ID: 903867467

View in Genome Browser
Species Human (GRCh38)
Location 1:26410104-26410126
Sequence GGACACTGGGAAGCCCGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 557
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 512}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903867467_903867480 12 Left 903867467 1:26410104-26410126 CCATCCCGGGCTTCCCAGTGTCC 0: 1
1: 0
2: 2
3: 42
4: 512
Right 903867480 1:26410139-26410161 CTATCTAAGCACACGGGGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 51
903867467_903867478 8 Left 903867467 1:26410104-26410126 CCATCCCGGGCTTCCCAGTGTCC 0: 1
1: 0
2: 2
3: 42
4: 512
Right 903867478 1:26410135-26410157 AGGTCTATCTAAGCACACGGGGG 0: 1
1: 0
2: 0
3: 6
4: 38
903867467_903867477 7 Left 903867467 1:26410104-26410126 CCATCCCGGGCTTCCCAGTGTCC 0: 1
1: 0
2: 2
3: 42
4: 512
Right 903867477 1:26410134-26410156 CAGGTCTATCTAAGCACACGGGG 0: 1
1: 0
2: 0
3: 4
4: 163
903867467_903867476 6 Left 903867467 1:26410104-26410126 CCATCCCGGGCTTCCCAGTGTCC 0: 1
1: 0
2: 2
3: 42
4: 512
Right 903867476 1:26410133-26410155 CCAGGTCTATCTAAGCACACGGG 0: 1
1: 0
2: 1
3: 2
4: 74
903867467_903867484 24 Left 903867467 1:26410104-26410126 CCATCCCGGGCTTCCCAGTGTCC 0: 1
1: 0
2: 2
3: 42
4: 512
Right 903867484 1:26410151-26410173 ACGGGGGTGGGGGGTGAGAGCGG 0: 1
1: 1
2: 15
3: 186
4: 1292
903867467_903867483 15 Left 903867467 1:26410104-26410126 CCATCCCGGGCTTCCCAGTGTCC 0: 1
1: 0
2: 2
3: 42
4: 512
Right 903867483 1:26410142-26410164 TCTAAGCACACGGGGGTGGGGGG 0: 1
1: 0
2: 1
3: 14
4: 132
903867467_903867474 5 Left 903867467 1:26410104-26410126 CCATCCCGGGCTTCCCAGTGTCC 0: 1
1: 0
2: 2
3: 42
4: 512
Right 903867474 1:26410132-26410154 TCCAGGTCTATCTAAGCACACGG 0: 1
1: 0
2: 1
3: 7
4: 91
903867467_903867479 11 Left 903867467 1:26410104-26410126 CCATCCCGGGCTTCCCAGTGTCC 0: 1
1: 0
2: 2
3: 42
4: 512
Right 903867479 1:26410138-26410160 TCTATCTAAGCACACGGGGGTGG 0: 1
1: 0
2: 0
3: 3
4: 40
903867467_903867481 13 Left 903867467 1:26410104-26410126 CCATCCCGGGCTTCCCAGTGTCC 0: 1
1: 0
2: 2
3: 42
4: 512
Right 903867481 1:26410140-26410162 TATCTAAGCACACGGGGGTGGGG 0: 1
1: 0
2: 0
3: 6
4: 74
903867467_903867482 14 Left 903867467 1:26410104-26410126 CCATCCCGGGCTTCCCAGTGTCC 0: 1
1: 0
2: 2
3: 42
4: 512
Right 903867482 1:26410141-26410163 ATCTAAGCACACGGGGGTGGGGG 0: 1
1: 0
2: 1
3: 8
4: 135
903867467_903867485 25 Left 903867467 1:26410104-26410126 CCATCCCGGGCTTCCCAGTGTCC 0: 1
1: 0
2: 2
3: 42
4: 512
Right 903867485 1:26410152-26410174 CGGGGGTGGGGGGTGAGAGCGGG 0: 1
1: 1
2: 16
3: 219
4: 1864

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903867467 Original CRISPR GGACACTGGGAAGCCCGGGA TGG (reversed) Intergenic
900289816 1:1919095-1919117 GGACAAGGGTGAGCCCGGGAGGG + Intronic
900352056 1:2239809-2239831 GCACACTGGGACGCCCCGGAGGG - Intronic
900374674 1:2348024-2348046 GGCCACGGGGAAGCCCAGGCTGG - Intronic
900639404 1:3681600-3681622 GGCCACAGGGAAGCCTGGCAAGG - Intronic
900971615 1:5995143-5995165 GGACAGTGGGCAGCTCGGGGCGG + Intronic
901081588 1:6586913-6586935 GGGCACTGGAAAGGCAGGGAAGG - Intronic
901136185 1:6997903-6997925 GCACACTGGGAGGCCAAGGAGGG - Intronic
901291521 1:8127957-8127979 GCACATTGGGAAGCCAAGGAAGG - Intergenic
902408551 1:16199707-16199729 GAGGACTGGGAAGCCCTGGAGGG - Intronic
903205940 1:21782762-21782784 GGACCTTGGAAAGCCCGGGCGGG - Intronic
903466266 1:23554551-23554573 CCACACTCGGAAGGCCGGGAAGG + Intergenic
903867467 1:26410104-26410126 GGACACTGGGAAGCCCGGGATGG - Intergenic
904369101 1:30037397-30037419 GGAAACTGAGAAGCCCTGGGGGG - Intergenic
904376303 1:30084562-30084584 GCACACTGGGAAGTCGGGGCAGG - Intergenic
904420636 1:30388914-30388936 GGAAACTGGGAAGAGTGGGAAGG - Intergenic
905199702 1:36307392-36307414 AGATACGGGGAAGCGCGGGAGGG + Intronic
905249766 1:36640438-36640460 AGACACTGGGGAGCCAGTGAAGG - Intergenic
905662635 1:39739091-39739113 GGACAGTGGGAAACCTTGGAAGG - Intronic
905662748 1:39739818-39739840 GGACAGTGGGAAGCCTTTGAAGG + Intronic
906775662 1:48527347-48527369 GCACTTTGGGAAGCCCGGGGTGG + Intergenic
907165416 1:52406236-52406258 GCACTCTGGGAGGCCCGGGGGGG - Intronic
907284559 1:53371405-53371427 GCACAGTGGGAAGCGAGGGAGGG + Intergenic
907462817 1:54615379-54615401 GGACAATGGGGAGCCACGGAGGG + Intronic
908396331 1:63728796-63728818 AGACACTGGGAACCCCAGGCTGG + Intergenic
908545057 1:65154017-65154039 GGGCACTGGAAAGCCAAGGAAGG + Intronic
909373056 1:74909149-74909171 GGACACTGGGAACCTGGGGTTGG - Intergenic
910435308 1:87200166-87200188 GGACTCTGGGATGCCTGGAATGG + Intergenic
910995013 1:93095282-93095304 GGACACTTGGAAGCCAGGTGAGG - Intronic
912210970 1:107556628-107556650 GGGCACTGGGAAGCCTTGGCAGG + Intergenic
912795154 1:112688898-112688920 GGAGACTGGGAAGTGAGGGAAGG - Intronic
915474645 1:156146534-156146556 GGGCTCTGGGAAGCCAGGGAGGG + Intergenic
915611274 1:156995237-156995259 GGACAGTGGGAAACCACGGAAGG - Intronic
915892025 1:159781492-159781514 GGAGACTGGGAAGCCAGTGCGGG + Intronic
917864984 1:179185996-179186018 GCACTCTGGGAGGCCCGGGCGGG + Intronic
918127250 1:181595541-181595563 GGAGAGTGGGAGACCCGGGAAGG - Intronic
918400063 1:184154174-184154196 GGACCCTGGGAAGCACGAGGAGG - Intergenic
918455719 1:184711344-184711366 GGACACTGGGAGGCCAAGGCAGG - Intronic
