ID: 903860108

View in Genome Browser
Species Human (GRCh38)
Location 1:26360022-26360044
Sequence CGAGCGGTGCGGAGGCCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 138}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903860108_903860119 1 Left 903860108 1:26360022-26360044 CCCCCGGGCCTCCGCACCGCTCG 0: 1
1: 0
2: 0
3: 7
4: 138
Right 903860119 1:26360046-26360068 CCATGGCGAGTGAAAGACCCGGG 0: 1
1: 0
2: 0
3: 2
4: 85
903860108_903860120 2 Left 903860108 1:26360022-26360044 CCCCCGGGCCTCCGCACCGCTCG 0: 1
1: 0
2: 0
3: 7
4: 138
Right 903860120 1:26360047-26360069 CATGGCGAGTGAAAGACCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 114
903860108_903860122 15 Left 903860108 1:26360022-26360044 CCCCCGGGCCTCCGCACCGCTCG 0: 1
1: 0
2: 0
3: 7
4: 138
Right 903860122 1:26360060-26360082 AGACCCGGGGCTCCGGCCGTCGG 0: 1
1: 0
2: 0
3: 7
4: 85
903860108_903860117 0 Left 903860108 1:26360022-26360044 CCCCCGGGCCTCCGCACCGCTCG 0: 1
1: 0
2: 0
3: 7
4: 138
Right 903860117 1:26360045-26360067 GCCATGGCGAGTGAAAGACCCGG 0: 1
1: 0
2: 1
3: 5
4: 109
903860108_903860121 8 Left 903860108 1:26360022-26360044 CCCCCGGGCCTCCGCACCGCTCG 0: 1
1: 0
2: 0
3: 7
4: 138
Right 903860121 1:26360053-26360075 GAGTGAAAGACCCGGGGCTCCGG 0: 1
1: 0
2: 1
3: 14
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903860108 Original CRISPR CGAGCGGTGCGGAGGCCCGG GGG (reversed) Intergenic
901005774 1:6170916-6170938 CGGGGGAGGCGGAGGCCCGGTGG - Intronic
903860108 1:26360022-26360044 CGAGCGGTGCGGAGGCCCGGGGG - Intergenic
905369336 1:37474781-37474803 GGAGGGGTCCTGAGGCCCGGCGG - Intronic
910449028 1:87328640-87328662 CGGACGGTGCGGAGGCCGGCAGG - Exonic
912576372 1:110675349-110675371 CTAGGGGTGTGGAGGCCAGGGGG - Intergenic
917839128 1:178963331-178963353 CGAGCGGTGGGGAGGGAGGGAGG + Intergenic
920920259 1:210292542-210292564 GGAGCCGCGCGGGGGCCCGGGGG + Intergenic
922440531 1:225652655-225652677 CGCGCGGGGCGGGGGCCGGGCGG - Intronic
922478668 1:225923991-225924013 CGGGCGGTCCCGAGGCCCGAGGG - Intronic
1063429657 10:5977530-5977552 CGAGCGCTGCCCAGGCCGGGGGG + Exonic
1064462196 10:15546028-15546050 CGAGCTGTGCAAAGGCCCTGAGG - Intronic
1065100452 10:22325822-22325844 TGAGCGCGGCGGACGCCCGGGGG - Intronic
1067414607 10:46094047-46094069 TGAGAGCTGCGGAGGCCCTGGGG - Intergenic
1067439064 10:46298064-46298086 TGAGAGCTGCGGAGGCCCTGGGG + Intronic
1069849684 10:71396874-71396896 CGAGCGGGGCGGGGGCCGAGCGG + Intergenic
1074182901 10:111078806-111078828 CGAGCGCAGCGCGGGCCCGGGGG + Exonic
1075800738 10:125152005-125152027 CGCGAGGTGGGGGGGCCCGGGGG + Intronic
1077494556 11:2880609-2880631 CCAGCAGTGGGGAGCCCCGGAGG - Intergenic
1077529766 11:3089754-3089776 CGGGAGGTGGGGAGGCCAGGAGG - Intronic
1078316021 11:10293970-10293992 CGGGGGGCGGGGAGGCCCGGGGG + Intronic
1078334068 11:10450535-10450557 GGAGCGGTGTGGAAGCCCGGCGG + Intronic
