ID: 903872050

View in Genome Browser
Species Human (GRCh38)
Location 1:26442932-26442954
Sequence CCTCAGATAACAGAATTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 1, 2: 6, 3: 25, 4: 248}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903872050_903872056 30 Left 903872050 1:26442932-26442954 CCTTGAAATTCTGTTATCTGAGG 0: 1
1: 1
2: 6
3: 25
4: 248
Right 903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG 0: 1
1: 0
2: 1
3: 7
4: 95
903872050_903872054 26 Left 903872050 1:26442932-26442954 CCTTGAAATTCTGTTATCTGAGG 0: 1
1: 1
2: 6
3: 25
4: 248
Right 903872054 1:26442981-26443003 TTAATGTTAGTTAGATATCTTGG 0: 1
1: 0
2: 1
3: 24
4: 273
903872050_903872055 27 Left 903872050 1:26442932-26442954 CCTTGAAATTCTGTTATCTGAGG 0: 1
1: 1
2: 6
3: 25
4: 248
Right 903872055 1:26442982-26443004 TAATGTTAGTTAGATATCTTGGG 0: 1
1: 0
2: 1
3: 18
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903872050 Original CRISPR CCTCAGATAACAGAATTTCA AGG (reversed) Intronic
900135056 1:1113246-1113268 CCTCAGAAGAAAGAATTTGATGG - Intronic
900740723 1:4329179-4329201 GCTCAGATCAGAGGATTTCAGGG + Intergenic
900801803 1:4741726-4741748 CCTCAGTTTGCAGAATTTCTTGG + Intronic
900837266 1:5014604-5014626 CATCAGATAAGAGATTTTCAAGG + Intergenic
903872050 1:26442932-26442954 CCTCAGATAACAGAATTTCAAGG - Intronic
905486901 1:38305679-38305701 TCACAAATAACAGAATTTCCTGG - Intergenic
906292874 1:44631574-44631596 CCTCTGATAACAGAACTGGATGG + Intronic
906651306 1:47514994-47515016 CCTAAGATTCTAGAATTTCATGG + Intergenic
907336414 1:53702605-53702627 CCTCAGATAGCAGGATGTGAGGG + Intronic
909076965 1:71060816-71060838 CCACAGATAACAAAATTTCAAGG - Intergenic
911146362 1:94555890-94555912 CCACAGATAACTGATTATCAGGG - Intergenic
911269956 1:95788971-95788993 CCTCAGAAAACTTAATATCATGG - Intergenic
911747213 1:101453115-101453137 CCTCAGAAGAAAGAATTTGACGG - Intergenic
912004197 1:104876893-104876915 CCTCTGAAAACATAAATTCAAGG - Intergenic
912342442 1:108930420-108930442 CCTAAAAAAACAGATTTTCATGG - Exonic
912509458 1:110178720-110178742 CCTCACATGGCAGAAGTTCAAGG + Intronic
912541076 1:110416034-110416056 CCTCAGAGAAGAGAATGTCATGG + Intergenic
917176481 1:172241626-172241648 GCTCACAAAACAGAATTTCCTGG + Intronic
918152080 1:181806305-181806327 CCTCAAATAACAACATTGCAAGG + Intronic
918270357 1:182892671-182892693 CCTCAGAGGAAAGAATTTGAGGG + Intergenic
919697932 1:200598259-200598281 CCCCAGATAACTGAATATCATGG + Exonic
920395348 1:205641486-205641508 CCTCATATCAGAGAATCTCAAGG + Intergenic
921329833 1:214024477-214024499 CTTCAGAGAACACAAGTTCATGG - Intronic
921848959 1:219913761-219913783 ACTCAGATAATACATTTTCAAGG + Intronic
922088673 1:222375076-222375098 CCCAAGATAAGAAAATTTCAAGG + Intergenic
923387248 1:233477282-233477304 CCACAGAAAACAGCTTTTCAAGG - Intergenic
924593548 1:245426057-245426079 CCTGAGATAACAGAATGGAAAGG - Intronic
1063399078 10:5723746-5723768 CTTCAGAAAACAGAATTACTTGG + Exonic
