ID: 903867584

View in Genome Browser
Species Human (GRCh38)
Location 1:26410553-26410575
Sequence CAGTTGTGCGTGTGGGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 560
Summary {0: 1, 1: 0, 2: 3, 3: 83, 4: 473}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903867572_903867584 17 Left 903867572 1:26410513-26410535 CCGGGGTACTCAAGTCTTCTAGG 0: 1
1: 0
2: 0
3: 7
4: 70
Right 903867584 1:26410553-26410575 CAGTTGTGCGTGTGGGGAGGGGG 0: 1
1: 0
2: 3
3: 83
4: 473

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903867584 Original CRISPR CAGTTGTGCGTGTGGGGAGG GGG Intergenic
900811140 1:4802133-4802155 CACTGATGCGTGTGGGGAGCTGG - Intergenic
900995539 1:6121446-6121468 CTGTGGTGTGTGTGGGGTGGAGG - Intronic
901530869 1:9851814-9851836 CAGTTGTGGGTGTGGGTGGCAGG - Intronic
901656289 1:10771689-10771711 CAGTTGGGCTGGTGAGGAGGAGG - Intronic
903655940 1:24948745-24948767 CAGGTGTGCATGTGGGGGAGGGG + Intronic
903760481 1:25694663-25694685 CTGGTGTGTGTGTGTGGAGGGGG - Intronic
903845830 1:26279594-26279616 TAGTGGTGCGTGTTGGGTGGTGG + Exonic
903867584 1:26410553-26410575 CAGTTGTGCGTGTGGGGAGGGGG + Intergenic
903891120 1:26571405-26571427 CAGTTCTCAGTGTGGGGAGGTGG - Intronic
905139322 1:35829023-35829045 AAGGTGTGTGTGTGGGGGGGGGG - Intronic
905826727 1:41031329-41031351 CAGGTGTGTGTGTGTGGTGGCGG - Intronic
905834559 1:41106355-41106377 CAGATGGCAGTGTGGGGAGGGGG - Intronic
906333923 1:44911853-44911875 CTGTTGTGGGTTGGGGGAGGGGG - Intronic
906688805 1:47779335-47779357 CAGAGGTGTGTGTGGGGAGAGGG + Intronic
906911676 1:49958688-49958710 CTGTTGTGGGGTTGGGGAGGGGG + Intronic
907311607 1:53542068-53542090 CAGTGGGGCATTTGGGGAGGAGG - Intronic
907515964 1:54993657-54993679 CAGTGGGGGGTGGGGGGAGGGGG - Intergenic
907767130 1:57423241-57423263 TAGCTGGGCGTGGGGGGAGGGGG + Intronic
907930901 1:58998975-58998997 TATTTGTGTGTGTGTGGAGGAGG - Intergenic
907965672 1:59326345-59326367 GAGTAGTGGTTGTGGGGAGGGGG + Intronic
909780515 1:79540959-79540981 CTGTTGGGGGTGGGGGGAGGGGG - Intergenic
909962966 1:81871081-81871103 CTGTTGGGGGTGGGGGGAGGGGG - Intronic
911114947 1:94237397-94237419 CCGTGGTGAGTGTGAGGAGGTGG - Exonic
911116027 1:94247547-94247569 CCGTGGTGAGTGTGAGGAGGTGG - Intronic
911312772 1:96316387-96316409 CTGGTGTGGGGGTGGGGAGGTGG - Intergenic
911983158 1:104590899-104590921 CAGTGGGGCCTGTAGGGAGGTGG + Intergenic
912717316 1:111991169-111991191 CATTTCTGGGTGTGGAGAGGTGG + Intergenic
912758056 1:112341279-112341301 CTGTTGTGGGTGGGAGGAGGGGG + Intergenic
913306795 1:117436604-117436626 CAATTGTGCTTGTAGGGATGAGG + Intronic
913433540 1:118822896-118822918 CTGTTGTGGGTGGGGGGAGGGGG - Intergenic
914786285 1:150834673-150834695 CATTTTTGTGTGTGGGGAAGAGG + Intronic
915780561 1:158545322-158545344 ATGTTGTGGGTGGGGGGAGGGGG + Intergenic
915782443 1:158567638-158567660 CTGTTGTGGGTTGGGGGAGGGGG + Intergenic
916981825 1:170145949-170145971 CTGTCATGGGTGTGGGGAGGAGG - Intergenic
917627652 1:176862344-176862366 CAGTCATGAGGGTGGGGAGGAGG + Exonic
918329032 1:183438508-183438530 CATTTTTGTGTGTGGGGGGGGGG - Intergenic
918839735 1:189518881-189518903 CAGTGGGGCCTGTTGGGAGGAGG + Intergenic
919656435 1:200201443-200201465 CTGTGGTGGCTGTGGGGAGGTGG - Intergenic
919706642 1:200682484-200682506 CAGCTGGGGTTGTGGGGAGGTGG + Intergenic
919855222 1:201701256-201701278 CTGTTGTGGGGGTGGGGAGCTGG + Intronic
922176558 1:223202205-223202227 CAGGTGTGCAGGTGGTGAGGTGG + Intergenic
922517059 1:226215400-226215422 CGGGTTTGAGTGTGGGGAGGAGG - Intergenic
922775993 1:228214419-228214441 CAGTTCTGCGTGTCGGGTGAGGG + Exonic
923749568 1:236735158-236735180 CAGTTGTTTGGGTGGGGAAGGGG + Intronic
923783085 1:237042728-237042750 CAGGTGTGCGTGTTGGGGCGAGG + Intronic
923874959 1:238037258-238037280 CTGTTGTGCGTCGGGGGAGGGGG - Intergenic
1063303146 10:4871693-4871715 CAGTTGTGGGGGTGGGGTGGGGG + Intergenic
1063372566 10:5531389-5531411 CAGATGCGCGTGTGTGGAGCAGG - Intergenic
1063588971 10:7377967-7377989 GGGTTGTGTGTGTGGGGGGGAGG + Intronic
1064105402 10:12496895-12496917 CACTGGTGCCTGTTGGGAGGTGG - Intronic
1064927960 10:20591002-20591024 CTCTTGTGCGTGTGTGGAGGAGG + Intergenic
1065446029 10:25800524-25800546 CTGTTGTGGGTGGGGGGAGGGGG + Intergenic
1065720413 10:28623665-28623687 AGGTTGTGTGTGTGCGGAGGTGG - Intergenic
1066316284 10:34250149-34250171 AAGCTGTGTGTGTGTGGAGGGGG - Intronic
1066511564 10:36104103-36104125 AGGTTGTGTGTGTGGGGATGGGG + Intergenic
1066578806 10:36857177-36857199 CTGTTGTGGGTGGGGGGAGGGGG + Intergenic
1067031947 10:42884215-42884237 CTGTTGGGAGTGTGGGGAGTGGG + Intergenic
1067932363 10:50575605-50575627 CCTTTGTGTGTGGGGGGAGGAGG - Intronic
1069224751 10:65929022-65929044 CTGTTGTGGGTGAGGGGAGGGGG - Intronic
1069717245 10:70529215-70529237 CAGTTGTACCTGGGGGGGGGGGG - Exonic
1070630205 10:78079341-78079363 CAGGTGTGGGGGTGGGGAGTGGG + Intergenic
1071515265 10:86292734-86292756 CAGGTGTGAGTGTCGGGAGTGGG + Intronic
1073526937 10:104191777-104191799 AAATTGTGTGTGTGGGGGGGGGG + Intronic
