ID: 903862975

View in Genome Browser
Species Human (GRCh38)
Location 1:26376292-26376314
Sequence TCCCCTGTTGGTGGACATAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 626
Summary {0: 1, 1: 1, 2: 6, 3: 73, 4: 545}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903862970_903862975 8 Left 903862970 1:26376261-26376283 CCATTGCAGGGTTGTGCTTAATA 0: 1
1: 0
2: 0
3: 8
4: 103
Right 903862975 1:26376292-26376314 TCCCCTGTTGGTGGACATACGGG 0: 1
1: 1
2: 6
3: 73
4: 545
903862967_903862975 25 Left 903862967 1:26376244-26376266 CCTGACTATATAATGTTCCATTG 0: 1
1: 0
2: 1
3: 13
4: 131
Right 903862975 1:26376292-26376314 TCCCCTGTTGGTGGACATACGGG 0: 1
1: 1
2: 6
3: 73
4: 545

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903862975 Original CRISPR TCCCCTGTTGGTGGACATAC GGG Intergenic
900546853 1:3234239-3234261 CCCTCTGTTGGTGACCATACTGG - Intronic
900843874 1:5080473-5080495 TCCCCTTTTGTTGGATATATAGG - Intergenic
902989389 1:20175728-20175750 CCCCCTGTCGGTGGACATGTGGG - Intronic
903390019 1:22957255-22957277 TCCCCTATTGATGGACATTTAGG + Intronic
903591860 1:24462399-24462421 TCTCCTGTTGGTAGACATTTGGG - Intronic
903796653 1:25934050-25934072 TGCCCTGTTGGAAGACAAACAGG + Intergenic
903855019 1:26331975-26331997 TCCCCTATTGATGGACATCTGGG - Intronic
903862975 1:26376292-26376314 TCCCCTGTTGGTGGACATACGGG + Intergenic
903863832 1:26383179-26383201 TCATCTGTTGATGGACATATGGG - Intergenic
903978715 1:27169645-27169667 TCCCCTGTTAATGGCCATTCAGG + Intergenic
904334672 1:29789218-29789240 TCCCCTGCTGGTGGGAATATAGG + Intergenic
904932471 1:34100550-34100572 TCCCCTGTTGATGGCCATTCAGG + Intronic
906020299 1:42622331-42622353 TCATCTGTTGGTGGACATTTAGG + Intronic
906467971 1:46101536-46101558 TCATCTGTTGGTGGACATTTGGG - Intronic
907216107 1:52865563-52865585 TCGCCTGTTGTTGGACATTTGGG - Intronic
907799026 1:57746078-57746100 TCCCCAATTGATGAACATACAGG + Intronic
908528319 1:65009098-65009120 TCTTCTGTCGGTGGACATTCCGG - Intergenic
910362816 1:86431400-86431422 TCTCCTCTTGGTGGACACACAGG + Intronic
910555265 1:88524670-88524692 TCCCCTTTTTATGGACATTCAGG - Intergenic
910777197 1:90888957-90888979 TCCCCTGTAGCTGGAATTACAGG + Intergenic
911476132 1:98375115-98375137 TCACCTGTTTGTGGTGATACTGG - Intergenic
911771425 1:101747493-101747515 TCCACTGTTGATGGACATCTAGG - Intergenic
912039631 1:105372083-105372105 TCCCCTGTTGGTGGACAGCTGGG - Intergenic
912599458 1:110913889-110913911 TCCACTGTTGATGGGCATCCAGG - Intergenic
913041177 1:115025598-115025620 TCACCTGTGGATGGACATTCAGG + Intergenic
913176795 1:116280517-116280539 TCCCCTGTTGCTGGACATTCAGG - Intergenic
913288272 1:117247911-117247933 TCCCCTATTGGTGGACATTTAGG - Intergenic
913309565 1:117475068-117475090 TCTCCTGTTGATGGACATTTAGG + Intronic
914046865 1:144100884-144100906 TCCCCAGTAGCTGGAAATACAGG + Intergenic
914131244 1:144859802-144859824 TCCCCAGTAGCTGGAAATACAGG - Intergenic
915509924 1:156381327-156381349 TCCCTAGATGGTGGACAGACAGG - Exonic
915573543 1:156759882-156759904 TCCCCTGTTGATGGGCATTTAGG + Intronic
917498014 1:175559719-175559741 TCTCCTGTTGATGGACCTTCAGG + Intronic
917512609 1:175680783-175680805 TGCCCTGTTTGTAGACACACTGG - Intronic
917558975 1:176124663-176124685 TCATCTGTTGATGGACACACAGG + Intronic
918482831 1:184998112-184998134 TCCACTGTTGATGGACATTTAGG - Intergenic
919520087 1:198577374-198577396 TAACCTGTTGATGGACATATTGG + Intergenic
920217757 1:204373625-204373647 TCACCTGTTGCTGAACTTACGGG + Intronic
920483869 1:206350028-206350050 TCACCTGTTGATGGACATTTGGG - Intronic
920531971 1:206708984-206709006 TCCCCTGTTGATGGACATTTGGG + Intronic
921698530 1:218240429-218240451 TCACCTGTTGATGGACATTTGGG - Intergenic
922281608 1:224130216-224130238 TCCCCAGTAGCTGGAAATACAGG - Intronic
922498666 1:226080803-226080825 TCCCCAGTAGGTGGAACTACAGG - Intergenic
923375354 1:233356686-233356708 TCCCCTGTTAATGGATATTCAGG - Intronic
923420366 1:233808980-233809002 CCCCATGTTGGTGTACACACAGG + Intergenic
923612594 1:235508225-235508247 TCCCGTATTATTGGACATACAGG + Intergenic
924073367 1:240306642-240306664 TCCACTGTTGATGGACATCTAGG + Intronic
924083991 1:240429800-240429822 TCCCCTGTTCATGGACATTTGGG + Intronic
924210408 1:241760261-241760283 TCCCCTGTAGGTGGCCATTTGGG + Intronic
924622093 1:245671238-245671260 TCACCTGTTGATGGACATTTAGG + Intronic
1063682512 10:8202720-8202742 TCATCTGTTGATGGACCTACAGG + Intergenic
1064191809 10:13212992-13213014 TCACCTGTTGGTGGGCATTTGGG + Intergenic
1064373792 10:14777507-14777529 TCTATTGTTGGTGGACATATGGG - Intergenic
1064374524 10:14783586-14783608 TCCCATGTAGGTGGAATTACAGG + Intergenic
1064743518 10:18456887-18456909 TCATCTATTGGTGGACATTCGGG + Intronic
1064906567 10:20352959-20352981 TCTCCTGTGGGTGGACATTTAGG - Intergenic
1065005685 10:21377982-21378004 TCCCCTTTTGTTGGACATCTAGG - Intergenic
1065170382 10:23021207-23021229 TCCACTGTTGATGGACATCTAGG + Intronic
1065257004 10:23880195-23880217 TCCCCTGTTGATGGACACATAGG - Intronic
1065416587 10:25494917-25494939 TCCTCTGTTGGTGAACATTTGGG - Intronic
1065556994 10:26926181-26926203 TCCCCTATTGCTGGACATCTTGG - Intergenic
1066252618 10:33649298-33649320 TCCCCAGTAGGTGGAACTACAGG + Intergenic
1066462722 10:35625689-35625711 TCCCCTGTTGATGGGCATCTGGG + Intergenic
1067142150 10:43667110-43667132 TCCCCTGCTGTTGGACATTTAGG + Intergenic
1067740235 10:48889998-48890020 TCCCCTGTTGCTGGAAATGCTGG - Intronic
1068105679 10:52612934-52612956 TCTCCTGTTCTTGGGCATACAGG - Intergenic
1068958741 10:62845202-62845224 TCCCCTCTTGGTTAACAAACTGG + Intronic
1069015401 10:63423550-63423572 TCCTCTGTTGCTGGACATTTGGG + Intronic
1069525096 10:69163158-69163180 TCTGCTGTTTGTGGACATACTGG + Intronic
