ID: 903857788

View in Genome Browser
Species Human (GRCh38)
Location 1:26346806-26346828
Sequence AAGGCCAAGCGATTTGCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 214}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903857788_903857795 15 Left 903857788 1:26346806-26346828 CCTCAGGCAAATCGCTTGGCCTT 0: 1
1: 0
2: 2
3: 30
4: 214
Right 903857795 1:26346844-26346866 TCTCATCTGTGAAATGGGCATGG 0: 1
1: 10
2: 78
3: 267
4: 829
903857788_903857793 9 Left 903857788 1:26346806-26346828 CCTCAGGCAAATCGCTTGGCCTT 0: 1
1: 0
2: 2
3: 30
4: 214
Right 903857793 1:26346838-26346860 TTGCTTTCTCATCTGTGAAATGG 0: 2
1: 9
2: 175
3: 1080
4: 4727
903857788_903857794 10 Left 903857788 1:26346806-26346828 CCTCAGGCAAATCGCTTGGCCTT 0: 1
1: 0
2: 2
3: 30
4: 214
Right 903857794 1:26346839-26346861 TGCTTTCTCATCTGTGAAATGGG 0: 1
1: 42
2: 362
3: 2142
4: 6930

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903857788 Original CRISPR AAGGCCAAGCGATTTGCCTG AGG (reversed) Intronic
901779916 1:11587127-11587149 AAGGTCAAGAGAGTTGCCTGAGG + Intergenic
901838404 1:11938746-11938768 AAGGCCATGCGTTTTGGGTGAGG - Intronic
902322832 1:15680775-15680797 AAGGCAAAGTGACTTGCCTGAGG + Intergenic
902584335 1:17428977-17428999 GAGGCCAAGTGACTTGCCTGAGG - Intronic
902723563 1:18320773-18320795 GAGGCCAAGCAATTTGTCTGAGG - Intronic
902823041 1:18955284-18955306 AATGCTAAGTGATTTGCCTAAGG - Intronic
903857788 1:26346806-26346828 AAGGCCAAGCGATTTGCCTGAGG - Intronic
904775199 1:32901788-32901810 GAGGGGAGGCGATTTGCCTGAGG - Intergenic
904823866 1:33262158-33262180 AAGGCCAAGGGATTTGGCTCTGG + Intronic
905301874 1:36991114-36991136 GAGGTGAAGTGATTTGCCTGAGG - Intronic
905812416 1:40922476-40922498 CAGGCAAAGCAACTTGCCTGAGG + Intergenic
907976094 1:59432832-59432854 AAGGCTAAGTGACATGCCTGAGG + Intronic
908463151 1:64366030-64366052 AAGGCAAAGTGATTTGCCCAAGG + Intergenic
910527318 1:88195793-88195815 GAGGCCAAGCAACTTGCCTAAGG - Intergenic
913044516 1:115062389-115062411 AAGGTAAAGCGATTTGCTTAAGG + Intronic
916449372 1:164905335-164905357 GAGACTAAGTGATTTGCCTGAGG + Intergenic
916745688 1:167683309-167683331 AAGGCTAAGCCATTTGCCCCAGG + Intronic
917200320 1:172507924-172507946 AAGGCCAAGCTATTTGTCTAAGG - Intergenic
918905205 1:190483320-190483342 CAAGGCAAGCGAATTGCCTGAGG + Intergenic
922063902 1:222117580-222117602 AAGGGAAAGTAATTTGCCTGAGG + Intergenic
1063522115 10:6750604-6750626 AAAGCTAAGCTCTTTGCCTGAGG + Intergenic
1064912019 10:20412796-20412818 AAGGTCAAGGGATTTACCTTGGG + Intergenic
1065133805 10:22648902-22648924 AAAGCCATGCCATTTGCTTGAGG + Intronic