1073541116 10:104316644-104316666 CAGAGCTGAGTGTGGGGAGGGGG - Intronic
1073782677 10:106856641-106856663 CAGTTGTCACTGTGGGGAGCTGG + Intronic
1074275400 10:111996961-111996983 CAGCTGTGCCTATGGGAAGGGGG - Intergenic
1074627724 10:115211758-115211780 CTGTTGTGGGTGAGGGGAGGGGG - Intronic
1074861649 10:117514576-117514598 AAGTGGGGCGGGTGGGGAGGGGG - Intergenic
1075304900 10:121359149-121359171 CTGTTGAGGGTGTGGGGAGAGGG - Intergenic
1075419746 10:122291873-122291895 GTGTTGGGGGTGTGGGGAGGAGG + Intronic
1075784740 10:125041507-125041529 CACTTGTGGGTGGGGGGGGGGGG - Intronic
1076176523 10:128372426-128372448 AAGTTGTGAGTCTGGGCAGGAGG + Intergenic
1076732353 10:132445041-132445063 CAGTTGTGGGGGTGGGGGGGAGG + Intronic
1078309523 11:10226476-10226498 CTGTTGTGGGGTTGGGGAGGGGG - Intronic
1078718926 11:13865717-13865739 CTGTTGTGGGTTGGGGGAGGGGG - Intergenic
1079460009 11:20670468-20670490 CAGGGTTCCGTGTGGGGAGGGGG + Intronic
1080588142 11:33699781-33699803 CAGTTGTCTGTAGGGGGAGGTGG - Intronic
1080903668 11:36519814-36519836 AAGTTGTGGGTGTGGGTTGGTGG - Intronic
1081326905 11:41756206-41756228 CTGTTGTGGGTGGGGGGAGGGGG - Intergenic
1082743535 11:56937805-56937827 CGGTGGTGGGTGGGGGGAGGGGG - Intergenic
1083306155 11:61762908-61762930 CAGATGTGCTTTGGGGGAGGAGG - Intronic
1084208308 11:67608720-67608742 CAGGTGTGTGTGTGGGGGCGGGG + Exonic
1084343731 11:68528421-68528443 AATTTGTGTGTGTGGGGGGGGGG + Intronic
1085071255 11:73548571-73548593 CAGTTCTGGGAGTGGGGAGAGGG - Intronic
1085944363 11:81248893-81248915 CAGGTGTGTGTCTGGTGAGGGGG + Intergenic
1086561555 11:88175163-88175185 CAGGTGAGCGCGGGGGGAGGGGG - Exonic
1087258096 11:95979445-95979467 CAGGTGTACCTGTGGGGAAGCGG + Exonic
1087452429 11:98342270-98342292 CTGTTGTGGGTGGGGGGAGGGGG - Intergenic
1087639366 11:100739858-100739880 CAGTTGTGTGTGTTGGGGGTGGG - Intronic
1088094441 11:106081852-106081874 CTGTTGTGGGTGGGGGAAGGGGG + Intronic
1088359885 11:108978946-108978968 GAGATGTGCATGTAGGGAGGGGG - Intergenic
1088544041 11:110942108-110942130 CAGTTCTGTGTGTGTGGTGGTGG - Intergenic
1089690618 11:120184745-120184767 CACGTGTCCGGGTGGGGAGGAGG + Intronic
1089795639 11:120978393-120978415 CAGATGTGTGTCTGGGGAGTAGG + Intronic
1090265551 11:125350987-125351009 CTGTTGTACGTGTGGGGAGGGGG - Intronic
1090547687 11:127783165-127783187 CAGTGGGGAGGGTGGGGAGGGGG + Intergenic
1091316099 11:134615137-134615159 GGGTTGTGTGTGTGGTGAGGTGG + Intergenic
1091584263 12:1806921-1806943 CACTTGTGTGTTTGGGGAAGAGG + Intronic
1093124112 12:15307504-15307526 CTGGTGGGGGTGTGGGGAGGTGG - Intronic
1095074379 12:37898377-37898399 CTGTTGTGGGTTGGGGGAGGGGG + Intergenic
1095556625 12:43513905-43513927 CTGTTGCGGGTGAGGGGAGGGGG + Intronic
1095916000 12:47479327-47479349 CTGTTGTGGGTGGGGGGAGGGGG + Intergenic
1096092457 12:48912175-48912197 CACTTGAACCTGTGGGGAGGAGG + Intronic
1096181247 12:49551696-49551718 GACTTGTACATGTGGGGAGGTGG + Intronic
1096394876 12:51258208-51258230 CAGTTGAGAGTGAGGGTAGGAGG + Intronic
1096759359 12:53827253-53827275 CAGGAGTGGGTGTGGAGAGGTGG + Intergenic
1097165862 12:57086529-57086551 CAGGTGTGTGTGTGGGGGGGGGG - Intronic
1097167587 12:57093936-57093958 GAGTTGTGGGTATGGGGATGGGG + Intronic
1097736850 12:63191953-63191975 CTGTTGTGGGTGGGAGGAGGTGG + Intergenic
1099159140 12:79218524-79218546 CTGTGGTGATTGTGGGGAGGTGG - Intronic
1099378932 12:81932115-81932137 CATGTGTGTGTGTGTGGAGGGGG - Intergenic
1099423554 12:82494423-82494445 CTGTTGTGGGTGGGGGGAGCGGG + Intergenic
1100926302 12:99551941-99551963 CAGATGTGTGTGTGTGGTGGGGG - Intronic
1101426263 12:104591057-104591079 CAGTTGTTGGTGTTGGGAGAGGG + Intronic
1101640094 12:106581500-106581522 CAGCTCTGATTGTGGGGAGGGGG + Intronic
1101911778 12:108865479-108865501 CACTTGAGCCTGGGGGGAGGAGG - Intronic
1102291203 12:111701579-111701601 CAGTTGTACCTGTGAGGTGGAGG + Intronic
1102856944 12:116302442-116302464 CCGTGGTGTGCGTGGGGAGGTGG + Intergenic
1102878088 12:116463455-116463477 TAGGTGTGTGTGTGGGGAGGGGG - Intergenic
1103742038 12:123097476-123097498 CACTTGTGCCTGTGGGGTCGAGG - Intronic
1104362268 12:128145023-128145045 CTTTTGTGTGTGTGGTGAGGAGG - Intergenic
1104376023 12:128266543-128266565 CACCTGTGCGTGTGCGGAGGGGG - Intergenic
1104410712 12:128555498-128555520 AAGTTTTGCGTGTGTGGAGTGGG - Intronic
1104470354 12:129025090-129025112 GAGGTGTGTGTGTGGGGATGTGG - Intergenic
1104636865 12:130442939-130442961 GTGTTGTTCGTGTTGGGAGGGGG - Intronic
1104897308 12:132170717-132170739 CCGGTGTGTGTGTGGAGAGGGGG + Intergenic
1105488016 13:20856737-20856759 CAGTTGTGCGTGTGTGTGGAAGG - Intronic
1105664585 13:22538674-22538696 CAGCTGTGAGTGTGGTAAGGAGG + Intergenic
1108030620 13:46225404-46225426 CAGAAGTGGGTGTGTGGAGGAGG + Intronic
1108966655 13:56314624-56314646 GAGGTGTGTGTGTGGGGAGTAGG - Intergenic
1109014536 13:56992801-56992823 CTGTTGTGGGTGGGGGGAGGGGG - Intergenic
1109228750 13:59729455-59729477 CAGTTGTGTGTGGGGTGAGGAGG + Intronic
1110086264 13:71384707-71384729 CTGCTGTGGGTGGGGGGAGGGGG - Intergenic