920444906 1:206008772-206008794 GCACTCTGGGAAGCCAAGGAAGG - Intergenic
920541243 1:206779652-206779674 GGAAAGTGGGAAGCCATGGAAGG - Intergenic
920670993 1:208003472-208003494 GGACAGAGGGAAGCCAGGGTGGG - Intergenic
924458496 1:244237368-244237390 GCACACTGGGAAGCCAGGGAGGG - Intergenic
924609976 1:245565534-245565556 GCACTTTGGGAGGCCCGGGAGGG - Intronic
924735804 1:246754401-246754423 GGAGAATGGGAATCCCGGGCGGG + Intronic
1062979539 10:1710541-1710563 GGACAGTGGGAAGGAGGGGAAGG - Intronic
1065134364 10:22653518-22653540 GCACACTGGGAAGGCAGGGGAGG + Intronic
1066446671 10:35490510-35490532 GGACACAGGGAAGGGCGGGAAGG - Intronic
1066640965 10:37553703-37553725 GGACACAGGCAATCCCGAGAAGG + Intergenic
1068127204 10:52855072-52855094 GCACTTTGGGAAGCCCGGGCAGG - Intergenic
1069921426 10:71818025-71818047 GGTCACAGGGAAGCCCGGTGAGG + Intronic
1070968181 10:80542801-80542823 GGAGAGTGGGAAGAGCGGGAGGG - Intronic
1071289343 10:84177204-84177226 GGACACTGGGAGGCCTGTGGCGG + Intronic
1071437934 10:85664105-85664127 AGGCACTGAGAGGCCCGGGAGGG + Intronic
1071506043 10:86232181-86232203 GAAAACTGGGAGGCCAGGGAGGG + Intronic
1071546951 10:86536434-86536456 GGACACTGGCCCGGCCGGGAAGG - Intergenic
1071572881 10:86707755-86707777 GGTTAATGTGAAGCCCGGGATGG - Intronic
1071619896 10:87109543-87109565 GCACTCTGGGAGGCCGGGGAGGG - Intronic
1072540873 10:96397114-96397136 GGACAGTGGGCTGCCTGGGAAGG + Intronic
1073070737 10:100791691-100791713 GCAGCCTGGGAAGCCTGGGATGG + Intronic
1073147834 10:101292164-101292186 GGAACGTGGGGAGCCCGGGAGGG - Intergenic
1073210990 10:101802425-101802447 GCACTTTGGGAAGCCCAGGAGGG + Intronic
1073372236 10:103000823-103000845 GCACTCTGGGAAGCCAAGGAGGG - Intronic
1073512928 10:104053616-104053638 TTACACAGGGAAGCCAGGGAAGG - Intronic
1074355604 10:112780830-112780852 GAACACTGGGGTGCCCGGGGAGG - Intronic
1075768859 10:124916972-124916994 GGAGACTGGGGAGCCCCGGGGGG - Intergenic
1075785438 10:125046288-125046310 GCACACTGGGAGGCCAAGGAGGG + Intronic
1076035487 10:127196059-127196081 GGACCCTGGCAAGCCTGGGGCGG + Exonic
1076683135 10:132185618-132185640 GGGCGCTGGGAAGGCCGGGCGGG - Intergenic
1077011464 11:381066-381088 GGATACTGGGAAGACCGGGAAGG - Intronic
1077506473 11:2931997-2932019 GGACACTGTGAAGACCTGGGGGG + Intergenic
1077544717 11:3164441-3164463 GGTGCCTGGGAAGCCCAGGACGG + Intronic
1079786555 11:24680439-24680461 GGACACTGAGAAGTCTGGGTTGG - Intronic
1080503967 11:32893816-32893838 AGACACTGGGGGGCCCGGGAGGG + Intronic
1081732405 11:45380815-45380837 CAACACTGGGAAGCCTGGGTGGG - Intergenic
1082010814 11:47448672-47448694 GGACACAGGGGAGCCCGAGGAGG + Intronic
1082641499 11:55666566-55666588 AGACAATGGGAAGCTAGGGAAGG - Intergenic
1083295430 11:61712758-61712780 GGCCACTGGGAAGAAGGGGAAGG + Intronic
1083388810 11:62333243-62333265 GGCCACTGGGCAGCCCGGCTCGG - Intergenic
1083452401 11:62754579-62754601 GGACTCTGGGAGGCCGAGGAGGG + Intergenic
1083744967 11:64730260-64730282 GGACACTGGGAACAGTGGGATGG - Intronic
1083882153 11:65554022-65554044 GGCAACTGGCAAACCCGGGAAGG - Intronic
1083901079 11:65643852-65643874 GGACACTGGGGAGCCATGGAGGG + Intronic
1084814481 11:71638282-71638304 GGAGACTGGGGAGGCCGGGGAGG - Intergenic
1085023347 11:73222475-73222497 GGACACTGAGGAGCCATGGAAGG - Intronic
1085159255 11:74325958-74325980 GAAGCCTGGGAAGCCTGGGAAGG - Intergenic
1086337025 11:85810700-85810722 GGAAGCTGGGATGCCCGGGTAGG - Intronic
1087095413 11:94313193-94313215 GGACAATGGGAAGTCCTGGGGGG + Intergenic
1087819951 11:102700618-102700640 GGTCAATGGGAAGCCCTGAAAGG + Intronic
1089311651 11:117562006-117562028 GGACAGTGGGAAGCAGGGGCAGG + Intronic
1089367732 11:117931372-117931394 GGGCACTGGGAAGGCTGGGAAGG + Intergenic
1089423862 11:118353469-118353491 GGTCACTGGGTAGCAGGGGATGG - Exonic
1089604997 11:119636565-119636587 GAACACAGGGAAGCCTGGGCAGG - Intronic
1089758718 11:120707187-120707209 GAACCCTGGGAAGCCATGGAAGG + Intronic
1089808489 11:121113079-121113101 GGACACTAGGACGGCCTGGAAGG - Exonic
1090059890 11:123455371-123455393 GCACACTGGGAGGCCGAGGAAGG - Intergenic
1090235141 11:125141473-125141495 GGAGGCTGGGAAGCCCGGCCGGG - Intergenic
1090467221 11:126945253-126945275 AGACACTGGGATGCCTGAGAAGG - Intronic
1091178020 11:133579314-133579336 GGAAGCTGGGAAGGCCGGGAGGG + Intergenic
1091345126 11:134847273-134847295 AAGCACTGGGAAGCCAGGGAGGG + Intergenic
1091398292 12:167631-167653 GCACTCTGGGAAGCTCAGGAGGG + Intronic
1092429604 12:8397885-8397907 GGAGACTGGGGAGGCCGGGGTGG + Intergenic
1092732204 12:11545542-11545564 GGGCACTGGGAAGCCTTGGATGG - Intergenic
1093997363 12:25656208-25656230 GTACTCTGGGAGGCCCGGGTGGG + Intergenic
1094084753 12:26577081-26577103 GGAGGCTGGGAAGTCCAGGATGG - Intronic
1094526527 12:31234685-31234707 GGACTCTGAGATGCCCGGGAAGG + Intergenic
1094604936 12:31941864-31941886 GTATACTGGGAAACCGGGGAAGG - Intergenic
1096460616 12:51819917-51819939 GGACGCTGGAGAGCCAGGGATGG + Intergenic
1096879803 12:54658458-54658480 GGGCACTGGGAGACCTGGGAGGG - Intergenic
1096976611 12:55702961-55702983 GGACACTGGGAATTAGGGGAGGG + Intronic
1097042010 12:56161419-56161441 GGACTCTGGGGAGACTGGGAAGG - Exonic
1097124110 12:56759942-56759964 AGACAATGGGAAGCCATGGAAGG + Intronic