1069636506 10:69928575-69928597 TCCCCTGTTGATGGGCATTTGGG + Intronic
1069689608 10:70341397-70341419 TCCCCAGTTGGTGGACATTTGGG - Intronic
1069704591 10:70450287-70450309 TCCCCAGTAGCTGGACTTACAGG - Intergenic
1069883021 10:71605761-71605783 TCCCCTATTGTTGGACATCTAGG + Intronic
1069905914 10:71731968-71731990 TCCCCTGTAGGAGGACACAGAGG - Intronic
1070246399 10:74736186-74736208 TCCCCTGTTGGTGGACATTTGGG - Intergenic
1071382209 10:85078042-85078064 TCCACTGTTGCTGGACATTTAGG - Intergenic
1071462186 10:85909493-85909515 TCCGCTGTTGATGGACATTTGGG - Intronic
1071934461 10:90512382-90512404 TCTCCTGTTGATGGACATCTGGG - Intergenic
1072111700 10:92327407-92327429 TCCTCCATTGATGGACATACAGG + Intronic
1072335978 10:94398989-94399011 TCCCCTGATGATGGACATTTGGG + Intergenic
1072484147 10:95838404-95838426 TCAACTGTTGATGGACATTCGGG - Intronic
1072500248 10:96008318-96008340 TCACCTGTTGATGGACATTTAGG + Intronic
1072611904 10:97022996-97023018 GTCCCTGTTGCTGGACATTCTGG + Intronic
1073174776 10:101548323-101548345 TCTCTTGTTGGTGGACATAGGGG - Intronic
1074155650 10:110796850-110796872 TTCCCTATTGTTGGACATTCAGG + Intronic
1075720092 10:124579499-124579521 TCCCCTGATGATGGACATGTAGG + Intronic
1075802997 10:125164267-125164289 TCCCCAGTAGCTGGAAATACAGG - Intergenic
1075807156 10:125197709-125197731 TCCCTTATTGATGAACATACGGG - Intergenic
1075931942 10:126305211-126305233 TCCCCTGTTGATGGATATTTGGG - Intronic
1075959303 10:126554124-126554146 TCCACCGTTGGTGGACATTTGGG - Intronic
1076938895 10:133587124-133587146 TCACCTGTTGGTGGACATTTGGG + Intergenic
1077934891 11:6773082-6773104 TCCACTGTTGATGGGCATAAAGG - Intergenic
1078418514 11:11186714-11186736 TCTACTGTTTTTGGACATACGGG - Intergenic
1079829763 11:25248480-25248502 TCCAGTGTTGATGGACATCCAGG + Intergenic
1079989189 11:27229342-27229364 TCCCCTGAAGGTGGTCATACTGG - Intergenic
1080468906 11:32526055-32526077 TCACCCATTGGTGGACATTCGGG - Intergenic
1080583107 11:33659484-33659506 TTCCCTATTGATGGACATAATGG + Intronic
1081735903 11:45404045-45404067 TCCCCTATTGCTGGATATATAGG + Intergenic
1081753127 11:45526281-45526303 TCCCCTGTTGTTGGACATTTAGG + Intergenic
1083973263 11:66096438-66096460 TCTCCTGTTGATGGACATATAGG + Intronic
1085021200 11:73210057-73210079 TCCTCTGTTGGTGGACATTTGGG - Intergenic
1085060773 11:73444691-73444713 TGCCCTGTTGGTAGACATTTAGG - Intronic
1085589756 11:77748910-77748932 TCACCTGTTAGTGGACATTTGGG - Intronic
1085781814 11:79416134-79416156 TCACCTGTTGATGGACATTTGGG + Intronic
1086268472 11:85029827-85029849 TCCCATGTAGGTGGGCTTACAGG + Intronic
1086313262 11:85560326-85560348 TCCCTGGTTGGTGGACATCTGGG - Intronic
1086923213 11:92611529-92611551 TCCCAAGTTGGTGGAACTACGGG + Intronic
1086974440 11:93116218-93116240 TCGTCTGTTGGTAGACATATGGG + Intergenic
1086985058 11:93238545-93238567 TCTCCTGTTGATGGACATTTAGG + Intergenic
1087094735 11:94307718-94307740 CCCACAGTTGGTGGACATGCAGG - Intronic
1087200532 11:95340352-95340374 TCATCTGTTGGTGGACATTTGGG + Intergenic
1088358069 11:108963854-108963876 TCCACTGTTGATGGACATGTAGG - Intergenic
1088358383 11:108966682-108966704 TCCCCTGTTTGAGGGGATACAGG - Intergenic
1088444561 11:109911488-109911510 TCCTCTGTTGATGGACATTTAGG - Intergenic
1089073246 11:115717209-115717231 TCCCCTGCTGGGGCACGTACAGG + Intergenic
1089763413 11:120745497-120745519 TCCCCTTTAGGTGGACATATGGG + Intronic
1089923849 11:122236693-122236715 TCCACTGTTGCTGGACATCTAGG + Intergenic
1090763169 11:129854767-129854789 TCCCTTGGGGGTGGACAGACTGG + Exonic
1092177210 12:6418299-6418321 TCACCTGTTGATGGACATTTGGG - Intergenic
1093190336 12:16067106-16067128 TCACCTGTTGATGGACATGTGGG + Intergenic
1095988860 12:48019840-48019862 TCCCCTTCTGATGGACATTCGGG + Exonic
1097010151 12:55947626-55947648 TTCCCTATTGGTGGACATTAGGG + Intronic
1097238824 12:57559118-57559140 GCCTCTGTTGGTGGACATTAAGG + Intronic
1097425082 12:59434414-59434436 TCCTCAGTTGGTGGACATTTGGG - Intergenic
1098367568 12:69720747-69720769 TTCCCTATTGATGGACATTCAGG + Intergenic
1098399723 12:70061669-70061691 TCCTCTGTTGATGGACATCTAGG - Intergenic
1099988568 12:89698244-89698266 TCGCCTGTTGATGGACATTTTGG - Intronic
1100327799 12:93555831-93555853 TTCCCTGTTGATGGACATTTGGG + Intergenic
1100332056 12:93592382-93592404 TCTCCTGCTAGTGGATATACAGG + Intergenic
1101522907 12:105501633-105501655 TCACCCATTGATGGACATACAGG - Intergenic
1101877424 12:108605092-108605114 TCTCCTGTTGATGGACATTTGGG - Intergenic
1101926842 12:108978865-108978887 ACTCCTGTTGATGGACATTCTGG - Intronic
1102240065 12:111319884-111319906 TCCCCAGTTGCTGGACACAGAGG + Intronic
1102366344 12:112339177-112339199 TCTCCTGTTGGTGGATATTTGGG - Intronic
1103730515 12:123024518-123024540 TCATCTGTTGGTGGACATTTGGG - Intronic
1104061012 12:125268408-125268430 GCCCCTCTTGATGGACATTCAGG - Intronic
1104325963 12:127798797-127798819 TCACTTGTTGGTGGACACTCGGG + Intergenic
1104884352 12:132096798-132096820 TCACCTGTCAGTGGACATTCGGG + Intronic
1105052961 12:133071178-133071200 GCACCTGTTGGTGGACATTTGGG + Intergenic
1105343706 13:19553546-19553568 TCACCTGTTAGTGGACATTTGGG - Intergenic
1105435084 13:20369803-20369825 TCACCTGTTGATGGACATCTGGG - Intergenic
1105536338 13:21268088-21268110 TCACCTGTTAGTGGACATTTGGG + Intergenic
1105963140 13:25360771-25360793 TCCCAAGTTGCTGGGCATACAGG + Intergenic
1106007877 13:25788009-25788031 TCCTCTGTTGGTGGTCTCACTGG + Intronic
1106293282 13:28386002-28386024 TCCCCTCTTGTTGGAAATCCTGG + Intronic
1106305445 13:28505205-28505227 TCCCCAGTTGCTGGAACTACAGG + Intergenic
1106539641 13:30678824-30678846 TTGCCTGTTGCTGGACATTCAGG - Intergenic