1070828877 10:79406708-79406730 GAGGTTAAGAGATTTGCCTGAGG + Intronic
1071491701 10:86140724-86140746 AAGGGATAGTGATTTGCCTGAGG - Intronic
1072228917 10:93396583-93396605 GAGGCCAAGAGATGTGCCTATGG + Intronic
1072449848 10:95531201-95531223 AAGGCTAAGCGACTTGCCGGAGG + Intronic
1075796792 10:125126199-125126221 GAGGCTAAGTGACTTGCCTGAGG - Intronic
1077532836 11:3105314-3105336 GAGGCGAAGCCATTTGCCTGAGG - Intronic
1078605396 11:12770649-12770671 AAGGTCAAGTTATTTGCTTGAGG + Intronic
1078838800 11:15058151-15058173 AAGTTTAAGCGATTTGCCTATGG + Intronic
1079323822 11:19474829-19474851 GAGGCAGAGTGATTTGCCTGAGG - Intronic
1080610226 11:33897790-33897812 TAGGCCAAAGGATCTGCCTGTGG + Intergenic
1083761595 11:64821704-64821726 AAGGCCAGGTAACTTGCCTGTGG + Intergenic
1084177043 11:67428396-67428418 CAGGCTAAGCGATTTTCCGGAGG + Intergenic
1084283856 11:68119009-68119031 AAGGAGAAGTGACTTGCCTGAGG - Intronic
1084595406 11:70113836-70113858 AAGGCTTAGTAATTTGCCTGAGG + Intronic
1085284277 11:75349974-75349996 GAGGCCATGTGATTTGCCTAAGG - Intronic
1085474318 11:76780364-76780386 AAGGGCAAGAGATCTGTCTGGGG - Intergenic
1086138355 11:83465807-83465829 AAGGTCAAGCAATTTGCCCAAGG + Intronic
1088250503 11:107857792-107857814 AAGGCTAAGCAATTTGCCCAAGG - Intronic
1088530334 11:110801288-110801310 AAGGCCATGCACTGTGCCTGTGG + Intergenic
1088975684 11:114814390-114814412 AAGGCTAAGTGATTTGCCTAAGG - Intergenic
1089157860 11:116415716-116415738 AAGGCCAAGTCATGTGCCTGAGG - Intergenic
1089344868 11:117784743-117784765 AGGGCTAAGCGGCTTGCCTGAGG - Intronic
1089929597 11:122297093-122297115 AAGGGCAAGAGAGTGGCCTGGGG - Intergenic
1091214715 11:133893687-133893709 AAGGCCAAGGGATTTCCCCAAGG + Intergenic
1091288382 11:134422254-134422276 AAGGCCCAGAGAGTTGCCTAAGG + Intergenic
1091853406 12:3719307-3719329 GAGGCCAAGTGACTTTCCTGAGG - Intronic
1092548667 12:9473679-9473701 GAGGCTAAGCCATTTGTCTGAGG - Intergenic
1093015679 12:14152255-14152277 AAGGCAAAGTGACTTGCCTAAGG + Intergenic
1094074484 12:26457783-26457805 GAAGCTAAGTGATTTGCCTGTGG - Intronic
1096974191 12:55689344-55689366 GAGGCCAAGCGACCTGCCTCAGG + Intronic
1098399253 12:70055699-70055721 AAGGCTAAACAACTTGCCTGAGG + Intergenic
1101477900 12:105067981-105068003 GAGGCTAAGCGACTTGCCTGTGG + Intronic
1102016575 12:109651789-109651811 GAGGCTAAGCAACTTGCCTGAGG - Intergenic
1102043947 12:109818040-109818062 GAGGCTAAGTGACTTGCCTGAGG + Intronic
1102044029 12:109818453-109818475 GAGGCTAAGCGACTTACCTGAGG + Intronic
1102572803 12:113837586-113837608 GAGGCAGAGCGACTTGCCTGAGG + Intronic
1102901184 12:116638581-116638603 AAGGCTAAGCAGTTTGCCTAAGG - Intergenic