1063817336 10:9790641-9790663 TCTCAGATCACAGAATTACAGGG + Intergenic
1064229561 10:13518044-13518066 CCTCAGAAAACAAAATCACAGGG + Intronic
1066170941 10:32844791-32844813 CATCACAAAACAGAATTTGAAGG - Intronic
1066388981 10:34963698-34963720 CTTTTGATAACAGGATTTCAAGG + Intergenic
1066701037 10:38128655-38128677 ACTCAGATTCCAGAATGTCATGG - Intergenic
1067893940 10:50159872-50159894 CCTCAGAAGAAAGAATTTGACGG - Intergenic
1067928266 10:50533250-50533272 CCTAAAATAAAAGAATTTCTTGG - Intronic
1068232284 10:54183577-54183599 CCAAAGATAACAGCATTTGATGG - Exonic
1069257279 10:66348845-66348867 GCTCAAATAACAAAATTTCCTGG + Intronic
1070523833 10:77277551-77277573 CCACAGACAACTGACTTTCAGGG + Intronic
1070689804 10:78516220-78516242 CCCCAGAAAACAGAATTTGAGGG + Intergenic
1071450977 10:85791147-85791169 CCTCAGATAAGAGCATTTCAGGG + Intronic
1077084127 11:739620-739642 CCTCAGATGACTGAATCGCACGG + Intergenic
1077674777 11:4186564-4186586 CCTCAGAACAAAGGATTTCATGG - Intergenic
1077702338 11:4453926-4453948 CCTCAGAAAAAAGAATTTTGAGG - Intergenic
1078617180 11:12877293-12877315 CCTCAAGTAACAGCTTTTCATGG - Intronic
1079116317 11:17642715-17642737 CCTCAGAGAAAAGGATTTCCTGG + Intronic
1081398222 11:42612409-42612431 CCACAGATAACTCAATTCCAGGG + Intergenic
1082201843 11:49381295-49381317 CCACAGAAAGGAGAATTTCAAGG - Intergenic
1082763787 11:57150502-57150524 GCTCTGATGACAGAATATCAAGG + Intergenic
1083263891 11:61537375-61537397 CCTCAGCTATCAGGAATTCAGGG - Intronic
1085873557 11:80379657-80379679 CCTAAGAGAACAGAATTTGGAGG - Intergenic
1086530337 11:87777541-87777563 CCTCAGGAAACATAATATCATGG - Intergenic
1087797747 11:102472440-102472462 CCTCAGAAGAAAGAATTCCACGG + Intronic
1088027260 11:105200284-105200306 GCCCAGATAGCAGAATTTGATGG + Intergenic
1088199850 11:107320653-107320675 CCTCAGCTGACAGAACTCCATGG - Intergenic
1088612440 11:111590693-111590715 CCTCAGGAAACAAAATTTAAGGG - Intergenic
1089659898 11:119978924-119978946 CCTGAGACAACAGAGCTTCAGGG + Intergenic
1093482202 12:19615951-19615973 CTTCTGATACCAGAATTACAGGG - Intronic
1093528510 12:20133704-20133726 CCTCAGAAAACAGATTCGCATGG + Intergenic
1094401764 12:30069645-30069667 CCTCAGAAGAAAGAATTTGACGG + Intergenic
1098043409 12:66375737-66375759 CATCAGATAACTCAATTTCTGGG + Intronic
1099362222 12:81718307-81718329 CCTCAGATAACTGAATGACTGGG - Intronic
1099707183 12:86170979-86171001 CCTCAGAGAACAGAATGTCCGGG - Intronic
1099873924 12:88381723-88381745 CCTCAGAAAACAAAAACTCAGGG - Intergenic
1100605039 12:96144762-96144784 ACCCTGAGAACAGAATTTCAGGG - Intergenic
1100736972 12:97546160-97546182 CCTCAGATAAAAGCCCTTCAAGG - Intergenic
1100770025 12:97911581-97911603 CCTCAGATAACATTCTTTCAGGG - Intergenic
1100849827 12:98697753-98697775 TGTTAGATAACAGCATTTCAAGG + Intronic
1101279675 12:103239567-103239589 CCTACCATAACAGAATCTCATGG + Intronic
1104299119 12:127547936-127547958 CCTCAAATAGCCGAAATTCATGG + Intergenic