1107477249 13:40750120-40750142 TCACCTGTTAGTGGACATTTGGG - Intronic
1107789284 13:43985053-43985075 TCTCATGTTGGTGGACATTTTGG + Intergenic
1108056196 13:46487790-46487812 TCACCTGTTGGTGCACATTTGGG - Intergenic
1108188727 13:47915428-47915450 TCCCCTTTGCTTGGACATACAGG - Intergenic
1109041342 13:57341531-57341553 TCATCTGTTGATGGACATTCAGG - Intergenic
1110185599 13:72671345-72671367 TACCCTGTTGGGGGACATTTGGG - Intergenic
1111463965 13:88583352-88583374 TCCCCTGTTGATGTACATTGAGG + Intergenic
1112527439 13:100165066-100165088 TCACCTGTTGATGGACATTTGGG + Intronic
1112772455 13:102805900-102805922 TCCTCAGTTGGTGGACATTTGGG + Intronic
1113102221 13:106733163-106733185 TCATCTGATGGTGGACATAGGGG + Intergenic
1113461866 13:110487552-110487574 TTCCCTGTTGATGGACATTTGGG - Intronic
1113464126 13:110502235-110502257 TCCTCTGTTGATGGACACTCGGG - Intronic
1113496655 13:110735727-110735749 TCCCCTGTAGGTGGGATTACAGG + Intergenic
1114591842 14:23872841-23872863 TCCCATGTAGGTGGAATTACAGG - Intergenic
1114934987 14:27523892-27523914 TCATTTGTTTGTGGACATACAGG + Intergenic
1115595070 14:34901411-34901433 TCCCCTGTAGCTGGAATTACAGG - Intergenic
1115930974 14:38494172-38494194 TCACCTGTTGTTGGACATTTAGG + Intergenic
1115968375 14:38917082-38917104 TCTACTGTTGGTGGACATATAGG - Intergenic
1116185305 14:41592958-41592980 TCTACTGTTGGTGGACATTTAGG - Intergenic
1116575004 14:46562980-46563002 TCACTTGCTGGTGGACATATGGG - Intergenic
1117459321 14:55929123-55929145 TCCCCTGTTGATGGACATTTGGG + Intergenic
1117633494 14:57718238-57718260 TCCTCTGTTGATGGACATGTAGG + Intronic
1117923368 14:60748957-60748979 TCACCTGTTTGTGGTGATACTGG - Intronic
1118033605 14:61841911-61841933 TCAACTGTTGGTGGACATTTAGG + Intergenic
1118658569 14:67981553-67981575 TCACTTGTTGATGGACATGCGGG - Intronic
1119223706 14:72928517-72928539 TCCCCTGTTGTTGGATATCTAGG + Intronic
1119608488 14:76041908-76041930 TCCCCTGTTGGTGGACATTTAGG + Intronic
1119802702 14:77459464-77459486 TGACATGTTTGTGGACATACTGG + Intronic
1120672381 14:87377873-87377895 TCCAGTGTTGGTGGATATTCAGG - Intergenic
1121646659 14:95522384-95522406 TCCCTTGTTGAAGGACATCCGGG + Intergenic
1121806366 14:96828151-96828173 TTTCCTGTTGTTGGACATACAGG + Intronic
1122539676 14:102491016-102491038 TCCCAAGTTGGTGGAATTACAGG + Intronic
1122656307 14:103262116-103262138 TCATCTGTTGCTGGACATATAGG + Intergenic
1122833463 14:104417313-104417335 TTCCCTGTTGATGGACATTTAGG - Intergenic
1123155546 14:106221440-106221462 TCATCTGTTGGTGGACACTCAGG + Intergenic
1123162889 14:106296895-106296917 TCATCTGTTGGTGGACACTCAGG + Intergenic
1123402204 15:19998580-19998602 TCATCTGTTGGTGGACACTCAGG + Intergenic
1123511545 15:21005246-21005268 TCATCTGTTGGTGGACACTCAGG + Intergenic
1123652536 15:22488593-22488615 TCTCCTGTTGATGGACATTTAGG + Intergenic
1123742958 15:23297452-23297474 TCTCCTGTTGATGGACATTTAGG + Intergenic
1124276302 15:28328423-28328445 TCTCCTGTTGATGGACATTTAGG - Intergenic
1124306396 15:28583184-28583206 TCTCCTGTTGATGGACATTTAGG + Intergenic
1125732819 15:41903626-41903648 TCCCCTATAGCTGGACACACAGG + Intronic
1126381843 15:48056405-48056427 TCCCATGTAGGTGGAAGTACAGG - Intergenic
1127023541 15:54777872-54777894 TCATCTGTTGATGGACATGCAGG + Intergenic
1128239351 15:66090699-66090721 TCCCTTGTTGATGGACATTGAGG - Intronic
1128305478 15:66595574-66595596 TCCCCTACTGGTGGACATTTGGG - Intronic
1128486710 15:68098779-68098801 TCCCCTGTTGGTCAACATTTGGG + Intronic
1129062983 15:72875289-72875311 TCACCTGTTGATGGACATTTGGG + Intergenic
1129125776 15:73439980-73440002 TCACCTGTTGGTGGACATTTGGG - Intergenic
1129488088 15:75895954-75895976 TCCCCTATTGGTGGACATCAGGG - Intronic
1129793560 15:78359128-78359150 TTCCCTGTTGGTGGATATTTGGG - Intergenic
1129990433 15:79957628-79957650 TCCCCTGTTGATGAACATTTGGG + Intergenic
1130084525 15:80766086-80766108 TCTCTTGTTGGTGGACATTTAGG + Intergenic
1130441038 15:83954906-83954928 TCCAGTGTTGGTGGCCATAGGGG - Intronic
1131252429 15:90839262-90839284 TCCCCTACTGTTGGACATGCAGG + Intergenic
1131446406 15:92501518-92501540 TCCACTGTGGGTGGACATCTAGG - Intergenic
1131735412 15:95326687-95326709 TCATCTATTTGTGGACATACGGG - Intergenic
1131945459 15:97615582-97615604 TCCCCTGTAGGTGCAAGTACAGG + Intergenic
1132205461 15:99983407-99983429 TCCCCTGTTGGGGGTGGTACGGG - Intronic
1133075902 16:3281049-3281071 TCCCCAGTAGCTGGAAATACGGG + Intronic
1133242356 16:4422658-4422680 TCCCCAGTAGCTGGAAATACAGG + Intronic
1133401602 16:5491497-5491519 TCTCCTGTTGATGGACATTTGGG - Intergenic
1133538415 16:6724331-6724353 TCCCCAGTTGGTGGGATTACAGG + Intronic
1134032379 16:11002868-11002890 TCCTCTGTTGGTGGACACTTAGG + Intronic
1134071529 16:11263038-11263060 TCCCCGGTGGGTGGACACATAGG + Intronic
1134225141 16:12384114-12384136 TCATCTGTTGGTGGACATTTAGG + Intronic
1134563302 16:15229232-15229254 TCCCCTATTGATGGACATTTGGG - Intergenic
1134570487 16:15286391-15286413 TTCCCTCATGGTGGACATTCAGG - Intergenic
1134731890 16:16469672-16469694 TTCCCTCATGGTGGACATTCAGG + Intergenic
1134923829 16:18140861-18140883 TCCCCTATTGATGGACATTTGGG - Intergenic
1134935555 16:18242333-18242355 TTCCCTCATGGTGGACATTCAGG - Intergenic
1136395485 16:29990521-29990543 TCCCTTATTGGTGGACATTTAGG + Intronic
1137371294 16:47908356-47908378 TCACCTGTTGATGGACATTTGGG + Intergenic
1137623763 16:49894499-49894521 TCATCTGTTGATGGACATTCAGG - Intergenic
1137722708 16:50637082-50637104 TCCCCTCCTGGTGGTCATAAGGG + Exonic
1137984442 16:53095735-53095757 TCTCCTGTTAGTGGACATTTGGG + Intronic
1138097625 16:54224539-54224561 TCCCCTCTTGTTGGACATTTAGG - Intergenic
1138698260 16:58835799-58835821 TCCACTGTTGATGGACATCTGGG + Intergenic