1111976865 13:94975421-94975443 AAGGTCAAGCGATTTGCCTAAGG + Intergenic
1112041401 13:95552342-95552364 GAAGCCAAGCTATTTGCCTTGGG + Intronic
1113274322 13:108711550-108711572 AAGGCCAAGCTCTTTGACGGTGG - Intronic
1113438702 13:110311902-110311924 AAGGTCAGGCGAATTTCCTGGGG - Intronic
1117791526 14:59346981-59347003 ATGGCCAAGTGATTTGTCCGAGG - Intronic
1119864677 14:77963523-77963545 AAGGGCAAGTGATTTGCCCAAGG - Intergenic
1120163825 14:81172954-81172976 GAGGCCAAGTAATTTGCCTAAGG - Intergenic
1120303204 14:82734512-82734534 AAGATTAAGTGATTTGCCTGAGG - Intergenic
1121238181 14:92408591-92408613 AAAGCTAAGTGACTTGCCTGAGG - Intronic
1121383060 14:93491120-93491142 AAGGGCAAGGGATTTCTCTGGGG + Intronic
1121715442 14:96070674-96070696 AGGGTTAAGCGATTTGCCTAAGG - Intronic
1121867027 14:97372206-97372228 AAGGTCAAGCGATGTCCCTCAGG + Intergenic
1122158290 14:99764330-99764352 GAGGCTAAGCGATTTGCCCAAGG + Intronic
1125103890 15:35948513-35948535 AAGGCCAAGAGATTAGTTTGGGG + Intergenic
1126683352 15:51225501-51225523 AAGGCGAAGTGACTTGCCTAAGG + Intronic
1127272480 15:57413825-57413847 AAGGCCAAGCAGTTGCCCTGTGG - Intronic
1128353802 15:66910174-66910196 GAGGGCAAGCGACTTGCCTGAGG - Intergenic
1128428123 15:67564170-67564192 AAGGTTAAGTGATTTGCCTAGGG - Intronic
1129464701 15:75717331-75717353 AAGGCGAAGTGACTTGTCTGGGG - Intergenic
1129720542 15:77875682-77875704 AAGGCGAAGTGACTTGTCTGTGG + Intergenic
1130230405 15:82092615-82092637 AAGGCCAGTCCATCTGCCTGGGG - Intergenic
1130985063 15:88839345-88839367 GAGGGCAAGTGACTTGCCTGAGG + Intronic
1131836892 15:96399857-96399879 AAAGGTAAGCAATTTGCCTGAGG + Intergenic
1131907521 15:97159312-97159334 AAGGGCAGCGGATTTGCCTGTGG - Intergenic
1133361062 16:5174134-5174156 AAGGCCTAGCCTTTTGCCTGGGG - Intergenic
1133438036 16:5796712-5796734 GAGGACAAGTAATTTGCCTGTGG + Intergenic
1134089552 16:11384309-11384331 AAGGCCAGCGGATATGCCTGTGG + Exonic
1134655958 16:15948993-15949015 AAGGCGAAGTGACTTGCCCGAGG - Intergenic
1134675129 16:16085052-16085074 GAGGCCAAGTGACTTACCTGAGG + Intronic
1135610253 16:23860101-23860123 AAGGATAAGAAATTTGCCTGGGG - Intronic
1136006252 16:27331365-27331387 AAGGCTGAGTGATTTGTCTGAGG - Intronic
1136779515 16:32887471-32887493 AAGGCCATGGGGTTTGCCTGCGG - Intergenic
1136891101 16:33974047-33974069 AAGGCCATGGGGTTTGCCTGCGG + Intergenic
1137369816 16:47894901-47894923 GAGGCTAAGTGAATTGCCTGGGG - Intergenic
1138148968 16:54637678-54637700 AATTCCAAGCACTTTGCCTGAGG + Intergenic
1138475472 16:57268408-57268430 GAGGCTAAGCCACTTGCCTGAGG - Intronic
1139279833 16:65760860-65760882 AAGCTCAAGTGAGTTGCCTGAGG - Intergenic
1139302115 16:65954294-65954316 GAGGCTAAGACATTTGCCTGAGG + Intergenic