1111136158 13:84047023-84047045 CTGTTGTGGGTGGGGGGAGGGGG - Intergenic
1111578420 13:90189984-90190006 CTGTTGTGGGTGTGGGCAAGAGG - Intergenic
1111580800 13:90220653-90220675 CTGTTGTGGGGGTGGGGAGGGGG + Intergenic
1112012925 13:95307243-95307265 CTGTTGTGGGTGGGGGGAGGGGG + Intergenic
1112134935 13:96567193-96567215 GACTTGTGGGTGTGGGGAGGCGG - Intronic
1112714275 13:102165659-102165681 CTGTTGTGGGTGGGGGGAGGGGG + Intronic
1112854789 13:103754504-103754526 CAATTGTGGGTGAGGGGCGGGGG + Intergenic
1113263995 13:108596087-108596109 CAGCTGTGTGTGTTGAGAGGTGG + Intergenic
1113613236 13:111662734-111662756 CAGGGGTGGGTGTGGGGATGGGG + Intronic
1113933264 13:113979823-113979845 GAGGTGTGCATGTGGGGAGGAGG - Intronic
1114347742 14:21814484-21814506 CTGTTGTGGGTGGGGGAAGGGGG + Intergenic
1114363788 14:22005147-22005169 CTGTTGTGGGTGGGAGGAGGGGG - Intergenic
1114923751 14:27366533-27366555 CATTTGTGTGTTTGGGCAGGAGG - Intergenic
1115070734 14:29319137-29319159 CACTTGTGTGTGTCGGAAGGTGG + Intergenic
1115727858 14:36236828-36236850 CACTGGGGCCTGTGGGGAGGGGG + Intergenic
1116538545 14:46066534-46066556 CTGTTGTGGGTTGGGGGAGGGGG + Intergenic
1116869532 14:50058059-50058081 CAGCTGTGGGTCAGGGGAGGTGG + Intergenic
1118716023 14:68560777-68560799 CAGAAGTGTGTGTGGGGCGGGGG - Intronic
1119159437 14:72440970-72440992 CATCTGTGCGTGTGTGCAGGTGG + Intronic
1119197771 14:72730185-72730207 CAGTGGTGGGTGCGGGGAGAGGG + Intronic
1120872854 14:89353567-89353589 CAGTAGTGAGTGTGGGGTGTGGG - Intronic
1121245971 14:92460979-92461001 CAGGAGTGGGTGTGGGTAGGGGG + Intronic
1121916799 14:97842899-97842921 CAGCTGTGTGTGTGTGGAGGGGG - Intergenic
1122160889 14:99783138-99783160 CTGTTGTGGGTGGGGGGAGGGGG - Intronic
1122427401 14:101619972-101619994 CAGGTGTGTGTGTGTGGGGGTGG - Intergenic
1122833925 14:104421772-104421794 CTGGTGGGAGTGTGGGGAGGGGG - Intergenic
1122916909 14:104863714-104863736 CAATTGTGTGGGTGGGTAGGTGG - Intergenic
1123010295 14:105346695-105346717 AAGTTGTGCGGGTGGGGGTGGGG - Intronic
1123470554 15:20549075-20549097 CAGTTGTGTGTAGGGGGATGGGG + Intergenic
1123647506 15:22451625-22451647 CAGTTGTGTGTAGGGGGATGGGG - Intergenic
1123730854 15:23144053-23144075 CAGTTGTGTGTAGGGGGATGGGG + Intergenic
1123748993 15:23341479-23341501 CAGTTGTGTGTAGGGGGATGGGG + Intergenic
1123754803 15:23388886-23388908 CCGGTGTGTGTGTGTGGAGGAGG - Intergenic
1123786633 15:23681336-23681358 CTGTTGGGGGTGGGGGGAGGGGG + Intergenic
1124281364 15:28365362-28365384 CAGTTGTGTGTAGGGGGATGGGG + Intergenic
1124301338 15:28546259-28546281 CAGTTGTGTGTAGGGGGATGGGG - Intergenic
1124480255 15:30073277-30073299 CATTTGAGGGTGTGGGGAGCTGG - Intergenic
1124656804 15:31515749-31515771 CAGTTGTGTGGGTGGGTGGGTGG - Intronic
1125073020 15:35578580-35578602 CAGGTGTGCATGTGTGAAGGTGG + Intergenic
1125832911 15:42729118-42729140 GAGCTGTGCCTGGGGGGAGGAGG + Exonic
1126782652 15:52151571-52151593 TGGATGTGGGTGTGGGGAGGAGG - Intronic
1127239776 15:57100182-57100204 GAGTTCTGCCTGTAGGGAGGTGG + Intronic
1127551689 15:60044785-60044807 GAGTTGTGGGTGAGGAGAGGAGG - Intronic
1128547797 15:68579352-68579374 GGGGTGTGGGTGTGGGGAGGGGG + Intronic
1128758183 15:70197189-70197211 CAGTGATGCGTGTGTGGAGGGGG - Intergenic
1129191775 15:73941742-73941764 CAGCAGTGGGTGTGGGCAGGGGG - Intronic
1129540844 15:76346252-76346274 CAGTTGCGAGTCTGGGGCGGTGG + Intergenic
1129556559 15:76516368-76516390 CAGTTGCGGGGGTGGGGTGGGGG - Intronic
1130138531 15:81202472-81202494 CTGTTGTGGGTGTAGGGAGGGGG - Intronic
1130584648 15:85171817-85171839 CAGGTGAGGGTGTGGGGACGTGG - Intergenic
1130736941 15:86560286-86560308 CTGTTGCGGGGGTGGGGAGGGGG - Intronic
1130850540 15:87789404-87789426 CTGTTGTGAGTGGGGGGAGGGGG + Intergenic
1131107798 15:89746595-89746617 GAGCTGTGTGTGTGTGGAGGCGG - Intergenic
1131198658 15:90378041-90378063 AACTTGAGTGTGTGGGGAGGGGG - Intergenic
1132159928 15:99531236-99531258 TTGTTGTGGGTGGGGGGAGGGGG - Intergenic
1132746643 16:1438970-1438992 CAGGTCTGCGTCTGGGAAGGGGG + Intronic
1132942251 16:2514084-2514106 CATGTCTGCGGGTGGGGAGGGGG - Exonic
1133321858 16:4919062-4919084 CCGGTGTGTGTGTGGGGAGGGGG - Intronic
1133394886 16:5438928-5438950 TAGTTGTGTGGATGGGGAGGTGG + Intergenic
1133589003 16:7224588-7224610 CAGTTGGGCGTGTAGTGGGGTGG + Intronic
1133589135 16:7225749-7225771 CATTTGGGGGTGGGGGGAGGGGG + Intronic
1134126327 16:11618644-11618666 CATTTCTGGGGGTGGGGAGGGGG + Intronic
1134194931 16:12152414-12152436 CAGATGGGCATGTGGGGAGCAGG + Intronic
1134461566 16:14434094-14434116 CTGGTGTGTGTGTGTGGAGGAGG + Intergenic
1134756845 16:16674636-16674658 CAGCTTTGGGAGTGGGGAGGTGG + Intergenic
1134989223 16:18684527-18684549 CAGCTTTGGGAGTGGGGAGGTGG - Intergenic
1135001200 16:18778362-18778384 CTGTTGTGGGTGGGGGGACGGGG + Intergenic
1137867684 16:51917657-51917679 CAGTTGTCTGTGTGTGGTGGTGG - Intergenic
1138271593 16:55699674-55699696 AAGTCCTGCATGTGGGGAGGGGG + Intronic
1138307912 16:55995108-55995130 CTGTTGGGTGGGTGGGGAGGAGG + Intergenic