1097223296 12:57462482-57462504 GGAGACTGGAAAACCCGGGATGG + Intronic
1097299096 12:57998565-57998587 GCACTCTTGGAAGCCCAGGAAGG - Intergenic
1098559615 12:71857194-71857216 GGACACTGGGAGGCCAAGGCAGG - Intronic
1098607371 12:72408003-72408025 GGAGGCTGGGAAGCCCAAGATGG + Intronic
1101332227 12:103766326-103766348 GGACACTGTGAGGGCCTGGACGG + Exonic
1101758615 12:107641077-107641099 GGACACTGGGAACCCAGAAATGG + Intronic
1101869571 12:108553859-108553881 GGATACTGGGAAGCCATGGAAGG - Intronic
1101928826 12:108995652-108995674 GTACTTTGGGAAGCCCAGGAGGG + Intronic
1102458137 12:113083787-113083809 GGACAGAAGGAAGCCAGGGAAGG - Intronic
1102650814 12:114441077-114441099 GGGCACTGGGAAACCCTGGTAGG - Intergenic
1103014467 12:117482962-117482984 GGACACTGGGAAACTGGGAAGGG + Intronic
1103536486 12:121637243-121637265 GCACACTGGGAAGCTGAGGAGGG - Intronic
1103723510 12:122986867-122986889 GGAGACAGGGAGGCCCAGGAGGG - Intronic
1103828958 12:123763258-123763280 GGACACTGAGAGGGCAGGGAGGG + Intronic
1104918804 12:132279898-132279920 GGACACTGGGCATCCAGGCAGGG - Intronic
1106682865 13:32026010-32026032 GCACAATGGGAAGCCCCTGAAGG - Intergenic
1107241691 13:38242852-38242874 GCACTCTGGGAAGCCCAGGTGGG + Intergenic
1107502468 13:40994394-40994416 GGACTCTGGGAAGCCCAAGAGGG + Intronic
1109108832 13:58290227-58290249 GCACTTTGGGAGGCCCGGGAGGG - Intergenic
1109975355 13:69825213-69825235 GGCTACTGAGAAGCCAGGGATGG + Intronic
1110201100 13:72851466-72851488 GGACACTGACAAGCACGGAAGGG + Intronic
1110318662 13:74135739-74135761 GGGCTGTGGGAAGGCCGGGAAGG + Intergenic
1110775308 13:79402486-79402508 GGATAGTGGGAAGCCAGTGAAGG - Intronic
1111238483 13:85441591-85441613 GCACTCTGGGAAGCCGAGGAGGG + Intergenic
1112294844 13:98177398-98177420 GGACACTGGGAGGCCGAGGTGGG + Intronic
1112478514 13:99753268-99753290 GAACACTGGGAAGCCATGGAAGG + Intronic
1113126146 13:106981719-106981741 GGAGACAGGGAAGCCTGGGAAGG - Intergenic
1113566605 13:111323154-111323176 GGACATGGGGAAGCCCAGCAGGG - Intronic
1113711281 13:112466926-112466948 AGACCCCGGGGAGCCCGGGATGG - Intergenic
1114739623 14:25081974-25081996 GGACAATGGGAAGCCATGGGAGG - Intergenic
1116749378 14:48863877-48863899 GGACACTGGGGACCACTGGAGGG + Intergenic
1117733974 14:58751127-58751149 GGGCACTGGTAAGCATGGGAGGG + Intergenic
1118651616 14:67901892-67901914 GGAGACTGGGAAGGGTGGGAGGG + Intronic
1120420717 14:84282662-84282684 GGACACTGGGAAGCAAAAGAAGG - Intergenic
1120877220 14:89386124-89386146 GCACACGGGGGAGCTCGGGAGGG + Intronic
1121115083 14:91337846-91337868 GGGCCCTGGGAAGCCCAGGCAGG + Intronic
1122317392 14:100834333-100834355 GGACATTGGAAAGCCCGGAGAGG + Intergenic
1122552989 14:102560227-102560249 GGACAATGGGGAGCCAGGGTTGG - Intergenic
1122981408 14:105193818-105193840 GGACATGGGGAGGCCAGGGAGGG + Intergenic
1122995626 14:105262275-105262297 GGTCTCTGGGAAGTTCGGGAGGG - Intronic
1123038402 14:105480573-105480595 GGACCCTGGCAAGCGCAGGAGGG + Intergenic
1202840208 14_GL000009v2_random:114415-114437 GGGCACTGGCAAGCACAGGAGGG + Intergenic
1202909589 14_GL000194v1_random:104612-104634 GGGCACTGGCAAGCACAGGAGGG + Intergenic
1123791446 15:23724464-23724486 GGACAGTGGGAAGCCCCTGAGGG - Intergenic
1123948633 15:25250965-25250987 GGACACTGGGCTCCCCGGAATGG + Intergenic
1124369647 15:29096797-29096819 GGTCACTGGGGAGCCCAGGGTGG - Intronic
1125192138 15:37005803-37005825 GGACTTTGGGAAGCCAAGGAGGG - Intronic
1125460469 15:39901825-39901847 GCACTCTGGGAAGCCAAGGAAGG + Intronic
1126142423 15:45449086-45449108 GGAAACTGGGAAGTCAAGGAAGG - Intergenic
1126400457 15:48263803-48263825 GGACACTGGGAAGGCTGAGGTGG - Intronic
1127956557 15:63858913-63858935 GCACTCTGGGAGGCCCAGGAGGG - Intergenic
1128277317 15:66364408-66364430 GAACACTGGGAAGCCGAGGCGGG - Intronic
1128372874 15:67053379-67053401 GGACTTTGGGAGGCCCAGGAGGG - Intergenic
1128836770 15:70815134-70815156 GGACAACTGGAAGCCAGGGAGGG + Intergenic
1128906731 15:71474071-71474093 GGACACTGGGATTCCCTGAATGG - Intronic
1129380532 15:75162537-75162559 GGACACTGGGAGGCCGAGGCAGG + Intergenic
1129694936 15:77735143-77735165 GTACACAGGGAAGCCCAGGCTGG - Intronic
1129814628 15:78540719-78540741 TGGCACTGGGAAGCCCCCGACGG - Intronic
1129875173 15:78970463-78970485 GGACCATGGGAAGCCCTGAAAGG - Intronic
1130013498 15:80170345-80170367 AGACAGTGGGAAGCCCTGGTTGG + Intronic
1130612235 15:85371971-85371993 GGACTCTGGGAAGCCGAGGCGGG - Intergenic
1132696951 16:1206303-1206325 AGACACTGGGCGGGCCGGGAGGG - Intronic
1132826355 16:1907506-1907528 CCACACTGAGGAGCCCGGGAGGG + Intergenic
1132854664 16:2039392-2039414 GGACACTGGGGACCCAGGCAGGG - Intergenic
1133249136 16:4468767-4468789 AGACACTGGGAACCACGGGAGGG + Intronic
1133369704 16:5238633-5238655 GGAGACTGGGGAGGCCGGGGAGG - Intergenic
1133591233 16:7246308-7246330 GGAGACAGGGAATCCAGGGAGGG - Intronic
1133920445 16:10148021-10148043 GGGCAGTGGGAAGCTCAGGAAGG - Intronic
1134507599 16:14820906-14820928 GAACACTGCGAAGCTCTGGACGG + Intronic
1134695297 16:16219668-16219690 GAACACTGCGAAGCTCTGGACGG + Exonic
1134976535 16:18575018-18575040 GAACACTGCGAAGCTCTGGACGG - Intergenic
1135187592 16:20328623-20328645 GGCCACTGGGGAGACTGGGATGG - Intergenic
1136009218 16:27351993-27352015 AGACACTAGGAAGCCCATGAAGG + Intronic
1136145424 16:28313659-28313681 GGAGGCTGGGAAGACAGGGATGG + Intronic