1141630283 16:85283951-85283973 AAGGCAAAGAGATGGGCCTGAGG - Intergenic
1141883098 16:86872810-86872832 GAGGGCAAGCCACTTGCCTGAGG - Intergenic
1142414070 16:89931934-89931956 AATGGGAAGCGACTTGCCTGAGG - Intronic
1203081931 16_KI270728v1_random:1149559-1149581 AAGGCCATGGGGTTTGCCTGCGG - Intergenic
1144535884 17:16091377-16091399 AAGGTTAAGTGACTTGCCTGTGG + Intronic
1146462335 17:33056107-33056129 AAGGCCAAGTGATTTGCCTCTGG + Intronic
1146558499 17:33848016-33848038 GAGGCAAAGAGATTTGCCTGGGG + Intronic
1149336107 17:55637823-55637845 AAGGAGAAGAGATTTGCCTGGGG + Intergenic
1149387403 17:56155680-56155702 AAGGCAAAGCAAGGTGCCTGGGG + Intronic
1150705676 17:67485060-67485082 AAGGTCAAGTGACTTCCCTGAGG + Intronic
1153694214 18:7624132-7624154 GAAGCAAAGTGATTTGCCTGAGG + Intronic
1154945535 18:21158135-21158157 AGGGCCAAGGGAATTTCCTGTGG + Intergenic
1156679726 18:39573813-39573835 AAGTCAAAGGCATTTGCCTGCGG + Intergenic
1158480150 18:57814753-57814775 AAGGCCAAGTGACCTGACTGAGG - Intergenic
1159432714 18:68375968-68375990 AATTCCATGTGATTTGCCTGTGG + Intergenic
1160890952 19:1378513-1378535 AAGGCCAGGCCATGTCCCTGGGG - Intergenic
1161469258 19:4448143-4448165 GAGGCCCAGCCCTTTGCCTGAGG + Intronic
1162086193 19:8250791-8250813 GAGGTCAAGTCATTTGCCTGAGG + Intronic
1162317194 19:9946715-9946737 AAGGTGAAGCAACTTGCCTGAGG + Intergenic
1162540903 19:11295363-11295385 GAGGCCAAGGGAACTGCCTGAGG - Intergenic
1162901650 19:13798709-13798731 GAGGCCAAGTGACTTGCCTGGGG + Intronic
1165920451 19:39294378-39294400 AAGGCAAAGTGACTTGCCTAAGG - Intergenic
1167152361 19:47717553-47717575 GAGGTCAAGTCATTTGCCTGAGG - Intronic
1167668701 19:50837616-50837638 GAGGCTAAGTGACTTGCCTGAGG - Intergenic
928073830 2:28244540-28244562 AAGGTTAAGTGATTTGCCTGAGG + Intronic
929942521 2:46345528-46345550 GAGGCCAAGTAATTTACCTGTGG - Intronic
929982952 2:46698748-46698770 AAGGGCAAGCGATGGGCTTGTGG - Intergenic
932374569 2:71224220-71224242 AGTGTTAAGCGATTTGCCTGAGG - Intronic
936350846 2:111711450-111711472 GAGGTTAAGGGATTTGCCTGAGG + Intergenic
937050359 2:118883253-118883275 AAGGCTAAGCGAAGTGCCCGAGG - Intergenic
939770994 2:146318135-146318157 AAAACCAAGGGATTTGCGTGAGG - Intergenic
943061137 2:183042690-183042712 AAGGACAATAGATTTCCCTGTGG + Intergenic
945178307 2:207065779-207065801 AAGGCTAAGCAATGTGCCTCAGG + Intergenic
946119597 2:217498230-217498252 AAGGCAAAGTTACTTGCCTGGGG - Intronic
946923105 2:224599511-224599533 AAGGTGAAGAGGTTTGCCTGAGG + Intergenic
947592849 2:231395340-231395362 AAGGCCCAGCCATTTCCCTCTGG - Intergenic
1171057233 20:21919213-21919235 AAGGACAAGTGATTTGCCCAAGG - Intergenic