1109976252 13:69836279-69836301 CCTCAGAAAAGAGAATGGCAGGG + Intronic
1110043530 13:70797634-70797656 ACTCACATAAAAGAATTTTATGG - Intergenic
1112220173 13:97480710-97480732 TCTCAGATACCAAAATTTGAGGG - Intergenic
1114924275 14:27375076-27375098 CGACAAATAACAGAATTTAAAGG + Intergenic
1117339321 14:54780269-54780291 CCTCACATGGCAGCATTTCATGG + Intronic
1117751005 14:58923998-58924020 CCTAAGATGACTGAATTTCCAGG + Intergenic
1118913870 14:70084773-70084795 GCTCAGAAAACTGGATTTCAGGG + Intronic
1119163848 14:72475992-72476014 TCTAACATTACAGAATTTCATGG + Intronic
1119689399 14:76659288-76659310 CCTCAAATTCCAGATTTTCAGGG + Intergenic
1120542485 14:85767084-85767106 CCTCAGTGAACTGAATTTGAGGG - Intergenic
1122486111 14:102081646-102081668 CCTCTGATAATATATTTTCAAGG - Exonic
1123542054 15:21303330-21303352 CATCAGATAAGAGAATATCAGGG - Intergenic
1127960055 15:63884160-63884182 ATTCTGATAACAGCATTTCAAGG + Intergenic
1128549709 15:68590372-68590394 CCTGAGAGAACAGAAGTGCAGGG - Intronic
1129188926 15:73926607-73926629 CCTCCGATGACAGCATTTCAAGG - Exonic
1130943037 15:88527020-88527042 CCTCAGAGAGCAGAAACTCAAGG - Intronic
1131367997 15:91855395-91855417 CCTGGGGTGACAGAATTTCAGGG + Intronic
1131549052 15:93340838-93340860 CCTCAAATCAAAGAACTTCAAGG - Intergenic
1202950372 15_KI270727v1_random:30470-30492 CATCAGATAAGAGAATATCAGGG - Intergenic
1132463122 16:65247-65269 CCTCAGACAACATAAGTCCATGG + Intronic
1134042056 16:11076393-11076415 CCACAGAAAACAGGAATTCATGG + Intronic
1135039217 16:19105033-19105055 CCTCAGAAAACAGAACCTAAGGG - Intergenic
1136042930 16:27594532-27594554 TCTCAGATCTCACAATTTCATGG + Intronic
1139658907 16:68406790-68406812 ACTCAGAAAACACAGTTTCAGGG + Intronic
1144506944 17:15839934-15839956 CCTCAAATAATAGAATTTGAAGG + Intergenic
1144679669 17:17184648-17184670 CCTCCAATAACAGCATTTCCCGG + Intronic
1144769899 17:17753651-17753673 CCTCAAATCACAGATTTTAAGGG + Intronic
1145171125 17:20657847-20657869 CCTCAAATAATAGAATTTGAAGG + Intergenic
1145212807 17:21027473-21027495 CATCAAATTACAGAACTTCAGGG + Intronic
1146173997 17:30653254-30653276 TCTCAGATAACAGATGTTCCTGG + Intergenic
1146347451 17:32069281-32069303 TCTCAGATAACAGATGTTCCTGG + Intergenic
1147362555 17:39940741-39940763 TCTCAAAAAAAAGAATTTCAAGG - Intergenic
1149156306 17:53633722-53633744 TACCAGATTACAGAATTTCAAGG - Intergenic
1150040676 17:61857324-61857346 CCTAAGATAAAAGATTTTTAGGG + Intronic
1151355964 17:73558724-73558746 CCCAAGTTAACAGAACTTCAGGG + Intronic
1155114523 18:22751615-22751637 CCACAAATAACAGAATGTCCTGG + Intergenic
1157707610 18:49820688-49820710 CCTCAGAAGAAAGAATTTGAGGG - Intronic
1158353638 18:56591844-56591866 CCCCAAATAACTTAATTTCATGG - Intergenic
1158753507 18:60294434-60294456 TCACAGATGACAGAATTTCCTGG + Intergenic
1159626105 18:70696568-70696590 CCTCAGAAAACTTAATATCATGG - Intergenic
1162988414 19:14286776-14286798 TCTCAGATAACAGATGTTCCTGG - Intergenic
