ID: 903864611

View in Genome Browser
Species Human (GRCh38)
Location 1:26389152-26389174
Sequence AACAGGGTCCCTGCCCTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903864602_903864611 13 Left 903864602 1:26389116-26389138 CCCCATGCTGGGGGCAAAGGATA No data
Right 903864611 1:26389152-26389174 AACAGGGTCCCTGCCCTCAAGGG No data
903864604_903864611 11 Left 903864604 1:26389118-26389140 CCATGCTGGGGGCAAAGGATATA No data
Right 903864611 1:26389152-26389174 AACAGGGTCCCTGCCCTCAAGGG No data
903864600_903864611 18 Left 903864600 1:26389111-26389133 CCGGACCCCATGCTGGGGGCAAA No data
Right 903864611 1:26389152-26389174 AACAGGGTCCCTGCCCTCAAGGG No data
903864603_903864611 12 Left 903864603 1:26389117-26389139 CCCATGCTGGGGGCAAAGGATAT No data
Right 903864611 1:26389152-26389174 AACAGGGTCCCTGCCCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903864611 Original CRISPR AACAGGGTCCCTGCCCTCAA GGG Intergenic
No off target data available for this crispr