ID: 903864606

View in Genome Browser
Species Human (GRCh38)
Location 1:26389127-26389149
Sequence GGGCAAAGGATATAAAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903864600_903864606 -7 Left 903864600 1:26389111-26389133 CCGGACCCCATGCTGGGGGCAAA No data
Right 903864606 1:26389127-26389149 GGGCAAAGGATATAAAGGAGAGG No data
903864594_903864606 12 Left 903864594 1:26389092-26389114 CCTAAGTCTCAAACAGGGGCCGG No data
Right 903864606 1:26389127-26389149 GGGCAAAGGATATAAAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903864606 Original CRISPR GGGCAAAGGATATAAAGGAG AGG Intergenic
No off target data available for this crispr