1136347701 16:29686830-29686852 GCACTCTGGGAAGCCAGGGTGGG - Intronic
1138311468 16:56027119-56027141 GGCCAATGGGAAGCCCCGGTGGG - Intergenic
1139111894 16:63902195-63902217 GGACAATAGGAAGCCCTGGCAGG - Intergenic
1139150921 16:64381215-64381237 GGACACTGAGGAGTCCAGGAGGG + Intergenic
1141469853 16:84230843-84230865 GAACAGTGGGAAGGCCGGCAGGG + Intronic
1141526786 16:84617166-84617188 GGACAGTGGGAAGAGCTGGATGG + Intronic
1141846927 16:86616751-86616773 GCACACTGGGAAGCCGAGGAGGG - Intergenic
1143028051 17:3952504-3952526 GGACACTGGGATCCACGGAAGGG + Intronic
1143375724 17:6465987-6466009 GGGCAGTGGGGAGCCCGGGAGGG - Intronic
1143936732 17:10494005-10494027 AGGTACTGGGAAGCCAGGGAGGG - Intronic
1144484375 17:15652705-15652727 GCACATTGGGAAGCCCAGGCAGG - Intronic
1144784576 17:17824459-17824481 GGGCCCTGGGAAGCCAGGAAGGG + Intronic
1146246419 17:31287783-31287805 GCACACTGGGAAGCCGAGGTGGG - Intronic
1146933380 17:36793776-36793798 GGACATTGGGAGGCCAGGGTAGG - Intergenic
1147343145 17:39767381-39767403 GGTCACAGGGAAGGCAGGGATGG + Intronic
1147914777 17:43879743-43879765 GGACATTGGGCAGGCTGGGAAGG + Intronic
1149336787 17:55643834-55643856 GGCCAATGGGAAGCCCTGGAAGG - Intergenic
1149927649 17:60717460-60717482 GCACTTTGGGAGGCCCGGGAAGG - Intronic
1150331354 17:64296977-64296999 GGGCAATGGGAAGCCAGTGAAGG - Intergenic
1150532286 17:65996574-65996596 GGACAGTGGTGAGCCCGTGATGG - Intronic
1150622069 17:66814972-66814994 GGGCACTGGGCAGCCCGGGGAGG + Intergenic
1151600029 17:75100406-75100428 TGGCAGTGGGAAGCCCAGGACGG - Exonic
1152022009 17:77784877-77784899 GCACTCTGGGAAGCCCAGGTGGG - Intergenic
1152374778 17:79913464-79913486 GGGCACAGGGAAGCCCCGTAGGG - Intergenic
1152387232 17:79981888-79981910 GCGCACAGGGAAGCCCCGGAGGG - Intronic
1152518252 17:80838682-80838704 AGACACGGGGAGGCCAGGGATGG + Intronic
1152559728 17:81072002-81072024 AGAGACTGGGAAGGCCGGGGAGG - Intronic
1152721960 17:81927664-81927686 GCGCACTGGGAAGGCCGGGCCGG + Exonic
1153006769 18:504182-504204 GGGCTTTGGGAAGCCAGGGAAGG + Intergenic
1153580878 18:6572118-6572140 GCACCCTGGGAAGCCGAGGAGGG + Intronic
1154161850 18:11986385-11986407 GGGCACTGGAAAGACAGGGAAGG - Intronic
1157491210 18:48125019-48125041 GGCCACTGGGAAGCAGGGGAGGG + Intronic
1157555994 18:48613201-48613223 GGATACTGAGAAGGCTGGGATGG + Intronic
1158457527 18:57621504-57621526 GGACTCGGGGAAGCCCGGCCTGG + Intronic
1158457793 18:57622844-57622866 GGACTCGGGGAAGCCCGGCCTGG - Intergenic
1158669479 18:59462022-59462044 TGACACTTGGCAGCCGGGGATGG - Intronic
1159586779 18:70289356-70289378 GGAAACCGGGAAGCCGGGGCCGG + Intronic
1159638513 18:70835912-70835934 GGCCATTGGCAAGCCCAGGAGGG + Intergenic
1159766947 18:72502683-72502705 GGACACTGAGGATCCCGAGAGGG - Intergenic
1160276947 18:77445694-77445716 GGACACTGGGGACCCGGGAAAGG - Intergenic
1160704733 19:524641-524663 GGCCGCTGTGGAGCCCGGGAAGG - Intergenic
1160778140 19:866126-866148 GGACCTTGGGAAGCCGGGGGCGG + Intergenic
1160905747 19:1450994-1451016 GGGCACTGGGGAGCCATGGAAGG + Intronic
1161216890 19:3099125-3099147 GGACCCTGGGCAGCACGGGGAGG + Intronic
1161894843 19:7072706-7072728 GGGGACTGGGAAGCCTTGGAAGG - Intronic
1162441188 19:10693099-10693121 GGACAGTGGGGAGCCATGGATGG + Intergenic
1163127834 19:15253864-15253886 TGACACTGCGGAGCCCTGGATGG - Intronic
1163176757 19:15569595-15569617 GGACAATGGGGAGCCCTGGAGGG + Intergenic
1163177839 19:15576921-15576943 GGGCACTGGGGAGCCATGGAAGG + Intergenic
1163187656 19:15650269-15650291 GGGCACTGGGGAGCCATGGAAGG + Intronic
1163544309 19:17932021-17932043 GGACAATGGGAACCCAGGGGAGG + Intergenic
1164185413 19:22863320-22863342 GCACACTGGGAAGCCGAGGCAGG + Intergenic
1164272937 19:23689279-23689301 GCACATTGGGAAGCCAAGGAGGG + Intergenic
1165730744 19:38143168-38143190 GGGCACTGGGGAGCCATGGAGGG - Intronic
1165944364 19:39432776-39432798 GCACTTTGGGAGGCCCGGGAAGG + Intergenic
1165993938 19:39831820-39831842 GGGCCCTGGGAAGCCAGAGAAGG + Exonic
1166145549 19:40832292-40832314 GCACACTGGGAGGCCAAGGAGGG + Intronic
1166671166 19:44710382-44710404 GGCCACTGGGTGGCCCGGGGTGG + Intronic
1166714394 19:44957345-44957367 GGGGACTGGGAACCCCAGGAGGG + Intronic
1167082357 19:47285629-47285651 GGAAACTGGGAAGCCAAGGCAGG - Intergenic
1167100076 19:47399272-47399294 GTACACTGGGAAGTTGGGGAGGG - Intergenic
1167212033 19:48139462-48139484 GGACACTGGGGAGCCATGGAAGG - Intronic
1167485005 19:49757617-49757639 GGACAATGGGAACCCTGTGAAGG - Intronic
1167711394 19:51113499-51113521 GGGCACTGGGGAGCCATGGAAGG - Intergenic
1167744582 19:51342986-51343008 GGGCACTGGGGAGCCAGGGGAGG - Intergenic
926975745 2:18515163-18515185 AGACACAGTGAAGCCTGGGAAGG - Intergenic
927469817 2:23364903-23364925 GGACTCTGGGAGGCCCAGGGAGG + Intergenic
927555414 2:24027694-24027716 GGACACTGGGAGGCCAAGGTGGG + Intronic
927798130 2:26069951-26069973 GCACTTTGGGAAGCCGGGGAGGG - Intronic
927848615 2:26485030-26485052 AGGCACTGGGAAGCCCCAGAGGG - Intronic
927865563 2:26585228-26585250 GCACCCTGGGGAGCCAGGGACGG + Intronic
928186379 2:29115127-29115149 GGACTCTGGGGAGCCCAAGACGG + Intronic
929128323 2:38541121-38541143 GCACACTGGCATGCCAGGGATGG - Intergenic
929191758 2:39146783-39146805 GGACTTTGGGAAGCCAGGGTGGG + Intergenic