1139185299 16:64799336-64799358 TCCCCTATTGGTGGACATTTAGG + Intergenic
1140773172 16:78224564-78224586 TCCCCTGTTGTTGGACATACAGG + Intronic
1141133536 16:81451067-81451089 TCCCCTGTTGATGGGCATTGAGG + Intronic
1141251853 16:82366334-82366356 TCACCTGTTGATGGACATTTAGG + Intergenic
1141519487 16:84568394-84568416 TCCTCTGTTGATGGACATAGGGG - Intronic
1141633349 16:85301050-85301072 TCCCCTGTGGTTGCACCTACCGG + Intergenic
1142105895 16:88302581-88302603 TGCCCTGGTGGTGGAGATACAGG + Intergenic
1203144151 16_KI270728v1_random:1788894-1788916 TCCCCAGTAGCTGGAAATACAGG + Intergenic
1142998901 17:3778150-3778172 TCTCCTGTTGATGGACATTTGGG - Intronic
1143091979 17:4454274-4454296 TCCCATGTTGGGGGACAGGCAGG - Intronic
1143263552 17:5618758-5618780 TCACCTGTTGATGGACATTTGGG + Intronic
1143380772 17:6494870-6494892 TCCCCTACTGGTGGACATATAGG - Intronic
1143425600 17:6834394-6834416 TCTCCTCTTGGTGGACATTTGGG - Intergenic
1143835782 17:9691476-9691498 TCCATTGTTGGTGGACACTCAGG + Intronic
1143876579 17:9995846-9995868 TCCCCTGTTGGTGAACATTTAGG - Intronic
1145770694 17:27490876-27490898 TCCCCTGTTACTGGACATTTAGG - Intronic
1145848496 17:28066511-28066533 TCACCTGTTGATGGACATTTAGG + Intronic
1146247360 17:31300546-31300568 TCCCCTATTGGTGGACATCTGGG + Intronic
1146727351 17:35167065-35167087 TCCCCTGTTGGTGAGCATGTGGG - Intronic
1146936736 17:36816722-36816744 TCCCCTGCTGGTAGAGCTACGGG - Intergenic
1147016172 17:37493307-37493329 TCCACTGTTGATGGACATCTGGG + Intronic
1147431462 17:40373678-40373700 TCACCTGTTGATGGACATCTGGG - Intergenic
1147645243 17:42029388-42029410 TCTCCTGTTGGTGGACATGTGGG - Intronic
1148221133 17:45862982-45863004 TTCCCTGTTGGTGGTCATTTAGG - Intergenic
1149096782 17:52851621-52851643 TCCCCTGTAGGTGGACATTTGGG + Intergenic
1149888120 17:60361003-60361025 TCCCCTGTAGCTGGAATTACAGG - Intronic
1151277195 17:73044291-73044313 TCTCCTGTTGATGGACATTTGGG - Intronic
1151394305 17:73811414-73811436 TCTCCTGTTGGTAGACATCTGGG - Intergenic
1152144014 17:78556752-78556774 TCCTCTGTTGATGGGCATTCGGG - Intronic
1152464894 17:80460641-80460663 TCCTCTGTTGAGGGACACACGGG - Intergenic
1153369759 18:4301537-4301559 TCATCGGTTGGTGGACACACAGG + Intronic
1156212080 18:34955638-34955660 TCCACTGTTGATGGACATTTAGG - Intergenic
1156852203 18:41741839-41741861 TCTCCTGTTGGTGGACATTTAGG - Intergenic
1156927575 18:42600916-42600938 TCCACTGTTGATGGGCATCCAGG + Intergenic
1157390696 18:47300503-47300525 TCTCCTCTTGGTGGACATCTGGG + Intergenic
1157960821 18:52151686-52151708 TCCCATGCTGGTGGCCATAGAGG + Intergenic
1159007826 18:63028588-63028610 TCCCCTGTTGTTTGACATTCAGG + Intergenic
1159576611 18:70186173-70186195 TCACCTGTTGGTGGACAATGGGG - Intronic
1160669845 19:356100-356122 TCCCCTATTGGTGGACATTCCGG + Intergenic
1161248173 19:3266551-3266573 TCCCCTGTTGGGGGACACTTGGG + Intronic
1161397721 19:4053256-4053278 GCCCTTGTGGGTGGACATCCCGG - Intronic
1161542907 19:4862835-4862857 TCCCCTTTTGCTGGGCATCCAGG - Intronic
1163948594 19:20563607-20563629 TCCCATGTTGTTGGGAATACAGG + Intronic
1164215400 19:23140826-23140848 TCCCCTGTAGGTGGAACTACAGG - Intronic
1165699666 19:37927940-37927962 TCCGCTGTTGATGGGCATCCGGG + Intronic
1165702024 19:37945715-37945737 TTGCCTGTTGTTGAACATACTGG + Intronic
1165716533 19:38049493-38049515 TCCCCTGGTGTTGGGCATCCAGG + Intronic
1166311430 19:41965079-41965101 TCTCCTGTTGGGGGACTTAGGGG - Intergenic
1167029561 19:46948518-46948540 TCACCTGGTGGTGGACATCTGGG - Intronic
1167255572 19:48426125-48426147 TCTACTGCTGGTGGACATTCAGG + Intronic
1168143714 19:54407065-54407087 TCCCCTGTTGATAGGCATACAGG + Intergenic
1202686420 1_KI270712v1_random:54302-54324 TCCCCAGTAGCTGGAAATACAGG + Intergenic
926015214 2:9445352-9445374 TCACCTGTGGGTGGACACTCGGG + Intronic
926651168 2:15347394-15347416 TCACCAGTTGGTGGACATTTGGG - Intronic
926981405 2:18574578-18574600 TCCCCTGATGATGGACATTTGGG - Intronic
927661154 2:24994162-24994184 ACCCCTATTGGTGGACATTCAGG - Intergenic
928068531 2:28191487-28191509 TTCCCTGTTGATGGACATTTGGG - Intronic
928441761 2:31297872-31297894 TCCCCTGTTAGGAGACATGCAGG - Intergenic
929072924 2:38051914-38051936 TCGTCTGTTGATGGACATGCAGG + Intronic
929985116 2:46722574-46722596 TCACCTGTTGAAGGACATATGGG + Intronic
930101074 2:47603676-47603698 TCCCCAGTTGATGGACATTAGGG + Intergenic
930425706 2:51209926-51209948 TCTCCTGTTGATGGACATTTAGG - Intergenic
930452528 2:51560185-51560207 TCAACTGTTGGTGGACATTTGGG + Intergenic
931702595 2:64921005-64921027 TCACTTGTTGGTGGACATTTGGG - Intergenic
932610969 2:73199830-73199852 TCTACTGTTGGTAGACATTCTGG + Intergenic
932682743 2:73840285-73840307 TCCCCTATTGATGGACATTTAGG + Intronic
933312070 2:80673190-80673212 TCCCCAGTAGCTGGAAATACAGG - Intergenic
933729588 2:85446648-85446670 TCCCCTTTTACTGGACATGCAGG + Intergenic
934245297 2:90300510-90300532 TCCCCAGTAGCTGGAAATACAGG - Intergenic
934263446 2:91496519-91496541 TCCCCAGTAGCTGGAAATACAGG + Intergenic
934478152 2:94606601-94606623 TCCCCTGTGGATGGACATTTGGG - Intergenic
934682507 2:96295083-96295105 TCCCCTGTAGCTGGAATTACAGG - Intronic
936605684 2:113950615-113950637 TCCCCTATTGATGGACTTAACGG + Intronic
937200480 2:120201021-120201043 TCCCGTGTAGCTGGAAATACAGG - Intergenic
938890124 2:135696081-135696103 TCACCTGTGGGTGGACATTTGGG - Intronic
938892298 2:135717929-135717951 TCTCCTGTTGATGGACATGTTGG - Intronic
938964337 2:136374915-136374937 TCACCTGTTGGTAGACATTTGGG - Intergenic
939514886 2:143154041-143154063 TCACCTGTTGATAGACATATGGG + Intronic
939834696 2:147114374-147114396 TCACCTGTTGATGGACATTTAGG + Intergenic
940779847 2:157921089-157921111 TCCCCTTTTGTTGGACATTTAGG - Intronic