1163866193 19:19775443-19775465 CCTGAGAACACAGAATTTTAGGG + Intergenic
1168118384 19:54238997-54239019 CCTCAAATAACAGAATCCCGAGG + Exonic
1168133149 19:54333673-54333695 CCTCAAATAACAGAATCCCGAGG + Exonic
925374021 2:3369227-3369249 CCTCAGAAAATAATATTTCAGGG + Intronic
930202994 2:48562288-48562310 TCTCAAACAACAGAATATCAAGG - Intronic
931631454 2:64304910-64304932 TCTCAAATAACAGAATTTGAGGG + Intergenic
933721048 2:85398071-85398093 CATCAGATATCAGCAGTTCAAGG + Exonic
934868421 2:97836081-97836103 CCTCAAACACCACAATTTCAAGG + Intronic
935365688 2:102288067-102288089 CTTCAGATAAGAGAAGTTAAGGG + Intergenic
935966963 2:108488253-108488275 CCAAAGAGAACAGAATTTCTTGG + Intronic
939329917 2:140744330-140744352 GCACATATAACAAAATTTCATGG + Intronic
940103557 2:150070651-150070673 CCTTAGTTAACAGAATGGCATGG + Intergenic
940652832 2:156454631-156454653 ACTCAGAGAAGAGAATTTAATGG + Intronic
942974728 2:182002011-182002033 ACCCAGATAACAGAAATACATGG - Intronic
943700920 2:190987598-190987620 CCCCAGATAACTGACTTTCCTGG - Intronic
944343540 2:198633072-198633094 CCTCAGATAACAAAATCTACAGG - Intergenic
944914519 2:204344433-204344455 CCTCAGAAAAAAGAATTCAAGGG - Intergenic
945195417 2:207232885-207232907 CATCACCTTACAGAATTTCATGG - Intergenic
945807173 2:214503916-214503938 CCACAGATGGAAGAATTTCAAGG - Intronic
948002741 2:234581630-234581652 CCTCAGATTCCAGAATTTCCGGG - Intergenic
1169527950 20:6450801-6450823 ACTCATAAAAAAGAATTTCAAGG + Intergenic
1169648929 20:7845336-7845358 CCTCAGATGACAGAACTGAAGGG + Intergenic
1172666208 20:36602067-36602089 CCTCATATCACTGATTTTCAGGG - Intronic
1173086870 20:39928831-39928853 CTTCATACAGCAGAATTTCAAGG - Intergenic
1173348583 20:42223641-42223663 CCTTAGATCCCACAATTTCATGG + Intronic
1173747378 20:45448264-45448286 CCTCAGATGTCAGCATCTCAAGG - Intergenic
1173933553 20:46841721-46841743 ACTCAAATAACCTAATTTCAAGG + Intergenic
1174732854 20:52935064-52935086 CCTCAGATAGTAGACTTTTATGG - Intergenic
1177140927 21:17357148-17357170 CCACAGATTATAGAATGTCATGG - Intergenic
1177591570 21:23176510-23176532 TCTCAGGTAAAACAATTTCATGG - Intergenic
1177670264 21:24215427-24215449 CTTCAAAGAACAGAAATTCAAGG + Intergenic
1179235022 21:39538249-39538271 CCTCAGAAGAAAGAATTTGACGG + Intergenic
1184297699 22:43535704-43535726 CCTGAAAGAACAGAATGTCAGGG + Intronic
1185126879 22:49016288-49016310 CCTGAGATAAAAGAATTACTCGG - Intergenic
949999801 3:9648369-9648391 CTTCTCATCACAGAATTTCAAGG + Intergenic
950683212 3:14599480-14599502 CCTCAGATAACAAAAGTTCAAGG - Intergenic
950683255 3:14599800-14599822 CCTCAGATAACAGAAGTTCAAGG + Intergenic
951033257 3:17905961-17905983 TCTGAGATAAGAGAAGTTCAAGG - Intronic
952412188 3:33059316-33059338 TCTCAGGTAATAAAATTTCATGG + Intronic
956019412 3:64917460-64917482 CCTCAGGAAACAGTTTTTCAGGG + Intergenic
956641811 3:71422805-71422827 ACTGAGATGAAAGAATTTCAAGG - Intronic