929259325 2:39847085-39847107 GAACAGTGGGATGCCTGGGAAGG + Intergenic
929279875 2:40066092-40066114 AGACACTGGGGAACCCTGGAGGG - Intergenic
929675293 2:43920764-43920786 GGACTGTGGGAAGACAGGGAAGG + Intronic
929935925 2:46294711-46294733 GCACTCTGGGAAGCCCAGGTGGG + Intronic
930088295 2:47513977-47513999 GGACACTGGCAAGCCAGTGGAGG - Intronic
930231544 2:48848626-48848648 GGACCTTGGGAAGCCTTGGAAGG + Intergenic
931708366 2:64966694-64966716 GGACTCTGGGAGGCCAGGGCAGG + Intergenic
932735616 2:74252152-74252174 GGTCACTGGGAGGCCTGGGGTGG + Intronic
933478477 2:82822427-82822449 GGACTCTGGGAGGCCCAGGCAGG + Intergenic
934081775 2:88474696-88474718 GCACTCTGGGAAGCCAAGGAAGG - Intergenic
934668654 2:96192671-96192693 CAACACTGGGAAGCCAAGGAAGG + Intronic
934713366 2:96529583-96529605 GGGAACTGCCAAGCCCGGGAAGG + Intergenic
935216986 2:100982385-100982407 GGACAGAGGCCAGCCCGGGAAGG - Intronic
935408915 2:102738346-102738368 GGACTTTGGGAAGCCAGGGTGGG + Intronic
938263232 2:129909795-129909817 GAACACTGTGGACCCCGGGAAGG - Intergenic
938660563 2:133482462-133482484 GGACACTGGGAGGCCAAGGCAGG - Intronic
940694329 2:156959683-156959705 GGACACTGAGGAGCACAGGAGGG - Intergenic
941186340 2:162325307-162325329 AGAGACAGGGAAGCCCAGGAAGG - Intronic
941727659 2:168881217-168881239 GGACATGGGGAAGGCAGGGAAGG - Intronic
942151185 2:173076718-173076740 GGAAAGGGGGAAGCCCGAGAGGG - Intronic
942247837 2:174023938-174023960 GGCCAGTGGGAGGCCAGGGAGGG + Intergenic
943614118 2:190072239-190072261 AGACACTGGGGAGCACTGGAGGG + Intronic
944069933 2:195657342-195657364 GGAGACTGCGAGTCCCGGGACGG + Intronic
944866421 2:203866776-203866798 GGACAATGGGAAACCATGGACGG + Intergenic
945710037 2:213284288-213284310 GGTAACTGGGAGGCGCGGGAGGG + Intergenic
947153570 2:227138047-227138069 GGACTTTGGGAAGCCAAGGAGGG + Intronic
947286681 2:228524557-228524579 GGATACTGGGAAGGGTGGGAGGG + Intergenic
947525125 2:230872934-230872956 GGACGATGGGGAGCCCGGGAAGG - Intronic
948288249 2:236803931-236803953 GGGCAATGGGATGCCCGTGAGGG - Intergenic
948737235 2:240016992-240017014 GGACACTGGGCAGGCCTGGGTGG - Intronic
948793802 2:240392133-240392155 GGACAGTGGGAAGAGAGGGAGGG - Intergenic
1168809853 20:698033-698055 GGGCACTGGGAGGCTCTGGAGGG + Intergenic
1169398230 20:5254826-5254848 GCACTTTGGGAAGCCCAGGAGGG + Intergenic
1171284766 20:23928137-23928159 GGACACTCGGAAGCCATGGGAGG - Intergenic
1171304372 20:24092578-24092600 GCACACTGGGAAGCCTTGGAGGG - Intergenic
1171456205 20:25273957-25273979 GCACTCTGGGAAGCCAGGGTGGG - Intronic
1172044394 20:32070225-32070247 GGACAGTGGGGAGCAGGGGAGGG - Intronic
1172221076 20:33275628-33275650 GGACACTGTGAGCCCCAGGAGGG + Intronic
1172755035 20:37277671-37277693 GCACTTTGGGAAGCCCGGGTGGG + Intergenic
1173008103 20:39156626-39156648 GGACACTGGGAACCCAAGGAGGG + Intergenic
1173583841 20:44166871-44166893 GGACAGTGGGAAGCCCTGCAGGG - Intronic
1174045640 20:47730692-47730714 GCACTCTGGGAAGCCGAGGAGGG - Intronic
1174200318 20:48802463-48802485 GGACACTGAGAAGCCAGCCATGG - Intronic
1174232827 20:49060527-49060549 GCACTTTGGGAAGCCCAGGAGGG + Intronic
1174248581 20:49200786-49200808 GCACTTTGGGAAGCCCAGGAGGG + Intergenic
1174295185 20:49540557-49540579 GGGCTCTGGGAGGCCCGAGAAGG + Intronic
1175337744 20:58207056-58207078 GGACACAGGGAAGCCAGGCTAGG + Intergenic
1175960003 20:62631214-62631236 GCACTCTTGGGAGCCCGGGAAGG - Intergenic
1176420866 21:6514141-6514163 GCACATTGGGAAGCCAAGGAAGG + Intergenic
1176628939 21:9119320-9119342 GGGCACTGGCAAGCACAGGAGGG + Intergenic
1177431180 21:20994548-20994570 GGAGCCTGGGAAGCCCAGGCTGG + Intergenic
1178988415 21:37330230-37330252 GCACTCTGGGAGGCCAGGGAAGG + Intergenic
1179036062 21:37759564-37759586 GGACAATGGGAAGCCAGTGATGG - Intronic
1179352922 21:40630543-40630565 GCACACTGGGAGGCCGAGGAGGG - Intronic
1179368673 21:40783357-40783379 GTGCACTTGGAAGCCAGGGATGG + Intronic
1179461102 21:41535959-41535981 GGACACTGTGTAGCCAGGGACGG + Intergenic
1179696357 21:43122460-43122482 GCACATTGGGAAGCCAAGGAAGG + Intergenic
1180867507 22:19127815-19127837 GGACTTTGGGAAGCTGGGGAAGG - Intergenic
1180980336 22:19875400-19875422 GGACTCTGGGCTGCCCTGGATGG + Intergenic
1181280447 22:21716153-21716175 GCACTCTGGGAAGCCGGGGCAGG - Intronic
1181460041 22:23080405-23080427 GGACACTGGGAGGCCCAGCCGGG + Intronic
1181468291 22:23122544-23122566 GGACACTAGGAAGTCTGTGAGGG - Intronic
1182081105 22:27529378-27529400 GGGCACTGGGAAGCCATGGATGG + Intergenic
1182336441 22:29586506-29586528 GCACACTGGGAGGCCCAGGCAGG + Intergenic
1182356099 22:29722814-29722836 GGGAGCTGGGCAGCCCGGGATGG + Intronic
1182475395 22:30574193-30574215 AGGGACTGGGAAGCCCTGGAAGG + Intronic
1182483825 22:30627320-30627342 GGAAACTGGGAGGCCGGGCATGG + Intergenic
1182647259 22:31820356-31820378 GCACACTGGGAAGCCGGGGTGGG - Intronic
1183217763 22:36492174-36492196 GGACAGCGGGAAGACTGGGAGGG + Intronic
1183738094 22:39654910-39654932 GGGCAATGGGGAGCCCGGAAAGG + Intronic
1183791293 22:40072615-40072637 GCACTTTGGGAAGCCCAGGAGGG + Intronic
1184087724 22:42275244-42275266 GGACACTGGGCAGCTCGGGCAGG + Intronic
1184551132 22:45204702-45204724 GGGCACTGGGAGGGCGGGGAGGG - Intronic
1184713713 22:46268336-46268358 GGACGCAGGGAAGCCCGCAAAGG + Intronic
1184723238 22:46328247-46328269 GGGCACTGGGCAGCAGGGGAGGG + Intronic