1172186124 20:33032084-33032106 GAGGCCAAGTAACTTGCCTGAGG - Intronic
1172577268 20:36018849-36018871 AAGGGAAAGTGATTTGCCCGTGG - Intronic
1173836602 20:46130118-46130140 GAGGCGAAGTGACTTGCCTGTGG + Intergenic
1173967377 20:47122981-47123003 AAGGCAAAGTGACTTGTCTGAGG - Intronic
1174414910 20:50360163-50360185 GAGGCCAAGAGATTAGCCAGAGG - Intergenic
1174735485 20:52961878-52961900 GAGGCTAAACAATTTGCCTGAGG + Intergenic
1176369596 21:6054261-6054283 GAGGCTCAGCGACTTGCCTGAGG + Intergenic
1179178858 21:39028508-39028530 GAGGCCAAGCAACTTGCCTGAGG + Intergenic
1179753923 21:43484280-43484302 GAGGCTCAGCGACTTGCCTGAGG - Intergenic
1182058383 22:27379008-27379030 AAGCCCAAACGATTTGTCTGAGG - Intergenic
1182471896 22:30553941-30553963 CAGGGGAAGGGATTTGCCTGAGG - Intergenic
1183495888 22:38143593-38143615 AAGGTTAAGTGAATTGCCTGAGG - Intronic
1184607118 22:45580579-45580601 GAGGGCAAGAGATTTGCCCGAGG + Intronic
1184803780 22:46778655-46778677 AAGGACTAGGGACTTGCCTGAGG + Intronic
1185328087 22:50237384-50237406 AAGACCAAACGATTTGCCAAAGG + Intronic
949789381 3:7776327-7776349 AATGCTAAGTCATTTGCCTGAGG + Intergenic
953109441 3:39919359-39919381 AAGCCAAAGCCATTGGCCTGTGG - Intronic
954644124 3:52120570-52120592 AAGACCAGGTGTTTTGCCTGGGG + Intronic
954813088 3:53259955-53259977 AATGTCAAGTGATGTGCCTGAGG + Intergenic
955722656 3:61899867-61899889 AAGGTTAAGTGATTTTCCTGGGG - Intronic
956587370 3:70878896-70878918 AAGGGCAACTGATTTTCCTGGGG - Intergenic
957733872 3:84180734-84180756 CAGGCCAAGTGGGTTGCCTGTGG - Intergenic
958104327 3:89053393-89053415 ATGGCCAAGGGATATTCCTGTGG + Intergenic
961315469 3:126032544-126032566 AAGGTGAAGTGACTTGCCTGAGG + Intronic
962204413 3:133423295-133423317 GAGGTTAAGCGATTTGCCTTGGG - Intronic
963814462 3:149813697-149813719 AAAGTCAAGCGATGTGCCCGAGG - Intronic
965839862 3:172892307-172892329 AAGGCCAAGTAATTTCCCTGGGG - Intronic
967709311 3:192687284-192687306 ATGGCCATGTGACTTGCCTGGGG + Intronic
969598237 4:8160795-8160817 GAGGGCAAGCAAGTTGCCTGAGG - Intergenic
972895494 4:43614873-43614895 AAGGTTAAGTAATTTGCCTGAGG + Intergenic
974449580 4:62035800-62035822 AAAGTCAAGCGATGTGCCTTAGG - Intronic
975174214 4:71269014-71269036 CAGGCTAAACAATTTGCCTGGGG + Intronic
981101957 4:140838925-140838947 GAGGCTAAGTAATTTGCCTGAGG + Intergenic
981479026 4:145217435-145217457 GGGGTCAAGGGATTTGCCTGGGG + Intergenic
981689848 4:147495695-147495717 AAGGCTAGGCAATTTGTCTGTGG + Intronic
982066730 4:151660940-151660962 GAGGTAAAGCAATTTGCCTGAGG + Intronic
982371185 4:154635312-154635334 AAGGCCTAGAGATTGGCCTGAGG + Intronic