1139335510 16:66228262-66228284 CAGTTGTGCTGGTGGAGAGCAGG - Intergenic
1140002642 16:71040492-71040514 AAGTTGTGTGTGTGGGGGGGAGG - Intronic
1140286732 16:73609949-73609971 CAGGTGTGTGTGTGGGTGGGTGG + Intergenic
1141016021 16:80450311-80450333 CAGTTTTTTGTGTGGGGATGGGG + Intergenic
1141867746 16:86762320-86762342 CTGCGGTGTGTGTGGGGAGGGGG + Intergenic
1142014936 16:87740373-87740395 AAGTTGTGGGGGTGGGGAGAGGG + Intronic
1142064766 16:88055281-88055303 CAGGGGTGTGTGTGCGGAGGGGG - Intronic
1142200759 16:88760117-88760139 GAGGTGGGCGTGTGGGGTGGTGG - Intronic
1142298695 16:89243703-89243725 CTGTTGTGTGTGTGTGGTGGTGG + Intergenic
1142656878 17:1400230-1400252 CAGTTGTCCGCGTGCGCAGGCGG - Exonic
1142766755 17:2068709-2068731 CCGTGGGGCGTGTGTGGAGGGGG + Intronic
1142858824 17:2749153-2749175 AAGGTGTGCGTGGCGGGAGGTGG + Intergenic
1143225514 17:5299109-5299131 CACTTGTGTGTGTGTGGAGGGGG + Intronic
1144046192 17:11456709-11456731 CAGTTCTTCGTGTGCAGAGGGGG - Intronic
1146451230 17:32975598-32975620 AAGTTGCGAGTGTGGGAAGGTGG - Intronic
1146589549 17:34116844-34116866 CAAGTGTGTGTGGGGGGAGGAGG + Intronic
1146937115 17:36818786-36818808 CAAGAGTGCGTGTGTGGAGGTGG - Intergenic
1147326563 17:39672466-39672488 CAGCTGGGGATGTGGGGAGGAGG + Exonic
1147425096 17:40342474-40342496 AAGTTGTGTGTGCTGGGAGGGGG - Intronic
1147847996 17:43418833-43418855 CGTGTGTGTGTGTGGGGAGGGGG + Intergenic
1147948809 17:44095692-44095714 CAGCTGTGCCTGGGGGGAGGGGG + Intronic
1148210157 17:45803797-45803819 CATGTGTGTGTGTTGGGAGGTGG + Intronic
1148387528 17:47245140-47245162 CATGTGTGTGTGTTGGGAGGGGG + Intergenic
1148568193 17:48646332-48646354 CAGGTGTGTGTGTGGGGAAAGGG - Intergenic
1148578022 17:48724991-48725013 CAGATGGGCCTGTGGGGAGGGGG - Exonic
1148950106 17:51303302-51303324 CCTTTGTGTGTGTGGGAAGGGGG - Intergenic
1148961104 17:51393601-51393623 AGGTTTTGAGTGTGGGGAGGAGG + Intergenic
1149636763 17:58177196-58177218 CTGGTGTTGGTGTGGGGAGGAGG - Intergenic
1150219017 17:63485380-63485402 CAGGTTTGGGGGTGGGGAGGTGG - Intronic
1151066309 17:71154189-71154211 CATTTGTGTGTGTCGGGTGGTGG - Intergenic
1151319559 17:73344294-73344316 CGGTTGTGGGTGTGGGGGGAGGG - Intronic
1152236660 17:79142589-79142611 CACTCGTGGGTGTGTGGAGGTGG + Intronic
1152767059 17:82147486-82147508 CAGGTGAGTGTGTGGGTAGGTGG + Intronic
1155540297 18:26862986-26863008 AAGGTGTGCGTGGGGGGGGGGGG + Intronic
1156179207 18:34583332-34583354 CAGTTGTGTGTTTGGGGGTGGGG - Intronic
1156343563 18:36235278-36235300 CTGTTGTGGGTGGGGGGAGGGGG - Intronic
1156450184 18:37262382-37262404 AAGGTGTGTGTGTGGGGTGGGGG + Intronic
1156720060 18:40059073-40059095 ACGTTGTGTGTGTGGGTAGGAGG - Intergenic
1157299275 18:46467919-46467941 CAGGTGTGTGGTTGGGGAGGGGG - Intergenic
1157701039 18:49761710-49761732 GAGGTGTGTGTGTGGGGATGTGG - Intergenic
1158243696 18:55406742-55406764 CCGTTGTGGTTGTGGGGATGGGG - Intronic
1159308695 18:66679644-66679666 CAGTTGAGCCTGTGGGGCAGAGG - Intergenic
1159558139 18:69966437-69966459 CTGTTGTGGGGGGGGGGAGGGGG + Intergenic
1160251919 18:77210387-77210409 CAGGAGTGGGGGTGGGGAGGTGG + Intergenic
1160523452 18:79522035-79522057 GTGTTTTGTGTGTGGGGAGGGGG + Intronic
1161055410 19:2188485-2188507 CACCTGTGCGGGTGGGGGGGGGG - Intronic
1161164377 19:2778220-2778242 CAGGGGTGTGTGTGTGGAGGGGG + Intronic
1161469533 19:4449335-4449357 CAGTTGAGGGTGGGGGGTGGTGG - Intronic
1162320019 19:9966245-9966267 TGGTTGTGGGTGTGGGGAGCAGG + Intronic
1162822184 19:13229691-13229713 CTCTTGAGAGTGTGGGGAGGAGG - Intronic
1163093831 19:15041303-15041325 CAGTTGTGGGGTGGGGGAGGGGG - Intergenic
1163962927 19:20714149-20714171 CACTGGTGCCTGTTGGGAGGTGG + Intronic
1164140511 19:22457583-22457605 CAGTTGAGCCTGGGAGGAGGAGG - Intronic
1164329329 19:24237220-24237242 CTGTTGTGGGTGGGGGAAGGGGG + Intergenic
1165390398 19:35535267-35535289 CAGGAGTGTGTGTGGAGAGGTGG + Intronic
1165784038 19:38450590-38450612 CAGATGAGCTGGTGGGGAGGTGG + Intronic
1166214851 19:41328107-41328129 GAATTGTGCGTGTGTGGCGGAGG + Intronic
1167135038 19:47610609-47610631 TAGGTGTGTGTGTGGGGGGGGGG - Intronic
1167382022 19:49143765-49143787 CTGTTGTGTGTGTGGGGTGGAGG + Intronic
1167577149 19:50323184-50323206 CCGTGGTGCGGGTGGGGCGGGGG + Exonic
1167701254 19:51047871-51047893 CAGCTGTGCGCGGGGGGCGGGGG - Intergenic
1167810132 19:51822428-51822450 CAGTTATTTGTGGGGGGAGGGGG + Intronic
925170025 2:1744541-1744563 CAGCTGTGCGCGGGGGGCGGGGG + Intronic
925188455 2:1865050-1865072 CAGGTGCTCTTGTGGGGAGGCGG + Intronic
926209131 2:10856125-10856147 CAGGTGTGTGTGTTGGGGGGGGG + Intergenic
926237173 2:11054693-11054715 CAGGTGTGTGGGTGGGGTGGAGG - Intergenic
927653478 2:24926733-24926755 CTGTTGTGCGGGTGGAGAAGCGG + Intergenic
929026426 2:37607885-37607907 CCTGTGTGTGTGTGGGGAGGCGG - Intergenic
929399663 2:41565470-41565492 CAGTTGTGCATTTGTTGAGGGGG + Intergenic
929441802 2:41970905-41970927 CAGGTGTGTGTGTGAGGGGGTGG - Intergenic
929744579 2:44642716-44642738 GAATTGTGAGAGTGGGGAGGGGG + Intronic
930198129 2:48529507-48529529 AAGCTGTGGGGGTGGGGAGGAGG - Intronic