949198753 3:1345360-1345382 GCACACTGGGAGGCCAGGGTGGG - Intronic
949319324 3:2791283-2791305 GGACAGTGGGAAGCCAAGGCGGG + Intronic
949917050 3:8973263-8973285 GGACTCTGAGTTGCCCGGGAAGG + Intergenic
950080611 3:10219562-10219584 GCACACTGGGAGGCCCAGGCAGG - Intronic
950986020 3:17367610-17367632 GCACTTTGGGAAGCCCGGGCGGG + Intronic
952506478 3:34010998-34011020 GGAATCTGGGAAGCCAGGGCTGG - Intergenic
952835416 3:37597940-37597962 GGAGACTGAGAAGCACGAGAAGG + Intronic
953614680 3:44478905-44478927 GGCCAATGGGAAGCCCTGGCAGG - Intergenic
953871385 3:46630133-46630155 GGCCACTGGGAGGCGCCGGAGGG - Intergenic
953875163 3:46662485-46662507 AGGCACTGGGAAGCCATGGAGGG + Intergenic
954036551 3:47853918-47853940 GGACACTGTGGAGGCCTGGAGGG + Intronic
954717674 3:52534371-52534393 TGGCACCGGGAAGCGCGGGAAGG - Intronic
955189425 3:56746483-56746505 GCACATTGGGAAGCCGGGGCAGG + Intronic
955281062 3:57595700-57595722 GCACTCTGGGAAGCCTGGGTGGG + Intronic
955633402 3:60999841-60999863 GGAGACTGGGAAGCCCATCAAGG + Intronic
956000298 3:64722905-64722927 GTGCAATGGGAAGCCTGGGATGG + Intergenic
956902480 3:73730869-73730891 GGAGATTGGGAAGGCCAGGAGGG + Intergenic
957388525 3:79530807-79530829 GAACACTGGGAATCCAGGGAAGG - Intronic
958180776 3:90057786-90057808 GGAGACTGGGAAAGTCGGGATGG - Intergenic
958258054 3:91347838-91347860 GCACACTGGGAGGCCCAGGCAGG + Intergenic
960023004 3:112976565-112976587 GGACACTGGGAGGCCGAGGCGGG + Intergenic
960050683 3:113236503-113236525 GGACACTTGGAAGGGTGGGAGGG + Intronic
960403234 3:117229297-117229319 GGACTCTGGGAGGCCGAGGAGGG - Intergenic
961022031 3:123516004-123516026 GCACTCTGGGAAGCCAAGGAGGG - Intronic
961200840 3:125043930-125043952 GCACACTGGGCAGCCCGGCCTGG + Intronic
961247742 3:125471096-125471118 GCACTCTGGGAAGCCAAGGAGGG + Intronic
962959606 3:140298590-140298612 GGAAGCTGTGAAGCCCAGGAGGG + Intronic
963731802 3:148981950-148981972 GCACTCTGGGAAGCCAGGGCGGG + Intergenic
964525029 3:157608734-157608756 GGAGCCTGGGAAGCCAGGCAGGG + Intronic
965299597 3:166993493-166993515 GCACTCTGGGAGGCCAGGGAGGG + Intergenic
965456375 3:168905993-168906015 GGACTTTGGGAGGCCAGGGAAGG - Intergenic
966158407 3:176943148-176943170 GAACTCTGGGAAGCCCAGGCAGG + Intergenic
966847401 3:184141320-184141342 GCACACTGGGAAGCCATGGTGGG + Intronic
966918978 3:184600292-184600314 GGCCCCTGGGAAGCCAGGTATGG + Intronic
967064532 3:185903188-185903210 GCACTTTGGGAAGCCCGGGTAGG - Intergenic
967283571 3:187846341-187846363 GCACTCTGGGAGGCCAGGGAAGG - Intergenic
967885927 3:194333537-194333559 GGACGCTTGGAAGCCGTGGAGGG + Intergenic
967974629 3:195026233-195026255 GGACACTGGGAGGCCGAGGCGGG + Intergenic
967989231 3:195119029-195119051 GCACTCTGGGAAGCCAGGGCGGG + Intronic
968297250 3:197586165-197586187 GCACTCTGGGAGGCCCGGGCAGG - Intergenic
968379477 4:78252-78274 GGACTCTGGGAGGCCCAGGTGGG - Intronic
968690734 4:1988522-1988544 GCCCACTGGGTAGCCCAGGAAGG - Intronic
968698649 4:2044408-2044430 GGTCACTGGGGAGCTCTGGATGG + Intergenic
968978461 4:3834143-3834165 GGACAATGGGGAGCCAGAGAAGG - Intergenic
969016819 4:4108742-4108764 GGAGACTGGGGAGGCCGGGGAGG + Intergenic
969264770 4:6057277-6057299 GGACTCTGTGAATCCCGGAATGG + Intronic
969308403 4:6338572-6338594 GGGCACTGGGGAGCCAAGGAGGG - Intronic
969346740 4:6575060-6575082 CGACCCCGGGAAGCTCGGGAAGG - Intergenic
969525532 4:7702181-7702203 GGACACAGGAAAGCCCAGGAGGG - Intronic
971320357 4:25600523-25600545 GGACACTGGGAATCTCTGGATGG + Intergenic
971454988 4:26835787-26835809 GGACAATGGGAAGCCATTGAAGG - Intergenic
972111477 4:35565867-35565889 GGACTTTGGGAAGCTCAGGAGGG - Intergenic
973752617 4:54037267-54037289 GGAGCCTGGGAAGTCTGGGAAGG + Intronic
973818381 4:54640015-54640037 GCACTCTGGGAGGCCCGGGTGGG + Intergenic
974278530 4:59759424-59759446 GAACACTTGGGAGCCCAGGAAGG - Intergenic
975048987 4:69835888-69835910 GCACACTGGGACGCCAAGGAGGG - Intronic
975443435 4:74437640-74437662 GCATACTGGGAAACCGGGGAAGG - Intergenic
975572654 4:75833934-75833956 GCACTTTGGGAAGCCAGGGAGGG - Intergenic
975986655 4:80206952-80206974 GGAAACCGGAAGGCCCGGGAAGG + Intergenic
976138171 4:81961088-81961110 GGAAACTGGGCAGGCAGGGAAGG + Intronic
976390788 4:84501817-84501839 GCACGCTGGGCAGCACGGGAAGG + Intergenic
977724585 4:100280969-100280991 TGACACTGTGAAGCCCAGGAAGG - Intergenic
979763421 4:124435860-124435882 GTACACTGGGAAGCTGGTGAGGG - Intergenic
981800563 4:148650532-148650554 GGGGACTGGGAAGACAGGGAAGG + Intergenic
984096040 4:175435950-175435972 GCACACTGGGAGGCCAAGGAGGG + Intergenic
984248075 4:177299540-177299562 GAACTTTGGGAAGCCCAGGAGGG - Intergenic
984378857 4:178965061-178965083 GCACACTGGGAGGCCCAGGTGGG - Intergenic
984705662 4:182845396-182845418 GGACAGTGGGAAGCCAGAAAAGG - Intergenic
984818507 4:183859495-183859517 GGGCAGTGGGCAGCCTGGGAAGG + Intronic
984827062 4:183935185-183935207 GGACAGTGGGAAGCCCGCTCAGG + Intronic
985090975 4:186362422-186362444 GGACAGGGGGATGCCAGGGAGGG - Intergenic
986013317 5:3736661-3736683 GGCATCAGGGAAGCCCGGGAGGG + Intergenic
986095544 5:4550370-4550392 GAACAATGGGAAGCCATGGAGGG + Intergenic
986716803 5:10530665-10530687 GGACTCTTGGAAGGCAGGGAAGG - Intergenic
987543579 5:19285211-19285233 GCACACTGGGAGGCCTAGGAGGG + Intergenic
