ID: 903864609

View in Genome Browser
Species Human (GRCh38)
Location 1:26389136-26389158
Sequence ATATAAAGGAGAGGGAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903864604_903864609 -5 Left 903864604 1:26389118-26389140 CCATGCTGGGGGCAAAGGATATA No data
Right 903864609 1:26389136-26389158 ATATAAAGGAGAGGGAAACAGGG No data
903864603_903864609 -4 Left 903864603 1:26389117-26389139 CCCATGCTGGGGGCAAAGGATAT No data
Right 903864609 1:26389136-26389158 ATATAAAGGAGAGGGAAACAGGG No data
903864600_903864609 2 Left 903864600 1:26389111-26389133 CCGGACCCCATGCTGGGGGCAAA No data
Right 903864609 1:26389136-26389158 ATATAAAGGAGAGGGAAACAGGG No data
903864602_903864609 -3 Left 903864602 1:26389116-26389138 CCCCATGCTGGGGGCAAAGGATA No data
Right 903864609 1:26389136-26389158 ATATAAAGGAGAGGGAAACAGGG No data
903864594_903864609 21 Left 903864594 1:26389092-26389114 CCTAAGTCTCAAACAGGGGCCGG No data
Right 903864609 1:26389136-26389158 ATATAAAGGAGAGGGAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903864609 Original CRISPR ATATAAAGGAGAGGGAAACA GGG Intergenic
No off target data available for this crispr