930722575 2:54651972-54651994 CAGTAGGGCTTGTGGGGAGGTGG - Intronic
930857432 2:56033736-56033758 CTGTTGTGGGTGGGGGGTGGGGG + Intergenic
931496155 2:62809353-62809375 CAGTTGGGGGAGAGGGGAGGAGG - Intronic
931893928 2:66707457-66707479 CATTTGTGTGTGGGGGGGGGGGG - Intergenic
932508514 2:72261218-72261240 CAGATGTGCTTGGAGGGAGGCGG + Intronic
932538838 2:72629327-72629349 AAGCAGTGCATGTGGGGAGGTGG - Intronic
933206791 2:79515417-79515439 GAGTTGTGAATGTGGGGAGGTGG + Intronic
933278382 2:80305699-80305721 AAGGTGTGTGTGTGGGGAGGTGG - Intronic
934108712 2:88721573-88721595 CATGTGTGCATGTGGGGGGGGGG - Intronic
934710353 2:96510095-96510117 CAGTTGTGTATGGGGTGAGGGGG - Intergenic
935789954 2:106581918-106581940 ACGTTGTGTGTGTGGGGGGGCGG - Intergenic
936572605 2:113628874-113628896 CCGTTGTGTGTGTCGGGTGGAGG + Intronic
936667873 2:114618550-114618572 GGGTTGTTGGTGTGGGGAGGCGG + Intronic
936939697 2:117871458-117871480 CTGTTGTGGGTGGGGGAAGGGGG - Intergenic
937375995 2:121336014-121336036 CAGGTGTGCCTGTCGGGGGGGGG + Intergenic
937802966 2:126102268-126102290 CTGTTGTGGGTGGGGGGAGGGGG - Intergenic
937914157 2:127090684-127090706 CAGCTGTGGGTGGGGGGCGGTGG + Intronic
939358038 2:141129560-141129582 CAGTAGTGTGTGTGGGGGGAGGG + Intronic
939566175 2:143788992-143789014 CAGTTGGGCATGTTAGGAGGTGG + Intergenic
940330030 2:152464680-152464702 CAGATCAGCGTGTGAGGAGGAGG + Intronic
941262911 2:163319567-163319589 CATTTGTGGGGGTGGGGAGGTGG - Intergenic
941726977 2:168871201-168871223 CTGTTGTGGGTTGGGGGAGGGGG + Exonic
942817872 2:180073913-180073935 GAGTTGTTTGTGTGGGGTGGGGG - Intergenic
942955360 2:181766778-181766800 CTGTTGTGGGGTTGGGGAGGGGG - Intergenic
943173972 2:184444529-184444551 TAGGTGTGTGTGTGGGGTGGGGG - Intergenic
943291558 2:186078636-186078658 CTGTTGTGGGTGGGGGGAGTGGG + Intergenic
943535153 2:189139356-189139378 GAGTTCTGGGTGTTGGGAGGAGG - Intronic
944026944 2:195181885-195181907 CTGTTGTGGGGGTGGGGTGGGGG - Intergenic
945048645 2:205802885-205802907 CAGTTCTGCCTCTGGGGAGCTGG - Intergenic
945586744 2:211674913-211674935 CAACTCTGCGTGTGGGGAAGTGG - Intronic
945798170 2:214390639-214390661 CCATTGGGAGTGTGGGGAGGTGG - Intronic
946247882 2:218397753-218397775 CAGGATTGCGTGGGGGGAGGGGG - Intergenic
946541590 2:220689946-220689968 CTGTTGTGTGTGTGGAGTGGGGG + Intergenic
946861104 2:224001139-224001161 CTGTTGTGGGCTTGGGGAGGGGG + Intronic
947190258 2:227497169-227497191 GAATTGTGTGTGTGGGGTGGGGG - Intronic
947868399 2:233417828-233417850 CAGTTGTGGGTATGGAGAGCAGG + Intronic
948067574 2:235092581-235092603 CCCTGGTGCTTGTGGGGAGGAGG - Intergenic
948374515 2:237512614-237512636 GCCGTGTGCGTGTGGGGAGGTGG - Intronic
948430481 2:237915480-237915502 GAGTTGGGAGTGTGTGGAGGCGG - Intergenic
948494363 2:238337330-238337352 CAGGTGTGTGAGTGGTGAGGTGG + Intronic
948798234 2:240417708-240417730 CATTTGTGGGTGGGGGGAGTGGG - Intergenic
948850737 2:240704151-240704173 CAGTGCAGCGGGTGGGGAGGAGG + Intergenic
1169704278 20:8484888-8484910 CAGTTGTGCATGTGGGTACCAGG + Intronic
1170747226 20:19111066-19111088 TATTGGTGTGTGTGGGGAGGGGG + Intergenic
1171993997 20:31718298-31718320 GTGGTGTGCGTGTGGGGAGAAGG - Intronic
1172077567 20:32310941-32310963 CAGTGGTGGGGGTGGGGAAGAGG + Exonic
1172608203 20:36230002-36230024 GAGTTGAGGGTGAGGGGAGGCGG - Exonic
1173036651 20:39418116-39418138 AAATTGTGTGTGTGTGGAGGGGG + Intergenic
1173367567 20:42400962-42400984 CAGATGTGGGTTTCGGGAGGAGG + Intronic
1173654473 20:44690177-44690199 CACTTGTGGGGGAGGGGAGGAGG + Intergenic
1173840666 20:46154698-46154720 CAGTTGGGCCTGTGGGGAGGAGG + Intergenic
1173843325 20:46173267-46173289 CACTTGGGCGTGGGGGGAGGTGG + Intergenic
1173960955 20:47072171-47072193 CTGTTGTGCCTGTGGGAAGGAGG - Exonic
1174023644 20:47553545-47553567 CTGTTGTGGGTGGGGGGAGGGGG - Intronic
1174343674 20:49914496-49914518 CATTGGTGTGGGTGGGGAGGTGG - Intronic
1174924497 20:54742757-54742779 GAAGTGTGTGTGTGGGGAGGGGG + Intergenic
1175111937 20:56654595-56654617 GATGTGTGTGTGTGGGGAGGAGG - Intergenic
1175212601 20:57370454-57370476 CAGTTGTGCTTGGGTGGAGGAGG - Intronic
1175308980 20:57998328-57998350 CAGAGCTGTGTGTGGGGAGGGGG + Intergenic
1175314933 20:58040538-58040560 CATGTGTGTGTGTGGGGTGGGGG - Intergenic
1175380492 20:58559282-58559304 CAGTTCTGCGTGTGGGCACACGG + Intergenic
1175580669 20:60096353-60096375 CACGTGTGCGTGTGGGGGAGGGG + Intergenic
1175831674 20:61967870-61967892 CAGAGGTGCGGGTGGGGAAGAGG - Intronic
1175927240 20:62476698-62476720 CAGAAATGCGTGTGGGTAGGAGG + Intergenic
1176161142 20:63649458-63649480 CAGCTGTGTCTGTGGAGAGGTGG - Intronic
1177057697 21:16329022-16329044 CAGTTGGGGGTGGAGGGAGGAGG + Intergenic
1178490009 21:33043864-33043886 GAGTTGTGGGTGTTGGGAGTGGG - Intergenic
1178494477 21:33075421-33075443 CTTTTGTGTGTGTGGGGGGGTGG + Intergenic
1179709521 21:43205197-43205219 AAGTTCTGTGTGTGGGGCGGTGG + Intergenic
1179944177 21:44659464-44659486 CATTAGTGTGTGGGGGGAGGTGG - Intronic
1180800698 22:18630589-18630611 CAGGGGTCTGTGTGGGGAGGGGG - Intergenic
