ID: 903864761

View in Genome Browser
Species Human (GRCh38)
Location 1:26389918-26389940
Sequence CAGAATGAGGAGGAAGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903864754_903864761 2 Left 903864754 1:26389893-26389915 CCAGTTTTGGAGGGGCATCTAGG No data
Right 903864761 1:26389918-26389940 CAGAATGAGGAGGAAGGGGCAGG No data
903864748_903864761 15 Left 903864748 1:26389880-26389902 CCTGAAGGGCCAGCCAGTTTTGG No data
Right 903864761 1:26389918-26389940 CAGAATGAGGAGGAAGGGGCAGG No data
903864753_903864761 6 Left 903864753 1:26389889-26389911 CCAGCCAGTTTTGGAGGGGCATC No data
Right 903864761 1:26389918-26389940 CAGAATGAGGAGGAAGGGGCAGG No data
903864747_903864761 23 Left 903864747 1:26389872-26389894 CCTCAGGGCCTGAAGGGCCAGCC No data
Right 903864761 1:26389918-26389940 CAGAATGAGGAGGAAGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903864761 Original CRISPR CAGAATGAGGAGGAAGGGGC AGG Intergenic
No off target data available for this crispr