCAGGG - Intronic
1048496879 8:134942751-134942773 CAGTGGTGATGGAGATGACATGG + Intergenic
1049161144 8:141098736-141098758 CTGAGGTCAGGGAGGTAACACGG - Intergenic
1050564806 9:6870909-6870931 CTGTGGTCCTGGATGTCACAAGG + Intronic
1051515158 9:17922539-17922561 CTGTGGTTATGTGGGTGAGGGGG - Intergenic
1052365619 9:27608994-27609016 CTGTTCCCATGGAGGTGACAGGG + Intergenic
1053247870 9:36550002-36550024 TTGTATTTATGGAGGAGACAGGG + Intergenic
1053472655 9:38357963-38357985 GTGTGGTTATGAAGGTGGGAGGG + Intergenic
1056793998 9:89644400-89644422 CCGAGGATATGGTGGTGACAGGG + Intergenic
1057407725 9:94788820-94788842 CTGTGGTGCTGGAGGAGAAATGG - Intronic
1059463262 9:114448861-114448883 CTGTGGGTGAGGAAGTGACAAGG - Intronic
1060250597 9:121983830-121983852 ATGTGGTTATGGATAAGACAAGG - Intronic
1061008270 9:127940775-127940797 CTGTCTTTAGGGAGGTGATAAGG - Exonic
1061570320 9:131474061-131474083 CTGGGGCTATGGGGGTGGCAGGG - Intronic
1062266682 9:135689732-135689754 CTTTGGTGAGGGAGGTGAGAGGG - Intergenic
1062287343 9:135779028-135779050 CTGTGGTTGTGGGGGTTTCAGGG - Intronic
1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG + Intronic
1187916040 X:24152652-24152674 CTGTGGTTGTTGAGGTGTTAAGG + Intronic
1188972262 X:36632570-36632592 CTGTGGTGATGGTGGACACAAGG - Intergenic
1190511865 X:51181357-51181379 CTATGGTTATTGAGATCACATGG + Intergenic
1191953487 X:66619494-66619516 CTTAGGTTGTGGAGGTGAGAGGG - Intronic
1193954590 X:87844201-87844223 CTGCTTTCATGGAGGTGACAGGG + Intergenic
1194815865 X:98440392-98440414 CTGTTCTGATGGAGGTGGCAAGG - Intergenic
1196575902 X:117318726-117318748 CTGTGGTCATGTAGATGAAATGG - Intergenic
1197518962 X:127473430-127473452 CTGTTCTGGTGGAGGTGACAGGG - Intergenic
1197556700 X:127964363-127964385 CTGTTCTTGTGGAGGTGGCAGGG + Intergenic
1199106005 X:143869197-143869219 TTGTGGTTGTGGTGGTGATAAGG - Intergenic
1199391197 X:147281278-147281300 CTTTGGTTTTAGAGGTGAAAAGG - Intergenic
1199391416 X:147283976-147283998 CTTTGGTTTTAGAGGTGAAAAGG - Intergenic
1199391634 X:147286675-147286697 CTTTGGTTTTAGAGGTGAAAAGG - Intergenic
1200313278 X:155101822-155101844 CTGTGGTTAGAGAAGTGATAGGG - Intronic
1202095931 Y:21248216-21248238 ATGTGTTTAAGGAAGTGACAGGG - Intergenic
1202300271 Y:23406200-23406222 TTCTGGATACGGAGGTGACATGG + Intergenic
1202570540 Y:26264398-26264420 TTCTGGATACGGAGGTGACATGG - Intergenic