1180851930 22:19026146-19026168 CAGGGGTCTGTGTGGGGAGGGGG - Intergenic
1181221021 22:21364673-21364695 CAGGGGTCTGTGTGGGGAGGGGG + Intergenic
1181783417 22:25208848-25208870 CAGTGGTCAGTGGGGGGAGGTGG - Intergenic
1182139296 22:27938934-27938956 CTGTTTTGGGGGTGGGGAGGAGG + Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1183369723 22:37425696-37425718 CAACTGTGTGGGTGGGGAGGTGG - Intronic
1184608378 22:45587181-45587203 CGGCTGTGGGTGTGGGGAGTGGG - Intronic
1184866489 22:47204484-47204506 CCTGTGTGCCTGTGGGGAGGAGG - Intergenic
1185060114 22:48602291-48602313 CTGGTGTGCTTGTGGGGGGGTGG - Intronic
1185336261 22:50272015-50272037 CAGGCGGGCGTGTGGGGTGGGGG + Intergenic
949646506 3:6101290-6101312 CTGTTGTGGGTGGGGGGAGGGGG - Intergenic
950151228 3:10688970-10688992 CTGGTGTGGGGGTGGGGAGGAGG + Intronic
950919783 3:16682585-16682607 CTGTTGTGGGTGGGGGGAGGGGG + Intergenic
952080222 3:29748855-29748877 CAGGTGGGCGTGTGGGGAAGGGG + Intronic
953216446 3:40923158-40923180 GAGTTGTGCACGTGGCGAGGTGG - Intergenic
953963865 3:47286959-47286981 CAGTTGCTTGTCTGGGGAGGGGG + Intronic
954139142 3:48595967-48595989 CAGCTGTGCCTGCAGGGAGGGGG + Intergenic
954632993 3:52056892-52056914 CTGTTGTGAATGTGGGGTGGGGG - Intergenic
954993766 3:54863612-54863634 CAGCACTGTGTGTGGGGAGGAGG - Intronic
955422993 3:58758684-58758706 CTGTTGTGGGTGAGGGGAAGGGG - Intronic
955986001 3:64574736-64574758 GGGGTGTGTGTGTGGGGAGGGGG - Intronic
956447327 3:69338301-69338323 CTGTTGTGAGTGGGGAGAGGGGG + Intronic
956682143 3:71790768-71790790 CTGGTGTATGTGTGGGGAGGTGG - Intergenic
957541707 3:81579654-81579676 GAGTGGTGGGGGTGGGGAGGGGG - Intronic
957835919 3:85589138-85589160 CATGTTTGTGTGTGGGGAGGAGG + Intronic
958114370 3:89196271-89196293 CAGTTGTGTATGTTGAGAGGAGG - Intronic
958875668 3:99613797-99613819 CCTTTGTGTGTGTGGGGGGGGGG - Intergenic
959051381 3:101527937-101527959 CATGTGTGTGTGTGGGGGGGGGG - Intergenic
959949174 3:112160416-112160438 CTGTTGTGGGTGGGGGGAGGGGG - Intronic
960052680 3:113252883-113252905 CAGCTGTGCTTGTTGGGCGGGGG + Intronic
960582904 3:119295477-119295499 CAGTTGCGGGTGGGGGGTGGGGG + Intronic
960985852 3:123280218-123280240 TATTTATGGGTGTGGGGAGGGGG - Intergenic
961338812 3:126203653-126203675 TAGGTGTGTGTGTGGGGGGGTGG - Intergenic
961479451 3:127170757-127170779 CAGGTGGGCTTGGGGGGAGGTGG + Intergenic
961824051 3:129589572-129589594 CAGCTGTGCGGGCGGGGAGCCGG - Intronic
962625360 3:137220578-137220600 CACTGGGGCCTGTGGGGAGGGGG + Intergenic
962865998 3:139448437-139448459 TGGTTGTGGGTGTGGGGACGAGG - Intergenic
963166770 3:142212195-142212217 CAGTGGTGTGTGTGGGTACGTGG + Intronic
963177442 3:142315016-142315038 CAGTTGAGCCTGTGAGGCGGAGG - Intronic
963178228 3:142324242-142324264 CTGTTGTGGGTGGGGGGAGGGGG - Intronic
964144502 3:153442733-153442755 GTGTTGTGCTGGTGGGGAGGGGG - Intergenic
965029836 3:163351891-163351913 CTGTTGTGGGTGGGGGCAGGGGG - Intergenic
965121282 3:164560986-164561008 CATTTGTGTGTGTGTGGCGGGGG + Intergenic
965177984 3:165361094-165361116 CTGTTGTGGGTGGGGGGAGGGGG - Intergenic
966629526 3:182057074-182057096 CAGGTGGGTGTGTGGGGTGGGGG - Intergenic
967228028 3:187311986-187312008 CAGGGGTGGGGGTGGGGAGGGGG + Intergenic
968103930 3:195988183-195988205 CAGCTGTGTGTGTGTGGTGGGGG - Intergenic
968302232 3:197625773-197625795 CAGCTGTGTGTGTGTGGTGGGGG - Intergenic
969162530 4:5273836-5273858 CTGTGGTGGGTGGGGGGAGGGGG + Intronic
969163709 4:5285258-5285280 GATTTTTGAGTGTGGGGAGGGGG + Intronic
969504464 4:7576066-7576088 CAGCTGTGTGTGTGAGGACGAGG + Intronic
969666048 4:8558109-8558131 CAGGTGTGCTTGGGGGGCGGTGG + Intergenic
970041177 4:11798584-11798606 CTGTTGTGGGTGGGGGGAGGGGG + Intergenic
971244344 4:24914580-24914602 CAGCTGTGCGGGTGGGGGTGGGG - Intronic
971740748 4:30517394-30517416 CAGTAGGGCTTGTCGGGAGGTGG + Intergenic
973238745 4:47934265-47934287 CAGGAGTGAGGGTGGGGAGGTGG - Intronic
973857582 4:55028785-55028807 CAGTTATGTCTGAGGGGAGGAGG - Intergenic
974027327 4:56745220-56745242 CGGGTGTGTGTGTGGGGGGGTGG - Intergenic
974459362 4:62167234-62167256 CTGTTGTGGGTGGGGGGAGGGGG - Intergenic
974976517 4:68900765-68900787 CAGGTGAGCTTGTGGGCAGGTGG + Intergenic
975007262 4:69305324-69305346 CAGCGGTGCCTGTGGGGGGGGGG + Intronic
975244363 4:72102522-72102544 CTGTTGTGGGTGGGGGGAGGGGG - Intronic
976604845 4:86973060-86973082 AGTTTGTGTGTGTGGGGAGGGGG + Intronic
977418271 4:96763718-96763740 AAGTGGTGTGTGTGTGGAGGGGG + Intergenic
978781007 4:112554199-112554221 GTGTTGTGGGTGGGGGGAGGGGG - Intronic
979325581 4:119375416-119375438 CATATGTGTGTGTGGGGGGGTGG + Intergenic
980604454 4:135071213-135071235 CTGTTGTGGGAGGGGGGAGGGGG + Intergenic
982122619 4:152157267-152157289 GAAGTGTGCGTGTGGGCAGGAGG - Intergenic
982487782 4:155988933-155988955 CACTTGAGCCTGCGGGGAGGAGG - Intergenic
982533048 4:156571731-156571753 CTGTTGTGTGTGTTGGGGGGTGG + Intergenic
983077357 4:163343289-163343311 CAGCTGTGGGTGTGGGCAAGTGG - Intronic
984417485 4:179479706-179479728 TGGTTGTGTGTGTGGGGAAGCGG - Intergenic