940930503 2:159423616-159423638 TCCACTGTTGATGGGCATATAGG - Intronic
942337143 2:174900679-174900701 TCCCGTGTAGCTGGGCATACAGG - Intronic
942393469 2:175521260-175521282 TCCCCTGTTGTTGGACATTTAGG + Intergenic
942510104 2:176688970-176688992 TCACCTGTTGATGGACATTTCGG - Intergenic
942965539 2:181889054-181889076 TCCCAAGTTGGTGGAATTACAGG + Intergenic
943040436 2:182797920-182797942 TCACCTGTTGATGGACATTTGGG - Intergenic
944784339 2:203052975-203052997 TCCCCTGTTGCAGGACATCTTGG + Intronic
944860692 2:203813213-203813235 TCACCTGTCGGTAGACATTCGGG + Intergenic
945911619 2:215656454-215656476 TCTCCTGTTGATGGACATTCAGG + Intergenic
945948213 2:216014254-216014276 ACCCCTATTGATGGACATATGGG + Intronic
947858527 2:233341433-233341455 TCATCTGTTGGTGGACATTTGGG - Intronic
1169331287 20:4718413-4718435 TTCCCTGTTGATGGACATTTGGG - Intergenic
1169368595 20:5011058-5011080 TCCCCAGTAGGTGGAACTACAGG - Intergenic
1169554808 20:6737897-6737919 TCTGCTGTTGGTGGACATTAGGG + Intergenic
1169737574 20:8853582-8853604 TCCACTGTTGATGGACATTTAGG + Intronic
1170641756 20:18160540-18160562 TCTCCTGTTGATGGACATTTTGG + Intronic
1170651796 20:18249717-18249739 TCCTCTGTTGATGGACATTTGGG + Intergenic
1170883558 20:20318585-20318607 TCCCCTGATGGTGGAAATCATGG + Intronic
1170894403 20:20400779-20400801 TCACCAGTTGATGGACATTCGGG - Intronic
1170951553 20:20940892-20940914 TCCCCTCTTGATGGACATTTGGG + Intergenic
1172213617 20:33218155-33218177 TCCCCTCTGGATGGACATGCAGG + Intronic
1172549856 20:35790322-35790344 TCCCCTGTAGGTGGGATTACAGG + Intronic
1172976759 20:38911842-38911864 TCTCCTTTTGGTGGACATTTGGG + Intronic
1173197413 20:40927198-40927220 TCCCCTCTTGATGGACATTCGGG - Intergenic
1173286822 20:41679914-41679936 TTGCCTGTTGGTGGACATTTGGG - Intergenic
1173292281 20:41725454-41725476 TCACCTGTTGATGGACATTGGGG + Intergenic
1174075551 20:47933186-47933208 TCCCCTGTCGGTAGACATTTGGG - Intergenic
1174199343 20:48796266-48796288 TCCCCTGTTGATGGACACTGAGG - Intronic
1174278040 20:49417854-49417876 TTCCCTGTTGATGGACATTGAGG - Intronic
1174675741 20:52352408-52352430 TCTCCTGTTGATGGACATGTGGG + Intergenic
1174686529 20:52461318-52461340 TCCCCTGTGGATGGACATTGAGG + Intergenic
1175143242 20:56876165-56876187 TCCCGTGTAGCTGGAAATACAGG + Intergenic
1175270861 20:57733364-57733386 TCCCCTGTTGCGGGACATTTGGG + Intergenic
1175272070 20:57741449-57741471 TCCCCTGTGGATGGACATTTAGG + Intergenic
1175548045 20:59792216-59792238 TCATCTGTTGATGGACATATGGG + Intronic
1175882544 20:62269267-62269289 CGCCCTGTTGTTGGACATACGGG + Intronic
1176728462 21:10465411-10465433 TCACCTGTTGGTGAACATTTGGG + Intergenic
1178352550 21:31882987-31883009 TCCCTTGTTGATGGACATTTAGG + Intronic
1179466072 21:41574103-41574125 TCACCTGTTGGAGGACATTTGGG + Intergenic
1179475867 21:41643633-41643655 TCGCCTGTTGATGGACATTTGGG - Intergenic
1179558750 21:42198611-42198633 TCTCCTATTGGTGGACATTTGGG - Intergenic
1179903616 21:44407828-44407850 TCATCAGTTGGTGGACATATGGG + Intronic
1179963195 21:44783509-44783531 TCCCCAGTTGATGGACATTTGGG - Intronic
1180003600 21:45007977-45007999 TCCCCTGTTGCTGGATATTTGGG + Intergenic
1182080611 22:27526199-27526221 TCCTCTGTTGATGGACATTTGGG - Intergenic
1182726394 22:32449637-32449659 TCCTATGTTGGTGGACATCTAGG + Intronic
1183374033 22:37452367-37452389 TCACCTGTTGATGGACATTTGGG - Intergenic
1183890038 22:40919760-40919782 TCTCCTGTTGATGGACATTTTGG - Intronic
1184012803 22:41762027-41762049 TCACCTATTGGTGGACATTTGGG + Intronic
1185174016 22:49309142-49309164 TCCCCTATTGGTGGACATTTGGG + Intergenic
1185418219 22:50721253-50721275 ACCCCTGTTTGTGGATGTACAGG + Intergenic
950294762 3:11819476-11819498 TCCCCTGTTGTTGGACATTTGGG - Intronic
950387101 3:12668776-12668798 TCATCTGTTGGTGGACATTTGGG + Intergenic
950439741 3:13003073-13003095 TCCCCGGTTGATGGACATGTGGG - Intronic
950733558 3:14984683-14984705 TCACCTGTTGATGGACATTTGGG + Intronic
950736702 3:15014854-15014876 TCATCTGTTGGTGGACATGTAGG + Intronic
950836519 3:15924851-15924873 TCCCCAGTAGGTGGAATTACAGG - Intergenic
951013904 3:17708361-17708383 TCCCCTGCTGATGGACATTTAGG + Intronic
951724519 3:25742311-25742333 TTCCCTATTGATGGACATAGAGG - Intronic
952264975 3:31776549-31776571 TCATCTGTTGGTGGACATTTGGG - Intronic
952666792 3:35916427-35916449 TCCACTGTTGGTGGACACTTAGG + Intergenic
952981437 3:38739276-38739298 TCCCCTCTTGGTGCAGATAAGGG + Intronic
953189732 3:40673426-40673448 TCACCTGTTGGTGGAGGTATTGG - Intergenic
953376589 3:42433524-42433546 TCTCCTGTTGATGGACATTTGGG - Intergenic
953470697 3:43163566-43163588 TCCCCAGGTGGTGGGCATCCTGG + Intergenic
954326198 3:49865535-49865557 TCACCTGTTGTTGGACATTTAGG - Intronic
954595002 3:51816817-51816839 TCACCTGTTGGTGGACATTTGGG + Intergenic
954782146 3:53069821-53069843 TCCCCTATTGCTGGACATCCAGG - Intronic
955078024 3:55632160-55632182 TCCCCTGCTGGTGTGCATAGAGG - Intronic
955222984 3:57038353-57038375 TCACCTCTTGGTTGACATCCAGG - Intronic
955495427 3:59526982-59527004 TCATCTGTTGGTGGACATTTGGG - Intergenic
955983893 3:64553445-64553467 TCCTCAGTTGATGGACATATGGG + Intronic
956392279 3:68786006-68786028 TCCCCTATTGATGGACATATGGG - Intronic
957755100 3:84475035-84475057 TCCCCTGTTGATGGACATGTAGG - Intergenic
958431697 3:94046574-94046596 TCACTTGTTGGTGGGCATTCAGG + Intronic
958469741 3:94502373-94502395 TCACCTGGTGGTGGACATTTGGG + Intergenic
959073998 3:101731322-101731344 TCCCCAGTAGCTGGAAATACAGG + Intronic
959616481 3:108353953-108353975 TCCCCTGTTGGTGGGTATTCAGG + Intronic
959680162 3:109086695-109086717 TTCTCTGTTGGTGGGCATTCAGG - Intronic
960092653 3:113657142-113657164 TCCTCTGTTGGTGGACATTATGG + Exonic