983217865 4:165018772-165018794 AAGCCCAATCTGTTTGCCTGGGG - Intergenic
984002969 4:174273067-174273089 AAGGCCAAGAGGATTGCTTGAGG + Intronic
985408389 4:189658665-189658687 AATGCCAAGCGATTTGGCTTTGG - Intergenic
985999375 5:3618261-3618283 AAGGCAAAGCATTTGGCCTGTGG + Intergenic
988483662 5:31650294-31650316 AAGGCTAAGTGACTTGACTGAGG + Intronic
991259094 5:64647708-64647730 AAGGCCAAGGGTATAGCCTGAGG + Intergenic
995362780 5:111317671-111317693 TAGGCCAAATGATTTGTCTGTGG + Intronic
995903309 5:117094222-117094244 AGAGCCAAGTGACTTGCCTGGGG - Intergenic
998006448 5:138660128-138660150 AAGGCTAGACAATTTGCCTGAGG - Intronic
998039972 5:138945649-138945671 GAGGCCAAGTGATCTGCCTGTGG - Intergenic
998930165 5:147172713-147172735 AAGCCAAAGAGATGTGCCTGGGG - Intergenic
999497771 5:152117163-152117185 AAAGTCAAGTGACTTGCCTGGGG - Intergenic
1006279367 6:33036443-33036465 AAAGGCAACCGAATTGCCTGAGG - Intergenic
1006810628 6:36818169-36818191 AAGCACAAGCCATTTGCCTGGGG - Intronic
1007745075 6:44038700-44038722 GAGGTCAACTGATTTGCCTGAGG - Intergenic
1007959186 6:45943149-45943171 GAGGTTAAGCAATTTGCCTGAGG + Intronic
1008675197 6:53811728-53811750 AAGGCTGAGCACTTTGCCTGGGG + Intronic
1010993808 6:82510198-82510220 AAGGCAAAGTGACTTTCCTGTGG - Intergenic
1014138634 6:117916578-117916600 AAGACCAGGCCATTTGGCTGGGG - Intronic
1015168749 6:130227939-130227961 AAAGCCAAGTGATTTGCCCAAGG + Intronic
1015353545 6:132250947-132250969 AAGGCCTAGAGTTTTGCCAGAGG + Intergenic
1015416815 6:132958408-132958430 AGAGCCAAGCTATTTGCCTGAGG - Intergenic
1015446581 6:133312439-133312461 AAGGTTAAGTGATTTGCCTAAGG - Intronic
1017789004 6:157779233-157779255 AAGACTAAGGGATTTGCCTAAGG - Intronic
1018866432 6:167750195-167750217 GAGGCCAAGTCATTTTCCTGAGG - Intergenic
1019875969 7:3811223-3811245 AAAGCCAAGTGATGAGCCTGTGG + Intronic
1021479134 7:21096365-21096387 AAGGCAGAGCTATTTTCCTGAGG + Intergenic
1021550767 7:21868858-21868880 AAAGCCAAGTCTTTTGCCTGTGG - Exonic
1021636377 7:22698128-22698150 CAGGCCAAACTATTGGCCTGAGG - Intergenic
1022334975 7:29413653-29413675 AAAGCCAGGCGATTTGCCCAGGG + Intronic
1025255579 7:57382035-57382057 GAGGCCAAGAGATTAGCCAGAGG + Intergenic
1029345478 7:99975670-99975692 AAGACCAAGCGACCTGCTTGGGG - Intronic
1029346306 7:99981102-99981124 AAGACCAAGCGACCTGCTTGGGG + Intergenic
1029558866 7:101289414-101289436 AAGACCAAGCGACCTGCTTGGGG - Intergenic
1029704557 7:102269342-102269364 AAGGACATGAGATTTGCGTGAGG - Intronic
1029733079 7:102450490-102450512 CAGGCCAAGAGCTCTGCCTGGGG - Exonic
1030659274 7:112203133-112203155 AAGGCTAAGTGATTTACCTAAGG + Intronic
1031331941 7:120476173-120476195 AAGGTTAAGTGACTTGCCTGTGG - Intronic