985520249 5:370757-370779 CAGGTGTTGGTGGGGGGAGGGGG + Intronic
986044268 5:4022517-4022539 CAGTTGTGCACGTGGGGAAGAGG + Intergenic
986463027 5:7992856-7992878 CTTTTGTGCGTGTGGAGAGAGGG + Intergenic
987699401 5:21376526-21376548 CTGTTGTGGGTGGGGGGAGGGGG + Intergenic
988020775 5:25617618-25617640 CACTTGTGTGTGTGGGTGGGTGG + Intergenic
988081983 5:26426459-26426481 CTGTTGTGGGGGTGGGGGGGAGG + Intergenic
988736934 5:34031953-34031975 CATTTGTGCGTGTATGGTGGTGG - Intronic
990065512 5:51709621-51709643 CACCGGTGCCTGTGGGGAGGTGG - Intergenic
990151268 5:52820367-52820389 CTGTTGTGGGTGGGGGGAGGGGG + Intronic
990204253 5:53412058-53412080 CAGTTCTGGGGGTGGGGAGATGG - Intergenic
990951744 5:61305238-61305260 CAATAGTGTGTGTGGGGGGGGGG + Intergenic
991189530 5:63853270-63853292 CAAGTGGGCGGGTGGGGAGGAGG + Intergenic
993913184 5:93709033-93709055 CATTTGTGTGTGTGGTGGGGTGG - Intronic
994576858 5:101589304-101589326 CTGTTGTTGGGGTGGGGAGGGGG + Intergenic
995287226 5:110403817-110403839 CAGTTGTGTGTGGGGTGGGGTGG + Intronic
997087978 5:130823595-130823617 CTGTTGTGGGTTGGGGGAGGGGG + Intergenic
997209266 5:132067997-132068019 CACTTGTCCTGGTGGGGAGGAGG - Intergenic
998462439 5:142319735-142319757 CATTTGTACCTGTGGGGAGGGGG + Exonic
998984261 5:147738362-147738384 CAGTTTTGCTTGTGGCGTGGGGG + Intronic
999265921 5:150266855-150266877 CAGGTATGCGGGTGGGGGGGTGG + Intronic
999484577 5:151983120-151983142 CTGTTGTGGGTGGGGGGAGGGGG - Intergenic
999570410 5:152913824-152913846 CTGTTGTGGGTGGGGGGATGGGG - Intergenic
999879793 5:155849416-155849438 CATGTGTGTGTGTGTGGAGGGGG - Intergenic
1000119911 5:158187572-158187594 CTGTTGTGTGTGGGGGGAGGAGG + Intergenic
1001922464 5:175611278-175611300 CAGTTGGGGGTCTGAGGAGGAGG - Intergenic
1002624797 5:180518492-180518514 TATTTGTGTGTGTGGGGGGGAGG + Intronic
1002893785 6:1362102-1362124 CTGTCGTGGGTGGGGGGAGGGGG + Intergenic
1003458735 6:6309421-6309443 CAGTTGTCCATGTGGAAAGGGGG + Intronic
1003951625 6:11121567-11121589 CAGGTGTGTGTGTTGGGAGGGGG - Intronic
1004190634 6:13460659-13460681 CTGTTGGGGGTGTGGGGAGAGGG + Intronic
1004200469 6:13543078-13543100 AAGTTGGGCGGGTGGGGTGGTGG + Intergenic
1004919900 6:20366707-20366729 CAGTGGTGCCTGCGGGGATGGGG + Intergenic
1005430404 6:25750773-25750795 CACTTGTGTGTGTGGGGGGAGGG + Intergenic
1006194050 6:32226971-32226993 CAATTGTGGGTATGGGGAAGAGG + Intergenic
1006425748 6:33961947-33961969 CAGTGGTGTGCCTGGGGAGGGGG - Intergenic
1007075326 6:39062533-39062555 CAGTTGGGAGGGTGGGGAGGTGG - Intronic
1007513155 6:42390293-42390315 AAGTTCTGTGTGTGTGGAGGGGG + Intronic
1008153579 6:47987245-47987267 CTGTTGTGGGTGGGGGGAGGGGG + Intronic
1008883885 6:56410936-56410958 CATATGTGTGTGTGGGGTGGGGG - Intergenic
1009420053 6:63455465-63455487 CATTTGTGAGTGGGGCGAGGTGG + Intergenic
1011227725 6:85126536-85126558 GATGTGTGCGTATGGGGAGGGGG - Intergenic
1011415914 6:87120067-87120089 CACTGGGGCCTGTGGGGAGGGGG - Intergenic
1012103922 6:95128467-95128489 GAGTTATGGGTTTGGGGAGGGGG - Intergenic
1012627730 6:101424713-101424735 CTGTTGTGGGTGGGGGGAGAGGG - Intronic
1013681790 6:112532441-112532463 CTGTTGTGGGTGGGGGGACGGGG - Intergenic
1014040797 6:116822705-116822727 CTGTTGTGGGTTGGGGGAGGGGG + Intronic
1014853760 6:126373830-126373852 CAGTTCTGAGTTTGGGGAGTGGG + Intergenic
1016538460 6:145135875-145135897 CAATTCTCCGTGTGGGGAGAGGG - Intergenic
1017024816 6:150172460-150172482 CTGTGGTGCAGGTGGGGAGGCGG + Intronic
1017515547 6:155152798-155152820 CTGTTGTGTGTGTGTGGTGGTGG + Intronic
1017554850 6:155551934-155551956 CAGTTTTGTGTGTCGGGGGGTGG + Intergenic
1018109112 6:160518322-160518344 CAGGTGTGTGTTTGGGGCGGTGG + Intergenic
1018607547 6:165613969-165613991 CAGTTTTGGGTGTGGGCAGGTGG - Intronic
1019311585 7:364437-364459 CAGTGGTGACAGTGGGGAGGGGG - Intergenic
1020579897 7:9983936-9983958 CATTTGTGTGTGTGTGGGGGGGG + Intergenic
1020705978 7:11544804-11544826 GAGTGGTGGGGGTGGGGAGGCGG - Intronic
1020733714 7:11918299-11918321 CAGGTGTGCTTGTGGTGAGGTGG - Intergenic
1023860577 7:44215758-44215780 CAGGTGTGTGGGTGGGCAGGTGG - Intergenic
1025152469 7:56569383-56569405 CAGTTGTCCGCGTGCGCAGGTGG - Intergenic
1026848819 7:73712319-73712341 CAGTTGTAGGTGTGGGGGAGTGG - Intronic
1027899580 7:84093781-84093803 CATTTGTGCCTCTGGGGAGTTGG + Intronic
1028509202 7:91604025-91604047 CTGGTGTGTGTGTGGGTAGGTGG + Intergenic
1028740717 7:94271258-94271280 CTGTTGTGGGTGAGGGGAGAGGG + Intergenic
1028821322 7:95215117-95215139 CTGTTGTGGGTGGGGGGAGGGGG - Intronic
1029128833 7:98314577-98314599 CAGCTGTGTGTGTTGGAAGGAGG + Intronic
1029655144 7:101919195-101919217 CAGGTGTGTGTGTGTGGGGGGGG + Intronic
1030699580 7:112622980-112623002 TATTTGTGTGTGTGTGGAGGGGG + Intergenic
1031691663 7:124795933-124795955 CAGAGGTGTGTGTGGGGAGAAGG - Intergenic
1032705622 7:134419171-134419193 CAGTTGTGGGTGTGACAAGGAGG - Intergenic
1033599898 7:142881811-142881833 CAGATGAGGGTGTGGGGCGGAGG - Intronic
1034439169 7:151077772-151077794 GAGGGGTGCCTGTGGGGAGGCGG + Exonic