962062626 3:131946420-131946442 TCACCTGTTGATGGACATTTGGG + Intronic
962469543 3:135693531-135693553 TCCCCTTTTGGTGGACATTTAGG + Intergenic
962698418 3:137973497-137973519 TCCCCTGTTGTTGGACATTTTGG + Intergenic
962948366 3:140194926-140194948 GCCAGTGATGGTGGACATACAGG + Intronic
966429588 3:179817400-179817422 TCCCCTATTGATGAACATTCAGG + Intronic
966877153 3:184328948-184328970 TTCCCTGTTGCTGGAGATCCTGG + Exonic
966997821 3:185300851-185300873 TCATCTGTTGGTGGACATTTAGG + Intronic
967893036 3:194376617-194376639 TCCTCTGTCGGTGGACATGGGGG - Intergenic
968496111 4:916931-916953 TCACCTGTTGATGGACATTTGGG - Intronic
968565147 4:1308358-1308380 TCCCCTGGTGATGGACATGTGGG + Intronic
968601194 4:1510303-1510325 TCACCTTTTGATGGACATATGGG + Intergenic
969405058 4:6986254-6986276 TCCGCGGTTGGTGGACGTTCTGG + Intronic
970621033 4:17819208-17819230 TCCTCTGTTGATGGACATTTAGG + Intronic
971212767 4:24635814-24635836 TTCCCTGTTGATAGACATCCAGG - Intergenic
971285367 4:25284214-25284236 TCACCTGTTGGTGGACACCTGGG - Intergenic
971685782 4:29765233-29765255 TCCACTGTTGATGGACATCCAGG - Intergenic
971997046 4:33978268-33978290 TCACCTGTTGATGAACATATTGG - Intergenic
972098973 4:35388198-35388220 TCCTCTGTTGGTGGACAGTTAGG - Intergenic
972896122 4:43621940-43621962 TCCACTGTTGATGGACATCTAGG - Intergenic
972903586 4:43716823-43716845 TCCCCTGTTGGTTTACTCACTGG + Intergenic
973718256 4:53699271-53699293 TTCTCTGTTGGTGGACATTTGGG + Intronic
974558229 4:63480162-63480184 TCACCTGTTGAAGGACAAACTGG - Intergenic
975216231 4:71759180-71759202 TCATCTGTTGATGGACATATGGG + Intronic
975894778 4:79075868-79075890 TCCCCTGTTGATGGGCATTTAGG + Intergenic
976318957 4:83689636-83689658 TCGCCTGTTGAAGGACATATGGG + Intergenic
977968426 4:103184025-103184047 TCCCCTGTTGAAGGACATGTAGG + Intronic
978048710 4:104167892-104167914 TCACCTGTTGATGGACATGAGGG + Intergenic
978266434 4:106831820-106831842 TCCACTGTTGATGGACATCTAGG - Intergenic
978352065 4:107830273-107830295 TCCACTGTTGGTGGGCATCTAGG + Intronic
978883440 4:113737241-113737263 TCGTCTGTTGATGGACATGCAGG - Intronic
979977912 4:127219623-127219645 TCACCTGTTGATGGACATTTAGG - Intergenic
980121074 4:128728553-128728575 TCTCCTGTTGATGGACATTTCGG - Intergenic
981445336 4:144830218-144830240 TCACCTGTTGATGGACATTGGGG - Intergenic
981721333 4:147804395-147804417 TCTACTGTTGGTGGACATCTAGG + Intronic
982017552 4:151169912-151169934 TCCCCTGTTGATGGACATTCAGG - Intronic
982155113 4:152511617-152511639 TCCCATATTGGTGGACATTTAGG - Intronic
983249695 4:165329756-165329778 TCCCCAGTAGGTGGAATTACAGG + Intronic
983444969 4:167838530-167838552 TCCCCTGTTGGTGAACATTTGGG + Intergenic
984469088 4:180143215-180143237 TCCCCTGTTGATGGACATTTAGG + Intergenic
984996091 4:185431441-185431463 TCTCCTGTTGATGGACATTTGGG + Intronic
985275023 4:188229738-188229760 TCCCATGTAGCTGGAAATACAGG - Intergenic
985814997 5:2120907-2120929 TCTTCTGTTGGTGGACATTTAGG + Intergenic
985825593 5:2188571-2188593 TCACTTGTTGGTGGACATTTGGG + Intergenic
986174775 5:5342461-5342483 TGCCCTGCTGGTGGACACAATGG - Intergenic
986584461 5:9300149-9300171 TCCCATGTAGCTGGACCTACAGG + Intronic
987912102 5:24161018-24161040 TCACCTGTTGATGGACATTTAGG - Intronic
988831216 5:34989179-34989201 TCCCCTGTTTGTGGTGATGCTGG + Intergenic
989013485 5:36901339-36901361 TCCACTGTTGGTGGGCATCTAGG + Intronic
989359950 5:40590387-40590409 TCCCCTGTTGATGGGCATCCAGG + Intergenic
989595129 5:43149435-43149457 TCACCTGTTGATGGACATTTAGG + Intronic
989642431 5:43595988-43596010 TCACCTGTTGAAGGACATATGGG + Intergenic
990415450 5:55581661-55581683 TTCCCTGTTGTTGGACATTCAGG - Intergenic
991365524 5:65864030-65864052 TCTCCTGTTGATGGACATTTAGG + Intronic
992032377 5:72734682-72734704 TCCACTGTTGATGGACATCTAGG + Intergenic
992699922 5:79331663-79331685 TCACCTGTTGATGGACATCTGGG - Intergenic
992717302 5:79523365-79523387 TCCTCTATTGATAGACATACAGG - Intergenic
993067760 5:83121186-83121208 TCACCAGTTGGTGGACATTTGGG + Intronic
993398697 5:87422073-87422095 TCCACTGTTGCTGGACAAAGTGG - Intergenic
993419850 5:87687396-87687418 TCATCTGTTGATGGACATATAGG + Intergenic
995602727 5:113815988-113816010 TCACCTGTTGATGGACATTTGGG - Intergenic
997135688 5:131322689-131322711 TCTTCTGTTGGTGGACATTTGGG + Intronic
997356968 5:133268830-133268852 TCCCCTGATGATGGATATTCAGG - Intronic
997494869 5:134314549-134314571 TTCCCTGTTGATGGACATGTGGG - Intronic
997649636 5:135506507-135506529 TCACCTGTTGGTGGACATTTGGG - Intergenic
997789696 5:136747047-136747069 TCATCTGTTGGTGGACACTCAGG - Intergenic
998303530 5:141050859-141050881 TCCCCTGTCAGTGTACTTACTGG + Intergenic
998590942 5:143477480-143477502 TCCTCTCATTGTGGACATACAGG + Intergenic
998694087 5:144617940-144617962 TCATCTGTTGATGGACATATAGG - Intergenic
998943831 5:147315321-147315343 TCATCTGTTGATGGACATTCGGG - Intronic
1000351879 5:160358590-160358612 TCCCAAGTAGGTGGACCTACAGG + Intronic
1000755559 5:165154934-165154956 TCCCCAGTAGCTGGAAATACAGG - Intergenic
1001008518 5:168076133-168076155 TCACCTGTTGATGGACATTTGGG + Intronic
1001039792 5:168326051-168326073 TCCTCTGTCGGTGGACATTTGGG + Intronic
1001077367 5:168640279-168640301 TCTCCTGTTGATGGACATATGGG + Intergenic
1001090103 5:168733536-168733558 TCCTCTGTTGATGGACATTGAGG - Intronic
1001257071 5:170192260-170192282 TCTCCTGTAGGTAGACACACAGG + Intergenic
1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG + Intronic
1001701246 5:173707920-173707942 TCTCCTGTTGGTGGACCTTTGGG - Intergenic
1002007072 5:176243943-176243965 TCACCTGTTGCTTGACATCCTGG - Intronic
1002219311 5:177666690-177666712 TCACCTGTTGCTTGACATCCTGG + Intergenic
1002480578 5:179498218-179498240 GCCCCTGCTGATGGACACACAGG - Intergenic