1079064379 11:17276739-17276761 AGAGCGGAGCGGTGGGCCGGGGG + Intronic
1081730963 11:45371541-45371563 CAAGAGGTGGGGAGGCCCAGTGG - Intergenic
1083758421 11:64803250-64803272 GGGGCGGGGCTGAGGCCCGGGGG + Intergenic
1083997072 11:66278006-66278028 CGAGGGGTGCGGGGTGCCGGGGG + Intergenic
1083997224 11:66278428-66278450 CGCGCCGGGCGGCGGCCCGGGGG - Exonic
1084171270 11:67401964-67401986 CGTGAGGCGCGGCGGCCCGGGGG + Intronic
1084506087 11:69569445-69569467 CCAGCGGTGGGGAAGCCAGGAGG + Intergenic
1084970056 11:72766530-72766552 CGAGTGGTGCAAAGGCCTGGAGG + Intronic
1085029850 11:73264460-73264482 CCAGCGGTGCGGAGGCCGCTTGG + Intergenic
1090199921 11:124846501-124846523 CCAGGGCTGTGGAGGCCCGGGGG + Intergenic
1092204479 12:6606939-6606961 CGGGCGCTGCGGGGGGCCGGAGG + Intronic
1097114621 12:56688271-56688293 CGAGGGGTGGTGAGGCCGGGCGG + Exonic
1097267661 12:57755328-57755350 CGAGCGGGCTGGCGGCCCGGGGG - Exonic
1102201833 12:111062833-111062855 CGAGATGTGCGAAGGCCCTGGGG + Intronic
1102247140 12:111362779-111362801 CGTGGGGTGCCGAGGCCCGGCGG + Exonic
1102453490 12:113057477-113057499 CGAGGGGGGCGGGGGCCCGTGGG - Intronic
1104929248 12:132329467-132329489 GGAGCGGTGAGGGGGGCCGGGGG + Intergenic
1113311876 13:109140441-109140463 CGCGCACTGCGGAGTCCCGGGGG - Exonic
1113768380 13:112894435-112894457 CGCGCGGGGCGGGGGCCTGGAGG + Intronic
1115028465 14:28767663-28767685 CGAGCCGGGCGGCGGGCCGGGGG + Exonic
1118885243 14:69860396-69860418 CCAGCGGTGCACAGGCCTGGCGG - Intronic
1119492813 14:75051254-75051276 CGAGGGCCCCGGAGGCCCGGCGG - Intronic
1121050324 14:90815974-90815996 CACGCGGTGTGGGGGCCCGGGGG - Intronic
1121437132 14:93927453-93927475 CGGTCAGTGTGGAGGCCCGGTGG + Intronic
1122779141 14:104136321-104136343 CGCGGGGCGCGGAGGACCGGGGG + Intergenic
1131076232 15:89496574-89496596 CGGGCGGTTCGGACGCTCGGAGG + Exonic
1131828845 15:96341691-96341713 CGAGCGGAGCTGGGGCGCGGTGG + Intergenic
1132498040 16:273107-273129 GGGGCTGTGGGGAGGCCCGGTGG - Intronic
1132499894 16:280612-280634 CGAGCGGGGCGGCGGCGGGGCGG + Exonic
1132994803 16:2817371-2817393 GGAGCGGTGGGGAGGACGGGAGG + Intronic
1136556644 16:31010893-31010915 CGGGGGGTGGGGTGGCCCGGCGG + Intergenic
1139871921 16:70114666-70114688 GGAGCGGTGCGCACGCCCAGGGG - Intronic
1140364005 16:74367817-74367839 GGAGCGGTGCGCAGGCCCAGGGG + Intergenic
1142206376 16:88785016-88785038 GGGGCGGTGCGGGGGCCCCGGGG + Exonic
1142310919 16:89313058-89313080 CGAGCTGTGTGGAGGCCGAGAGG - Intronic
1142347069 16:89560866-89560888 GGTTCGGGGCGGAGGCCCGGGGG + Intronic
1147123859 17:38352382-38352404 CGAGCGGACCTGGGGCCCGGCGG + Exonic
1147200775 17:38799770-38799792 CGAGGCGTTCGGAGGCCAGGCGG - Exonic
1147469746 17:40648152-40648174 CGAGCCTTGCGGAGGGGCGGTGG + Exonic
1151802129 17:76384817-76384839 CGAGCGGCGCGAAGGCAGGGTGG - Exonic
1152520928 17:80856384-80856406 GGAGCGGTGCGGTGGGGCGGTGG + Intronic
1152782395 17:82232065-82232087 CGAGGGGTGCCGAGGGCGGGAGG - Intronic