1035709278 8:1700141-1700163 CAGTTGTGTGAGTACGGAGGAGG - Intronic
1035759974 8:2061965-2061987 CAGCTGTGGGTGAGGGGAGGGGG + Intronic
1035869699 8:3124131-3124153 CCTGTGTGCGTGTGGGGAGGGGG + Intronic
1037430987 8:18812957-18812979 CAGTTTTGCTTGTGGTGTGGAGG + Intronic
1037987761 8:23300210-23300232 CAGTGTTACGTGTGGGGTGGAGG + Intronic
1038103015 8:24400783-24400805 CTGTTGTGGGTGGGGGGAGGGGG - Intronic
1038285736 8:26204896-26204918 GAGATGTGTGTGTGGGGTGGGGG - Intergenic
1038441262 8:27572307-27572329 CAGCTGAGTGTGTGGTGAGGTGG + Intergenic
1038588768 8:28816299-28816321 CTGTTGTGGGTGGGGGGAGGGGG - Intronic
1038786479 8:30622119-30622141 CTGTTGTGGGTGGGGGGAGGGGG - Intronic
1038968046 8:32597842-32597864 CATATGTGCATGAGGGGAGGAGG + Intronic
1039439573 8:37585518-37585540 GAGTTGGGCCTGTAGGGAGGAGG - Intergenic
1040675312 8:49742139-49742161 AGGTTGTGTGTGGGGGGAGGGGG + Intergenic
1040696641 8:50007373-50007395 TAGTTGAGCTTGTGGGGAGGAGG + Intronic
1041297267 8:56370889-56370911 CTGTTGTGGGTGGGGGGAGGGGG - Intergenic
1042152465 8:65802944-65802966 CAAGTGAGAGTGTGGGGAGGGGG - Intronic
1042155436 8:65840967-65840989 CAGTTGTGTGTATGGGAAGGGGG + Intronic
1042522999 8:69734113-69734135 CACTTGTGCCTGGCGGGAGGTGG - Intronic
1043202071 8:77382851-77382873 CTGTCGTGGGTGGGGGGAGGGGG - Intergenic
1043343603 8:79272598-79272620 CTGTTGTGGGGTTGGGGAGGGGG - Intergenic
1043887747 8:85622044-85622066 TAGTGGTGCTGGTGGGGAGGTGG + Intergenic
1044037127 8:87320607-87320629 CACGTGTGTGTGTGGGGGGGCGG + Intronic
1044273129 8:90270085-90270107 CTGTTGTGGGTGGGGGGAGTGGG + Intergenic
1046392735 8:113597834-113597856 CACGTGTGTGTGTGTGGAGGGGG - Intergenic
1046880050 8:119298025-119298047 CTGTTGTGGGTGTGGGGAGGGGG + Intergenic
1048781148 8:138003473-138003495 CCCTTGTGTGTGTGGGGAGAGGG - Intergenic
1049095645 8:140546694-140546716 TATTTGTGCGTTTGGGCAGGAGG - Intronic
1049575753 8:143388899-143388921 CTGTGCTGCGGGTGGGGAGGAGG + Intergenic
1050400428 9:5247893-5247915 CTGTTGTGCAGGTGGGGTGGGGG + Intergenic
1052814589 9:33091400-33091422 CTGTTGGGGGTGGGGGGAGGGGG + Intergenic
1054356832 9:64070607-64070629 CAGCTGTGTGTGCGGGTAGGGGG - Intergenic
1055717842 9:79137906-79137928 GAGGTGTGTGTGTGGGGAGGGGG - Intergenic
1055893925 9:81153743-81153765 CAATGGTGTGTGTGTGGAGGGGG - Intergenic
1055898467 9:81207598-81207620 AGGTTGTGCATGTGTGGAGGTGG + Intergenic
1056799210 9:89679852-89679874 CAGTGTTGAGTGTGTGGAGGAGG + Intergenic
1056903808 9:90627090-90627112 AAGTTGGGGGTGTGGGGAGGAGG - Intronic
1056938112 9:90933319-90933341 AAGGTGTGGGTTTGGGGAGGAGG + Intergenic
1058643856 9:107112390-107112412 CTGTTGTGTGTGTGGGGAGACGG - Intergenic
1058847210 9:108972837-108972859 CAGATGTGTGTGTGGGTGGGGGG + Intronic
1061163445 9:128909338-128909360 CAGCTCTGCGTGTGGGCTGGCGG + Intronic
1061441951 9:130611234-130611256 CTCTTGTGCGTGTGGCCAGGAGG - Intronic
1061604031 9:131694944-131694966 CTGTTGTGGGTGGGGGGAGGGGG - Intronic
1061621454 9:131813827-131813849 CAGCTGTGCTGCTGGGGAGGAGG - Intergenic
1062503924 9:136863236-136863258 GGGTTGTGGGTTTGGGGAGGGGG - Intronic
1186163372 X:6801569-6801591 AAGGTGTGTGTGTGGCGAGGGGG - Intergenic
1186593790 X:10959142-10959164 CATATGTGTGTGTGGGGATGGGG - Intergenic
1186947225 X:14582213-14582235 CTGTTGTGGGGGTGGGGAGGGGG - Intronic
1188170462 X:26918182-26918204 TAGATGTGTGTGTGTGGAGGGGG + Intergenic
1188194023 X:27208437-27208459 CTGTTGTGGGGGGGGGGAGGGGG + Intergenic
1188736863 X:33727403-33727425 GAGTTATGTGTGTGGGGAGGTGG - Intergenic
1189136382 X:38555026-38555048 CAGTGGTGCCTCTGGGAAGGAGG - Intronic
1189609868 X:42720897-42720919 CTGTTGTGGGTGTGGAGAGGGGG - Intergenic
1189798735 X:44672586-44672608 CACTGGGGCTTGTGGGGAGGAGG + Intergenic
1189820852 X:44868908-44868930 CAGTTGTGTGTGTGTGTTGGCGG + Intergenic
1190595469 X:52049153-52049175 CTGTTGTGGGTAGGGGGAGGGGG + Intergenic
1190613355 X:52204920-52204942 CTGTTGTGGGTAGGGGGAGGGGG - Intergenic
1191810527 X:65182237-65182259 CACTAGTGCCTGTTGGGAGGTGG + Intergenic
1191879003 X:65825641-65825663 CTGTTGTGGGTGGGGGGAGGGGG + Intergenic
1192293498 X:69822843-69822865 CAGTTGTGGGGTGGGGGAGGGGG - Intronic
1193196637 X:78639691-78639713 CAGGTGTGGGGGTGGGGAGGTGG + Intergenic
1193454511 X:81713695-81713717 CTGTTGTGGGTGGGAGGAGGGGG + Intergenic
1193579536 X:83247178-83247200 CTGTCGTGAGTGGGGGGAGGGGG + Intergenic
1193642016 X:84020969-84020991 CACTTTTGTGTGTGGGGAGAAGG + Intergenic
1193698782 X:84739681-84739703 CAGCTGGGGCTGTGGGGAGGGGG - Intergenic
1196541625 X:116917287-116917309 CTGTTGTGGGTGGGGGGAGCGGG - Intergenic
1196794270 X:119489686-119489708 CAGGATTGGGTGTGGGGAGGTGG + Intergenic
1197719533 X:129735745-129735767 CAGTTCTGCAGGTGGGAAGGAGG - Intergenic
1197735400 X:129847058-129847080 GGGCTGTGTGTGTGGGGAGGAGG - Intergenic
1198420915 X:136470254-136470276 CAGTGATGAGTCTGGGGAGGTGG + Intergenic
1200737888 Y:6819824-6819846 CACTTGTGTCTGTCGGGAGGTGG + Intergenic
1201651297 Y:16290575-16290597 CTGTTGTGGGTTGGGGGAGGGGG - Intergenic