1002511537 5:179722303-179722325 TCTCCTGTTGGTGGCCATTTAGG + Intronic
1003587595 6:7407029-7407051 TCATCTGTGGATGGACATACGGG + Intronic
1003692832 6:8371758-8371780 TCCCCTGTTGGTTGAAAAGCAGG + Intergenic
1003939979 6:11014970-11014992 TCACCTGTTGATGGACATTTGGG - Intronic
1006448779 6:34093996-34094018 TCCCCTCTTGATGGACATGTGGG - Intronic
1006667915 6:35710737-35710759 TCTCCTGTTGATGGACATTATGG - Intronic
1006739640 6:36298236-36298258 TCCCCTGTTGATGGACATTTAGG + Intronic
1006795050 6:36726692-36726714 TCCCCTATTGATGGACATTTAGG - Intronic
1007731249 6:43948677-43948699 TCCCCTACTGGTGGACATTTTGG + Intergenic
1008551538 6:52637274-52637296 TCCCCTGCTGATGGACATTTGGG - Intergenic
1008614555 6:53213671-53213693 TTCCCTGTGGGTGGACATTTTGG - Intergenic
1009301956 6:62035237-62035259 TCCTCTGGTGGTGGACACATAGG - Intronic
1009561824 6:65256094-65256116 TCATCTGTTGATGGACATGCAGG - Intronic
1009568546 6:65348126-65348148 TCATCTGTTGGTGGACACCCAGG + Intronic
1009977804 6:70691854-70691876 TCCCCTGTTGATGGACACTTAGG + Intronic
1010230965 6:73534988-73535010 TCACCTGTTGATGGACATTTGGG - Intergenic
1010554505 6:77262337-77262359 TCCCCTTTTAGTGAACATGCAGG + Intergenic
1010607708 6:77911769-77911791 TCCACTGTTGATGGGCATCCAGG + Intronic
1011118075 6:83917470-83917492 TCTCCTGTTGATGAACATTCAGG - Intronic
1011305703 6:85923977-85923999 TCACCTGTTGATGGACATCAGGG + Intergenic
1011353485 6:86448906-86448928 TCTCCTCTTGGTGGACATTTGGG - Intergenic
1011446671 6:87448898-87448920 TCTCCTGTTGGTGGACACTTAGG + Intronic
1011919903 6:92560597-92560619 TCACCTGTTGATGGGCATATAGG + Intergenic
1012158466 6:95851753-95851775 TCATCTGTTGATGGACATTCAGG + Intergenic
1012472476 6:99587904-99587926 TCCCCCGTAGGTGGAATTACAGG + Intergenic
1012589249 6:100959751-100959773 TCCCCTGTTGATGGACACTTGGG + Intergenic
1013834193 6:114313433-114313455 TCACCTGTTGTTGGACATTTGGG - Intronic
1014053254 6:116981368-116981390 TCACCTGTTGATGGACATTTGGG - Intergenic
1014483251 6:121965091-121965113 TCACCTGTTGGTGGGCATTTGGG + Intergenic
1015053202 6:128867412-128867434 TCCCCTGTTGGTAGATATTTAGG + Intergenic
1015222755 6:130823768-130823790 TCACCTGTTCGTGGACATTTGGG - Intergenic
1016261719 6:142179466-142179488 GCCCCTGTTGGTGGACATCAGGG - Intronic
1016308470 6:142708498-142708520 TCATCTGTTGGTGGACATTTAGG - Intergenic
1016498544 6:144691238-144691260 TCCCATGTAGCTGGAAATACAGG + Intronic
1016774283 6:147887571-147887593 TCACCTGTTGATGGACATTTGGG + Intergenic
1016868512 6:148793591-148793613 TCACCTGTTGGTGGTGATGCTGG - Intronic
1017494062 6:154967639-154967661 TCCCCTGTAGCTAGACTTACAGG - Intronic
1018585690 6:165355595-165355617 GCCCCTGTTGCTGGACATTTAGG + Intronic
1019684162 7:2371316-2371338 TCCTCTGTTGATGGACATCAGGG + Intronic
1019877041 7:3822642-3822664 TCCCCTGTAGCTGGAATTACAGG - Intronic
1020043093 7:5018883-5018905 TCCCGAGTAGGTGGAAATACAGG - Intronic
1021466658 7:20951848-20951870 TCCACTGTTGGTGGACATTTGGG - Intergenic
1022233866 7:28442335-28442357 TCATCTGTTGATGGACATATAGG + Intronic
1022422247 7:30234551-30234573 TCCCTTATTGCTGGACATGCAGG - Intergenic
1023008575 7:35903507-35903529 CCCCCAGTTGTTGGACATAAGGG + Intronic
1023374155 7:39539430-39539452 TCCCCTGTAGGTGGGATTACAGG - Intergenic
1023871549 7:44265762-44265784 TCCACTCATGGTGGCCATACAGG + Intronic
1024052663 7:45638642-45638664 GTCCCTGTTGTTGGACATGCAGG + Intronic
1024602149 7:50993271-50993293 TCACCTGTTGATGGACATTTAGG - Intergenic
1024947455 7:54824418-54824440 TCACCTCTTGGTGGACATTAGGG + Intergenic
1025809890 7:64869028-64869050 TTCCTTGTTGGTGGATATAACGG - Intergenic
1026234921 7:68519169-68519191 TCCCCTGTAGCTGGAACTACAGG - Intergenic
1027371536 7:77511054-77511076 TCCACTGTTGATGGACATCTAGG - Intergenic
1029271319 7:99378557-99378579 TCCCCAGTAGGTGGAACTACAGG - Intronic
1029950653 7:104580925-104580947 TCTCCTGTTGATGGACATTTAGG + Intronic
1031608463 7:123796682-123796704 TCATCTGTTGGTGGACATTTGGG - Intergenic
1034125215 7:148665436-148665458 TCACCAGTTGTTGGACATTCGGG - Intergenic
1034131409 7:148721835-148721857 TCTCCTGTTGGTGGACATGTGGG + Intronic
1034490492 7:151390638-151390660 TCACCTGTTGATAGACACACGGG - Intronic
1034601628 7:152262549-152262571 TCACCTGTTGGTGAACATTTGGG - Intronic
1035090106 7:156303239-156303261 TCACCTGTTGGTGGGCATTTGGG - Intergenic
1035596709 8:863951-863973 TCACCTGTTGATGGACACACAGG - Intergenic
1036724273 8:11205620-11205642 TCCCCTTTGGGTGGACATGTGGG - Intergenic
1037074702 8:14700203-14700225 TCCACTGTTGATGGGCATCCAGG - Intronic
1037369076 8:18154016-18154038 TCCTCTGTTGATGGACATTTAGG - Intergenic
1038457199 8:27683743-27683765 TCTCCTGTTGATGGATATATGGG - Intergenic
1039459584 8:37732318-37732340 TCACCTGTTGATGGACAGATAGG - Intergenic
1039617408 8:38967184-38967206 TCCTCTGTTGGTGGACACTTAGG + Intronic
1039986080 8:42449186-42449208 CCCCCTGCGGATGGACATACTGG + Intronic
1040009731 8:42651436-42651458 TCACCTGTTGGTGGACACTTGGG - Intergenic
1041110069 8:54475535-54475557 TCCCCTCTGGGTGGACCCACTGG - Intergenic
1042109471 8:65365804-65365826 TCACCTGTTGATGGACATTTGGG - Intergenic
1042223476 8:66496198-66496220 TCATCTGTTGGTGGACATTTGGG + Intronic
1043088461 8:75867498-75867520 TCACCTGTTGATGGACATCTGGG + Intergenic
1043321747 8:78995520-78995542 TCCCCTGTTGATGGACACATAGG - Intergenic
1044538653 8:93385604-93385626 CCTCCTGTTGGTGGACACATGGG - Intergenic
1045605866 8:103774422-103774444 TCTCCTGTTGATGGACATATGGG - Intronic
1045661434 8:104441815-104441837 TCCCCTATTGATGGACATCTGGG - Intronic
1046284222 8:112074065-112074087 TCCCCTGGTGGTGTATATAGAGG - Intergenic
