ID: 903864600

View in Genome Browser
Species Human (GRCh38)
Location 1:26389111-26389133
Sequence TTTGCCCCCAGCATGGGGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903864600_903864611 18 Left 903864600 1:26389111-26389133 CCGGACCCCATGCTGGGGGCAAA No data
Right 903864611 1:26389152-26389174 AACAGGGTCCCTGCCCTCAAGGG No data
903864600_903864609 2 Left 903864600 1:26389111-26389133 CCGGACCCCATGCTGGGGGCAAA No data
Right 903864609 1:26389136-26389158 ATATAAAGGAGAGGGAAACAGGG No data
903864600_903864612 19 Left 903864600 1:26389111-26389133 CCGGACCCCATGCTGGGGGCAAA No data
Right 903864612 1:26389153-26389175 ACAGGGTCCCTGCCCTCAAGGGG No data
903864600_903864608 1 Left 903864600 1:26389111-26389133 CCGGACCCCATGCTGGGGGCAAA No data
Right 903864608 1:26389135-26389157 GATATAAAGGAGAGGGAAACAGG No data
903864600_903864610 17 Left 903864600 1:26389111-26389133 CCGGACCCCATGCTGGGGGCAAA No data
Right 903864610 1:26389151-26389173 AAACAGGGTCCCTGCCCTCAAGG No data
903864600_903864606 -7 Left 903864600 1:26389111-26389133 CCGGACCCCATGCTGGGGGCAAA No data
Right 903864606 1:26389127-26389149 GGGCAAAGGATATAAAGGAGAGG No data
903864600_903864607 -6 Left 903864600 1:26389111-26389133 CCGGACCCCATGCTGGGGGCAAA No data
Right 903864607 1:26389128-26389150 GGCAAAGGATATAAAGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903864600 Original CRISPR TTTGCCCCCAGCATGGGGTC CGG (reversed) Intergenic
No off target data available for this crispr