987931709 5:24408923-24408945 GCACACTGGGAAGCCGAGGCAGG + Intergenic
988970812 5:36465607-36465629 GGAGGCTGGGAAGCCTGGGTTGG + Intergenic
989237583 5:39166791-39166813 GGAGACTGGGAAGGGTGGGAGGG + Intronic
989277075 5:39601680-39601702 GGACTTTGGGAGGCCCAGGAGGG - Intergenic
989387314 5:40866566-40866588 GGGTGCTGGGAAGCCCTGGATGG + Intergenic
990049018 5:51471997-51472019 GCACATTGGGAAGCCCAGGCAGG - Intergenic
991380400 5:66016859-66016881 GCACTCTGGGAAGCCGAGGAGGG - Intronic
991588021 5:68219442-68219464 GGACACTGGGACATCCGGGGAGG - Intronic
991631416 5:68660313-68660335 GGACAATAGGAAGCCATGGAAGG - Intergenic
992231943 5:74672254-74672276 GGACACTGGGCTTCCCTGGAGGG - Intronic
995833778 5:116380687-116380709 TGACAGTGGGAACCCAGGGAAGG - Intronic
997439332 5:133898290-133898312 GGACACAGGGAAGCTGTGGAGGG + Intergenic
997456182 5:134019206-134019228 AGACACAGGGAAGGCCGTGAAGG + Intergenic
999379800 5:151112583-151112605 GGACATTGGGAAGCCAAGGTGGG + Intronic
1001630053 5:173168276-173168298 GGAAGCCAGGAAGCCCGGGAAGG - Intergenic
1003147118 6:3517934-3517956 GGAGACAGGGATGCCCGAGATGG - Intergenic
1003234921 6:4287085-4287107 GCACTCTGGTAAACCCGGGAAGG + Intergenic
1004039504 6:11961723-11961745 GGATTCTGGGAAGGCCTGGAGGG - Intergenic
1004273542 6:14215300-14215322 GGACGCTGGGAAACACTGGATGG + Intergenic
1004390478 6:15205459-15205481 GAACACTGGGAAGCCAAGGGGGG - Intergenic
1004746622 6:18515239-18515261 GGAGACTTGGAAGGCTGGGAGGG + Intergenic
1006020455 6:31114815-31114837 GGACACCTGGAAGCTTGGGAAGG - Exonic
1006085912 6:31594881-31594903 GTACTTTGGGAAGCCCAGGAGGG + Intergenic
1006183976 6:32170026-32170048 GGACAATGGGAACCTGGGGAAGG + Exonic
1007214742 6:40228288-40228310 GGACACTGAAGAGCACGGGAGGG + Intergenic
1007739685 6:44002948-44002970 AGACTCTCGGAAGCCCAGGAGGG - Exonic
1008585722 6:52947194-52947216 GAACACTGGGAGGCCCAGGTGGG + Intergenic
1008585744 6:52947348-52947370 GAACACTGGGAGGCCCAGGTGGG + Intergenic
1008997202 6:57672871-57672893 GCACACTGGGAGGCCCAGGCAGG - Intergenic
1009185716 6:60572200-60572222 GCACACTGGGAGGCCCAGGCAGG - Intergenic
1011820355 6:91245722-91245744 GGACATTGGGAAGAGGGGGATGG + Intergenic
1012234635 6:96799043-96799065 ACACACTGGGGAGCTCGGGAAGG + Exonic
1013086829 6:106864225-106864247 GTGCTCTGGGAGGCCCGGGAAGG - Intergenic
1013162823 6:107562263-107562285 GCACTTTGGGAAGCCCAGGAGGG - Intronic
1013693002 6:112667688-112667710 GTACACTTGGGAGCCCAGGAAGG + Intergenic
1014259219 6:119197060-119197082 GAACATTGGGAGGCCGGGGAGGG + Intronic
1014944406 6:127479412-127479434 TGAGACTGGGAAGCCAGGTAGGG + Intronic
1015613202 6:135048148-135048170 GGACACCGGAAAGCCAGAGAAGG + Intronic
1016007912 6:139108115-139108137 GCACTCTGGGAAGCCCAGGTGGG + Intergenic
1017451349 6:154557339-154557361 GCACTCTGGGAAGCCAGGGCAGG + Intergenic
1017721298 6:157245068-157245090 GCACTCTGGGAGGCCAGGGAGGG + Intergenic
1018799282 6:167210099-167210121 GGACAGTGTAAAGCCCTGGAGGG - Intergenic
1018987532 6:168649119-168649141 GGCCACGGGGAAGGCGGGGAAGG + Intronic
1019599474 7:1874079-1874101 GGCCACCGGGGATCCCGGGACGG + Intronic
1019623328 7:2003052-2003074 GCACACAGGAAAGTCCGGGAAGG + Intronic
1019633140 7:2060563-2060585 GGACACAGGGAAACACTGGAAGG + Intronic
1019664652 7:2245782-2245804 GCACTCTGGGAGGCCCGGGAGGG - Intronic
1019707943 7:2505277-2505299 GGACACTGAGACCCCCGGCAGGG + Intergenic
1019811145 7:3165879-3165901 GCACTCTGGGAAGCCGAGGAGGG + Intronic
1020744694 7:12067147-12067169 GGAGAATGGGAATCCCGGGCAGG - Intergenic
1021852067 7:24818002-24818024 GGACAGTGGGGAGCCCTGGCTGG + Intronic
1024196281 7:47062070-47062092 GCATACTGGGGAGCCAGGGATGG + Intergenic
1026294846 7:69042240-69042262 GGCCAATGGGAAGACCAGGAGGG - Intergenic
1026940184 7:74283264-74283286 GGGCAATGGGGAGCCCTGGAGGG - Intergenic
1027145482 7:75691240-75691262 GCACTCTGGGAGGCCCGGGCAGG + Intronic
1027333376 7:77122561-77122583 GGCCAATGGGAAGCACGGAAGGG + Intronic
1029075297 7:97929542-97929564 GGAGACTGGGGAGGCCGGGGCGG + Intergenic
1029124048 7:98285293-98285315 GGTGACTGTGGAGCCCGGGAGGG + Intronic
1029166643 7:98596050-98596072 GGGCACTGGGAAGCCAGGAAAGG - Intergenic
1029415256 7:100438761-100438783 GCACTTTGGGAAGCCCGGGTGGG + Intergenic
1029419674 7:100466237-100466259 ACACACTGGGAAGCCAGGGGTGG + Intronic
1029782416 7:102748752-102748774 GGCCAATGGGAAGCACGGAAGGG - Intergenic
1033222833 7:139540124-139540146 GGACTGTGGGAAGCCTGGCAGGG - Intronic
1034906112 7:154948297-154948319 GCACTTTGGGAAGCCGGGGAAGG + Intronic
1035142322 7:156775119-156775141 GCACTCTGGGAAGCCCGGGTGGG + Intronic
1036259613 8:7229320-7229342 GGAGACTGGGGAGGCCGGGGCGG + Intergenic
1036307004 8:7610204-7610226 GGAGACTGGGGAGGCCGGGGTGG - Intergenic
1036308060 8:7616332-7616354 GGAGACTGGGGAGGCCGGGGTGG - Intergenic
1036311656 8:7687890-7687912 GGAGACTGGGGAGGCCGGGGCGG + Intergenic
1036357852 8:8058191-8058213 GGAGACTGGGGAGGCCGGGGCGG - Intergenic
1036358916 8:8064333-8064355 GGAGACTGGGGAGGCCGGGGTGG - Intergenic
1036673604 8:10810609-10810631 GGAGACTGGGATCCCCGTGAGGG - Intronic
1036892042 8:12602619-12602641 GGAGACTGGGGAGGCCGGGGTGG + Intergenic
1036893097 8:12608755-12608777 GGAGACTGGGGAGGCCGGGGCGG + Intergenic
1036924176 8:12888173-12888195 GCACACTGGGAGGCCGAGGAAGG - Intergenic