1152923853 17:83079030-83079052 TGACCGGGGGGGAGGCCCGGCGG - Intergenic
1153939739 18:9967852-9967874 CGGGCGCTGCGGAGACCCAGAGG - Intergenic
1154304032 18:13217905-13217927 GGAGCGCGGGGGAGGCCCGGGGG + Intronic
1157799701 18:50609320-50609342 CGGGCGGGGCGGCGGCCGGGCGG + Intronic
1158729934 18:60011268-60011290 CGAGAGGTTCGGAGGATCGGGGG - Intergenic
1160793785 19:934609-934631 CGGGCAGTGCAGAGGCCCTGAGG + Intronic
1161264843 19:3359473-3359495 CGGGCGGTGCGCGGGACCGGGGG + Intergenic
1161628606 19:5340286-5340308 CGGGCGGGGCAGAGGCGCGGAGG - Intronic
1163315107 19:16536086-16536108 CCAGATGTGCAGAGGCCCGGTGG - Intronic
1163681179 19:18683580-18683602 CGAGCAGTGCGCAGGCGCGCCGG - Intergenic
1163708527 19:18831994-18832016 CGAGGGGAGCTGAGGCGCGGAGG + Exonic
1165213729 19:34254723-34254745 CGAGCGGAGCGGCGCCCCGCGGG - Intronic
1165899135 19:39160580-39160602 AGATAGGTGCAGAGGCCCGGAGG + Intronic
934500769 2:94858400-94858422 TGAGTGGCGCGGAGGGCCGGGGG + Intergenic
934688046 2:96335855-96335877 CGGGCGGTCGGGAGGCGCGGCGG + Intronic
946338749 2:219055446-219055468 TGAGCGGGGCGTAGGCCCCGAGG + Exonic
947609432 2:231514474-231514496 CGGGCGGTGCGGGAGCCTGGGGG + Intergenic
1169673799 20:8132491-8132513 AGGGAGGTGCGGAGGCCGGGAGG + Intronic
1172061616 20:32190428-32190450 CGAGCGGCTTGGAAGCCCGGAGG + Intergenic
1172336644 20:34122401-34122423 CGTGGGGTGCGGAGGTCGGGTGG + Intergenic
1175424716 20:58855996-58856018 CAAGCGGTGCGGAGGACACGCGG + Intronic
1176016627 20:62937414-62937436 CTTGCGGGGCGGAGTCCCGGCGG - Intronic
1176380559 21:6110610-6110632 CGGGACGTGCGGGGGCCCGGGGG - Intergenic
1178989331 21:37339385-37339407 GGAGTAGTGCGGAGGCGCGGTGG + Intergenic
1179742913 21:43427630-43427652 CGGGACGTGCGGGGGCCCGGGGG + Intergenic
1180005567 21:45018993-45019015 GGGGCGGGGCGGGGGCCCGGAGG + Intergenic
1181312491 22:21952775-21952797 CCAGGGGTGAGGAGGCCGGGGGG - Exonic
1183270764 22:36861225-36861247 GGAGCAGTGAGAAGGCCCGGGGG - Intronic
950447192 3:13045133-13045155 ACAGCGGTGCAGAGGCCCTGGGG - Intronic
951809372 3:26682691-26682713 GGAGCTGTGCAGAGGCCCAGTGG - Intronic
954156083 3:48685598-48685620 CCAGGGGCGCGGAGGCCGGGCGG + Intronic
954632872 3:52056501-52056523 CGGGCGGGACGGAGGCCGGGAGG - Exonic
961377360 3:126475772-126475794 CGAGCGGCGCTGGGGCTCGGCGG + Exonic
961779944 3:129315506-129315528 GGAGCGGCGCGGAGCCCCGGCGG - Exonic
963091412 3:141486961-141486983 CGAGTCGGGCCGAGGCCCGGGGG + Intergenic
968319157 3:197750198-197750220 GGACCCGAGCGGAGGCCCGGAGG + Intronic
968439282 4:613393-613415 CGAGTGGTGGGGATGCCTGGAGG - Intergenic
968505230 4:968278-968300 CGAGTGGTGCGGGGTCCAGGTGG - Exonic
978385668 4:108173235-108173257 CGAGGGACGCGGAGGGCCGGTGG - Intergenic
978503651 4:109434133-109434155 GGCGCGGTGCGGAGGCCGCGGGG + Intronic
985792757 5:1939300-1939322 AGAGTGATGCGGAGACCCGGGGG - Intergenic