1036620191 8:10419874-10419896 ATGGCCAAGCCATATGCTTGGGG + Intronic
1037763697 8:21758622-21758644 AAGGCACAGAGATTTACCTGGGG - Intronic
1038266215 8:26041535-26041557 AAGGGCAAGGGATTTTCCTTTGG + Intronic
1038542382 8:28400851-28400873 AAGGCAAAGCGGTTTGTCAGAGG - Intronic
1041825489 8:62091482-62091504 TTGGCCATGAGATTTGCCTGTGG + Intergenic
1042840577 8:73119803-73119825 AAGGGCAAGCCATTTGCCAGGGG - Intronic
1043381172 8:79703757-79703779 GAGGCTAAGTGATTTGCCTAAGG - Intergenic
1043879626 8:85527570-85527592 ACGGCGAAGTGATCTGCCTGAGG - Intergenic
1044603597 8:94029986-94030008 AATGCCAAGTGATTTGCTTAAGG - Intergenic
1047743458 8:127826192-127826214 GAGGCCAAGCAATTTGCCCAAGG - Intergenic
1048053734 8:130844532-130844554 AAGATGAAGCGATTTGCTTGGGG + Intronic
1048130604 8:131693178-131693200 AAGGACATGAGATTTGCCAGGGG - Intergenic
1048558344 8:135505286-135505308 GAGGCCAAGTGATTTGCCAGAGG + Intronic
1050898124 9:10909804-10909826 AAGGAAAAGAGATTGGCCTGGGG + Intergenic
1052464008 9:28806583-28806605 AAGGGCAAGTGATTTGCTTTGGG - Intergenic
1054782897 9:69182210-69182232 AAGGCAAAGTGCTCTGCCTGAGG - Intronic
1056004795 9:82257444-82257466 GAGGTCAAGCAACTTGCCTGAGG + Intergenic
1056170488 9:83980299-83980321 AGGGCGAAGCGATTGGCCCGAGG + Intronic
1056904396 9:90632763-90632785 CAGGCTAAGCGACTTGCCTTAGG + Intronic
1058728333 9:107824942-107824964 AAGGCCCAGAGAGTTGGCTGGGG - Intergenic
1059654638 9:116346455-116346477 AAGGAAAAGGGACTTGCCTGTGG + Intronic
1059678001 9:116558537-116558559 AATGCCAAGTCATTGGCCTGTGG - Intronic
1059772272 9:117438467-117438489 AAGGCTAAGGGATTTGCACGAGG + Intergenic
1061052550 9:128204875-128204897 GAGGGCAAGTGACTTGCCTGAGG - Intronic
1061161197 9:128895388-128895410 TAGGCTAAACAATTTGCCTGGGG + Intronic
1061475297 9:130861505-130861527 AAGGCCAAGGCCTTTGGCTGTGG - Intronic
1061542795 9:131287352-131287374 ATGGCGAAAGGATTTGCCTGGGG + Intergenic
1061872390 9:133527906-133527928 CAGGGGAAGCGATTGGCCTGGGG + Intronic
1187545643 X:20249377-20249399 ATGGCCAAACTATTTTCCTGAGG + Intronic
1189397123 X:40633007-40633029 AAGGCCAAGAGTTTTGGCTTAGG - Intronic
1190057840 X:47192143-47192165 AAGGCTAAGTAATTTGCCTAAGG + Intronic
1191608084 X:63083188-63083210 TAGGCAAAGGGATCTGCCTGGGG - Intergenic
1195960875 X:110385147-110385169 AACGTTAAGTGATTTGCCTGAGG - Intronic
1198322511 X:135532611-135532633 AAGGTTAAGTGACTTGCCTGGGG - Intronic
1198590316 X:138173110-138173132 GAGGTCAAGCAAGTTGCCTGAGG - Intergenic
1198795685 X:140391525-140391547 AAGGCCATGTGCTTTGGCTGGGG - Intergenic
1200100242 X:153686527-153686549 AAGGCAATGGGGTTTGCCTGTGG + Intronic