1046319401 8:112552360-112552382 TCCCCAGTAGGTGGGAATACAGG - Intronic
1046649337 8:116819512-116819534 TCACCTGTTGGTGAACATTATGG + Intronic
1046685493 8:117221461-117221483 TCACCTGTTAGTGGACATTTTGG - Intergenic
1047320548 8:123776454-123776476 TCCTCTTTTGGAGGAAATACTGG + Intronic
1047322879 8:123804782-123804804 TCCCCTGTTGGTGGACATTTTGG + Intronic
1048644570 8:136405224-136405246 TCACCTGTTGATGGACATTTAGG - Intergenic
1048848975 8:138626441-138626463 ACCCCTGTTGGTACACACACTGG + Intronic
1049044211 8:140136712-140136734 TCCCCTGTTGCTGGGATTACAGG - Intronic
1051435639 9:17028002-17028024 TCCCCTATTGATGGATATCCAGG + Intergenic
1051702959 9:19843918-19843940 TCCACTGTTGGTGGGCATCTAGG + Intergenic
1051763607 9:20497697-20497719 TTCCCTGTTGGTGGACATCTGGG + Intronic
1052434732 9:28411661-28411683 TCATCTGTTGGTGGACACATGGG + Intronic
1052520583 9:29543369-29543391 TCGCCTATTGGTGGACATTTTGG + Intergenic
1052755609 9:32537794-32537816 GCCCCTGTTGGTGGGAATACTGG + Intergenic
1052851793 9:33382975-33382997 TCCCCTGTGGATGGACATTTGGG + Intergenic
1053376466 9:37610969-37610991 TCCCCTATTGATGGACATTTAGG + Intronic
1053679900 9:40479513-40479535 TCCCCTGTGGATGGACATTTGGG + Intergenic
1053929896 9:43107823-43107845 TCCCCTGTGGATGGACATTTGGG + Intergenic
1054283814 9:63145422-63145444 TCCCCTGTGGATGGACATTTGGG - Intergenic
1054391005 9:64619516-64619538 TCCCCTGTGGATGGACATTTGGG + Intergenic
1054504721 9:65896810-65896832 TCCCCTGTGGATGGACATTTGGG - Intergenic
1054714026 9:68539682-68539704 TCACCTGTTGATGGACATTTGGG + Intronic
1054766480 9:69046671-69046693 TCCCCTACTGTTGGACATTCAGG + Intronic
1056262924 9:84866809-84866831 TCATCTGTTGGTGGACATTTGGG - Intronic
1056366907 9:85914460-85914482 TCTCCTTTTGGTGGACATTTAGG - Intergenic
1056528161 9:87463149-87463171 TTCCCTATTGGTGGACATTGAGG - Intergenic
1057117508 9:92539845-92539867 TCCCCTATTGATGGACATTTGGG + Intronic
1057516671 9:95728142-95728164 TCCCCTATTGTTGGATATTCAGG + Intergenic
1057573368 9:96220307-96220329 TCAGCTGTTGGTGGACATTTGGG - Intergenic
1057734861 9:97647060-97647082 TCTCCTGTTGGTGGACGTTTAGG + Intronic
1058991914 9:110262210-110262232 TCACCTGTTGGTGAACATTTGGG - Intergenic
1059209794 9:112502868-112502890 TCCCCTACTGATGGACATATCGG - Intronic
1059361526 9:113745756-113745778 TCCCCTTTTCGTGGACATTCAGG - Intergenic
1059714553 9:116901545-116901567 TCACCTGTTTGTGGTCATGCTGG + Intronic
1060204056 9:121671821-121671843 TCCCCTATTGGTGGACATTTAGG + Intronic
1061634333 9:131897166-131897188 TCTCCTATTGGTGGACATTCGGG + Intronic
1061910705 9:133721254-133721276 TCCCCTGTTGATGGCCCTCCTGG - Intronic
1062573660 9:137196786-137196808 TCCCCTCCTGATGGACATTCTGG + Intronic
1062637534 9:137499528-137499550 TCCCCTGCTGGTGGAGGGACCGG + Intronic
1062714240 9:137997880-137997902 TTCCCTGATGGTGAACATGCAGG - Intronic
1185534742 X:851988-852010 TCCCCAGTAGCTGGAAATACAGG - Intergenic
1185598824 X:1325237-1325259 TCCCCAGTAGGTGGAACTACAGG - Intergenic
1186043175 X:5503864-5503886 TCCACTGTTGGTGGGCATCTAGG + Intergenic
1186726762 X:12366250-12366272 TTTACTGTTGGTGGACATAGAGG + Intronic
1187165988 X:16804320-16804342 TTCCCTATTGGTGGACATTTAGG + Intronic
1187615325 X:20987526-20987548 TCCTCTGTTGATGGACATCTAGG - Intergenic
1187724569 X:22189172-22189194 TCACCTGTTGGTGGACACTTAGG + Intronic
1187829238 X:23363945-23363967 TCTCCTGTTGGTGGACCTTTGGG - Intronic
1188264927 X:28061398-28061420 TCCTCTGTTGATGGCCATATAGG + Intergenic
1188602128 X:31980288-31980310 TCTCCTTTTGATGGACATTCAGG - Intronic
1189269406 X:39740335-39740357 TCACCTGCTGGTGGACAGAAAGG - Intergenic
1190414916 X:50171573-50171595 TCCCAAGTAGCTGGACATACAGG + Intergenic
1191734181 X:64371765-64371787 TCCCCTATTATTGGACATACAGG - Intronic
1192308918 X:69992544-69992566 TCTCCTGTTGGTGGACAATGAGG + Intronic
1192627092 X:72740759-72740781 TCCCCTGTTTGTGGAAATATCGG + Intergenic
1193054090 X:77131541-77131563 TCCACTGTTGATGGACATCTAGG - Intergenic
1193432971 X:81434587-81434609 TCCACTGTTGATGGACATTTTGG + Intergenic
1195082112 X:101381201-101381223 TCTCCTGTTGATGGACATTTAGG + Intronic
1195223216 X:102766238-102766260 TCCCTTGTTGGTGGAAAAATAGG + Intergenic
1195288341 X:103407214-103407236 TCACCTGTTGGTGGATATTTGGG + Intergenic
1195324739 X:103749156-103749178 TCCTCTGTTGATGGACATTTAGG - Intergenic
1195640277 X:107166664-107166686 TCACCTGTTGATGGACATATAGG - Intronic
1195745691 X:108115636-108115658 TTCCCTGTTGATGGACATTTGGG + Intronic
1195796702 X:108656399-108656421 TCCCCTGTTGATGGACTTTTGGG + Intronic
1196078307 X:111602029-111602051 TCACCTGTTGATGGACATCTGGG + Intergenic
1196186859 X:112753750-112753772 TGCCCTTTTGGTGGACATGTTGG + Intergenic
1196352243 X:114745549-114745571 TCATCTGTTGGTGGACATTTAGG - Intronic
1196387509 X:115174637-115174659 TCATCTGTTGATGGACATACAGG + Intronic
1196497591 X:116339911-116339933 TCCACTGTTGATGGACATCTAGG - Intergenic
1196521188 X:116674205-116674227 TCTCCTGTTGATGGACATTTAGG + Intergenic
1197197804 X:123720658-123720680 TCTTCTGTTGGTGGACATTTAGG - Intronic
1197452176 X:126633001-126633023 TCACCTGTTGATGGACATTTAGG + Intergenic
1198205024 X:134457850-134457872 TCCCCTGTTGATGGACATTTGGG - Intergenic
1198501269 X:137249930-137249952 TCACCTGTTAGTGGACATTCAGG - Intergenic
1198641575 X:138761682-138761704 TCCTCTGGAGGTGGACATATGGG - Intronic
1199035572 X:143046154-143046176 TCATCTGTTGATGGACATATAGG + Intergenic
1200292205 X:154885301-154885323 TCCCCTGCTGCTGGACATGGTGG + Exonic
1200339042 X:155381038-155381060 TCCCCTGCTGCTGGACATGGTGG + Exonic
1200347427 X:155459654-155459676 TCCCCTGCTGCTGGACATGGTGG - Exonic
1200377681 X:155801335-155801357 TCCCATGTTGATGGACATTTAGG + Intergenic