1037597559 8:20367097-20367119 GCACACTGGGAGGCCCAGAAGGG - Intergenic
1037885360 8:22593328-22593350 GCACTCTGGGAAGCCAAGGAGGG + Intronic
1038761046 8:30384525-30384547 AGGCTCTGGGAAGTCCGGGATGG - Exonic
1039240755 8:35553892-35553914 TGACACTGAGAAGCCAAGGACGG + Intronic
1039520309 8:38165100-38165122 GCACACTGGGAAGCCGAGGCGGG + Intronic
1039963051 8:42264400-42264422 GGACATTGGGAAGCCCAGGCAGG - Intergenic
1040848723 8:51875689-51875711 GCACTCTGGGAAGCCAAGGAGGG + Intronic
1041760181 8:61357801-61357823 GCACTTTGGGAAGCCAGGGATGG - Intronic
1041760412 8:61360196-61360218 GGTCTCTGGGAAGACCAGGAAGG - Intronic
1044729478 8:95218582-95218604 GGACTTTGGGAAGCCGAGGAGGG + Intergenic
1045352510 8:101355172-101355194 GGACTCTTGGAATCCAGGGAGGG + Intergenic
1045701085 8:104866842-104866864 GGAGACTGGGAAAACCAGGAGGG - Intronic
1046916392 8:119682363-119682385 GGACAGTGGGAAACCCTGCAGGG - Intergenic
1047498806 8:125427259-125427281 GCCCAGTGGGAGGCCCGGGAGGG - Intergenic
1048240473 8:132736581-132736603 GTACATTGGGAAGCCAAGGAGGG + Intronic
1049122920 8:140756076-140756098 GCACACTGGGAGGCCGGGGCAGG + Intronic
1049130952 8:140840288-140840310 GCACACTGGGAGGCCAGGGTAGG - Intronic
1049140443 8:140949643-140949665 GGGCACTGACAAGCACGGGAGGG + Intronic
1049364649 8:142231296-142231318 ACACACTGTGAAGCCTGGGAAGG - Intronic
1049468091 8:142762551-142762573 GCACACTGGGAGGCCGAGGAGGG - Intergenic
1049585665 8:143431332-143431354 GGGCACCGGGAAGCACGGGGCGG + Intergenic
1049608032 8:143538763-143538785 GGAGCCTGGTAAGCCCAGGATGG - Exonic
1049643225 8:143724912-143724934 GGACACAGGGAAGCCCGAAGGGG - Exonic
1049729049 8:144166624-144166646 GGACACCGAGAGGCCCGGAATGG + Intronic
1050063956 9:1738972-1738994 GCACATTGGGAAGCCCAGGTGGG + Intergenic
1051111100 9:13637749-13637771 GCACTTTGGGAAGCCAGGGAGGG - Intergenic
1051288008 9:15515626-15515648 GCACTCTGGGAGGCCGGGGAGGG - Intergenic
1052497231 9:29242804-29242826 AGACACTGGGAATCCCTAGATGG + Intergenic
1052975325 9:34405915-34405937 GGAGACTGTGACGCCCGGGAGGG - Exonic
1053503128 9:38619665-38619687 GGACACTGGGAAGCGCGAGGTGG - Intergenic
1055124153 9:72699708-72699730 GCACATTGGGAGGCCGGGGAGGG + Intronic
1057331731 9:94121178-94121200 ATCCACTGGGAAGCCCAGGAGGG + Intergenic
1057551189 9:96051875-96051897 GGAGCCTGGGAAGTCCGAGATGG - Intergenic
1057814159 9:98281794-98281816 GCACTCTGGGAGGCCCAGGAGGG - Intergenic
1058405990 9:104674655-104674677 GGACTCTGGTAAGCATGGGAAGG - Intergenic
1058501610 9:105624709-105624731 GGAGACTGGGACGACAGGGAGGG - Intronic
1058792725 9:108467346-108467368 AGCCACAGGGAAGCCCAGGAAGG - Intergenic
1059630994 9:116122104-116122126 GCACACTGGGAAGCCGAGGCAGG - Intergenic
1060211657 9:121714157-121714179 GGACCCTGGGAAGACTGGGTTGG - Intronic
1060370714 9:123068101-123068123 GGACTTTGGGAAGCCAGGGTGGG + Intronic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1060588541 9:124801683-124801705 GGACCCTGGGGAGTCAGGGATGG + Intronic
1060661137 9:125405827-125405849 GGACAATGGGGAGCCATGGAAGG - Intergenic
1060811393 9:126613153-126613175 GGACACTGGGACGACAAGGAAGG - Intergenic
1061175244 9:128991593-128991615 GGACTCTGGGAGGCCCAGGTGGG + Intronic
1061220312 9:129246709-129246731 GGACAGAGGGAGGCGCGGGAGGG + Intergenic
1061254440 9:129446028-129446050 GGACACAGGCGAGCCAGGGAGGG - Intergenic
1061376135 9:130225935-130225957 GGACCCTGGGAGACCCGGCAGGG - Intronic
1062075566 9:134586742-134586764 AGACCCTGGGAAGCCCTGGGAGG - Intergenic
1062099597 9:134721276-134721298 GGAGCCTGGGCAGCCCTGGATGG - Intronic
1062117839 9:134818712-134818734 GGCCCCTGGGAAGCCCGGACCGG + Exonic
1062171250 9:135136027-135136049 GGACACAGGGAGGACAGGGATGG + Intergenic
1062409344 9:136414684-136414706 GGACATAGGGAAGACCGGAAAGG + Intronic
1062437200 9:136551534-136551556 AGTCACTGGGAAAGCCGGGATGG + Intergenic
1062494577 9:136825653-136825675 GGACACTCGGAAGTCCTGGTGGG + Intronic
1203751786 Un_GL000218v1:87001-87023 GGGCACTGGCAAGCACAGGAGGG + Intergenic
1185482602 X:458983-459005 AGACACTGGGAAGTCCGAGGAGG + Intergenic
1185938148 X:4282270-4282292 GGAGACTTGGAAGGCTGGGAGGG - Intergenic
1186286258 X:8046840-8046862 AGACACTGGTAGGCCAGGGATGG - Intergenic
1188255373 X:27956121-27956143 GGACACTTGGAAGCAGGGAAGGG - Intergenic
1194412985 X:93578620-93578642 GTACTCTGGGAAACCTGGGAAGG + Intergenic
1195292092 X:103439195-103439217 GGACAACTGGAAGCCAGGGAGGG + Intergenic
1196828448 X:119758632-119758654 GGACACTGGGACGGCCGCGGCGG + Exonic
1198886525 X:141344263-141344285 GGACAATGGGAAACCATGGAAGG + Intergenic
1200119795 X:153784863-153784885 GGGCACAGGGCAGCCCGGGCGGG - Intronic
1200185473 X:154180280-154180302 GCACTCTGGGAAGCCCAGGCAGG + Intergenic
1200191127 X:154217420-154217442 GCACTCTGGGAAGCCCAGGCAGG + Intergenic
1200196881 X:154255221-154255243 GCACTCTGGGAAGCCCAGGCAGG + Intergenic
1200202532 X:154292339-154292361 GCACTCTGGGAAGCCCAGGCAGG + Intronic
1200982995 Y:9279161-9279183 GCACTTTGGGAAGCCCAGGAGGG + Intergenic
1201165441 Y:11204621-11204643 GGGCACTGGCAAGCACAGGAGGG + Intergenic
1201260603 Y:12155462-12155484 GCACACTGGGAGGCCAGGGTGGG + Intergenic
1202350391 Y:23983881-23983903 GCACACTGTGATGCCCAGGAAGG + Intergenic
1202520388 Y:25686240-25686262 GCACACTGTGATGCCCAGGAAGG - Intergenic