989103341 5:37839738-37839760 CTGGGGGTGCGGGGGCCCGGCGG - Intergenic
991967765 5:72108652-72108674 CGGGCGGTCCGGAGGCACTGCGG - Intronic
996234422 5:121108607-121108629 AGAGCTGAGCAGAGGCCCGGCGG - Intergenic
997654087 5:135542731-135542753 CCAGGGATGCGGAGGGCCGGGGG - Intergenic
1002401533 5:178994059-178994081 CGAGCGCTCCGCAGGCCCAGGGG + Intronic
1003552277 6:7109294-7109316 CGAGCGGGGAGGGGGCGCGGGGG - Intronic
1005303791 6:24495097-24495119 CGGGCCGGGCGCAGGCCCGGAGG - Exonic
1007383279 6:41504114-41504136 AGGGCAGTGCGGCGGCCCGGCGG - Intergenic
1007558139 6:42783258-42783280 CCAGCCGCGCGGAGGACCGGCGG + Intronic
1016932795 6:149426686-149426708 CGAGCTGTTCGGAGGTCCAGCGG - Intergenic
1017842271 6:158231993-158232015 CGGGCGGCGCGGCGGCCCGCGGG + Intergenic
1019630230 7:2045153-2045175 AGAGGGGTGTGGAGGCCGGGTGG - Intronic
1019664064 7:2242460-2242482 AGAGCGGGGCGGAGGCTTGGGGG + Intronic
1021649694 7:22821491-22821513 CGCGCGGGGCGGAGGCCGGCTGG + Intronic
1025639582 7:63354006-63354028 TGAGCGGTGCGGATCCCTGGAGG - Intergenic
1025643117 7:63394086-63394108 TGAGCGGTGCGGATCCCTGGAGG + Intergenic
1027592731 7:80135410-80135432 CCGGCGGTGCGGAGGCAAGGCGG + Intronic
1034781492 7:153886538-153886560 CGGCTGGGGCGGAGGCCCGGAGG + Intergenic
1035817907 8:2561355-2561377 CGGGGGGTGCAGAGGCTCGGGGG - Intergenic
1040516850 8:48142820-48142842 CAAGCAGTGCGAAGGCCCTGTGG + Intergenic
1042306983 8:67343140-67343162 TGAGCGGGGAGGAGGCCCGGGGG - Intronic
1044841772 8:96343223-96343245 TGGGCTGTGCGGAGGCCCAGTGG - Intergenic
1049197870 8:141325407-141325429 CGGGGGATGCGGAGGCCCTGGGG + Intergenic
1049367574 8:142248054-142248076 CGAGAGGTGATGAGGCCTGGCGG + Intronic
1049419392 8:142510342-142510364 CCAGGGGTGATGAGGCCCGGGGG + Intronic
1049643437 8:143725711-143725733 CCAGCGTTGGGGAGGCCAGGGGG + Exonic
1049789737 8:144467077-144467099 AGAGAGCTGCGGGGGCCCGGCGG + Exonic
1059061226 9:111037669-111037691 CGAGAGGTGCGGAGCCCCAGGGG + Intronic
1059102371 9:111483436-111483458 CGCGCGGTGCCGGGGGCCGGCGG - Intronic
1059471125 9:114505403-114505425 CGGGCGGCGCAGAGGCGCGGAGG - Intronic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1060770242 9:126327024-126327046 CGGGCGCCGCGGAGGCTCGGCGG + Intronic
1061873965 9:133534855-133534877 CGAGCGCTGCGGAGGGCAGACGG - Intronic
1061999305 9:134207808-134207830 GGACCGGTACGGAGGACCGGTGG - Intergenic
1062408696 9:136410526-136410548 CGAGAGGCTCGGAGGCGCGGGGG - Exonic
1062439147 9:136561845-136561867 CCAGTGGTGGGGAGGCCCCGTGG + Intergenic
1187403652 X:18984131-18984153 CGCGCGGCGGGGAGGCGCGGGGG + Exonic
1189044023 X:37572007-37572029 GGGGCGGCGCGGAGGCCCGAGGG + Exonic
1190008006 X:46758664-46758686 CGAGGGGTGTGGAGGGCGGGGGG + Intronic
1198424082 X:136497407-136497429 GCGGCGGTGCCGAGGCCCGGCGG + Exonic
1199772655 X:150984174-150984196 CGGGCGGCTCGGAGGGCCGGGGG + Intronic
1200227844 X:154428924-154428946 CGAGGGGTGGTGAGGCCCGGAGG + Intronic