957573224 3:81975692-81975714 CCTCAGTAAATAGAAGTTCAAGG + Intergenic
957667309 3:83249551-83249573 CCTAAGATACCTGAATTTGAAGG + Intergenic
957764145 3:84599815-84599837 TCTCAGAAAATAGAATTTCATGG + Intergenic
958532448 3:95350586-95350608 CCTCAGAAGAAAGAATTTGAAGG - Intergenic
959552967 3:107684625-107684647 ACTCACATGACTGAATTTCAGGG + Intronic
959649536 3:108738141-108738163 CCTCAGAAGAAAGAATTTGACGG - Intergenic
959942811 3:112097029-112097051 TCTCAAATAACAGAATTCCCTGG - Intronic
960747911 3:120909312-120909334 CCTCACACATCAGATTTTCAAGG - Intronic
961157876 3:124696151-124696173 CATCAGATTACAGATCTTCAGGG - Intronic
964480420 3:157133441-157133463 GCTCAGAGGACACAATTTCAGGG + Intergenic
965659180 3:171022663-171022685 CCCCAGAGAACAGAAATCCAGGG - Intronic
967684562 3:192405179-192405201 CCTCACATCACACAGTTTCAGGG - Intronic
967982870 3:195076157-195076179 CCTGAGAGAACAGAGGTTCAGGG + Intronic
972316414 4:37930672-37930694 CCACAGAACACAGCATTTCAAGG - Intronic
972693071 4:41418753-41418775 CCTGAGTTAACAGAGTTTCATGG - Intronic
972986489 4:44772255-44772277 CCTCAGAAGAAAGAATTTGAAGG - Intergenic
972987141 4:44778396-44778418 CCTCAGAGGAAAGAATTTGAGGG - Intergenic
973948571 4:55986855-55986877 ACTCAGATGACAGAATTAGAAGG - Intronic
977982769 4:103344896-103344918 CAACAGACAACAGAATCTCACGG + Intergenic
978463832 4:108986248-108986270 CCTCAGCTCAAAGAACTTCAGGG + Intronic
979742033 4:124163008-124163030 CTTCAGATAAAAATATTTCAAGG - Intergenic
979782835 4:124676860-124676882 GGTCAGATAGCAGAATTTCATGG + Intronic
980504941 4:133706229-133706251 TCTCAGATAACAGAAATTATAGG - Intergenic
981027067 4:140087374-140087396 TCCCAAATAACAGAATGTCAAGG - Intronic
981756432 4:148145558-148145580 CCTCAGAAGAAAGAATTTGAGGG - Intronic
983153993 4:164321566-164321588 CATCAGATGAAAGAATTTAATGG + Intronic
984173891 4:176392383-176392405 CTTCAGAAATAAGAATTTCAGGG + Intergenic
986790849 5:11158340-11158362 CCAAGGATAACAGAATTTAAGGG + Intronic
987689206 5:21245217-21245239 CCTAGGAGAACAGAATTTAAGGG + Intergenic
987734269 5:21819287-21819309 CCTCATTAAACAGAAGTTCAGGG - Intronic
987972292 5:24963397-24963419 CCTCATATCTGAGAATTTCATGG + Intergenic
988428454 5:31091528-31091550 CCTGAGATACCAGATTTTAACGG + Intergenic
988490589 5:31701934-31701956 CCTCAGACATCAGGATTTGAGGG + Intronic
988922340 5:35954932-35954954 CCTCACTTAACTGAAATTCATGG + Intronic
990497652 5:56364697-56364719 ACTCAGATAACAGCTCTTCAAGG + Intergenic
992034159 5:72754887-72754909 CCTCAGGTAAGAGAAATGCATGG + Intergenic
992502488 5:77356320-77356342 GCTCAGACTTCAGAATTTCAAGG + Intronic
992998808 5:82359081-82359103 GCTCAGAGGACAGAAATTCATGG - Intronic
993682851 5:90901126-90901148 CCTCAGATCAGAGACTCTCATGG + Intronic
994297386 5:98106944-98106966 ACTAATATAACGGAATTTCAGGG + Intergenic
996838152 5:127816877-127816899 TCTCAGATAAAAGAAAATCAAGG + Intergenic
998902698 5:146872901-146872923 CCTCAGATAAGAACATTTCAGGG - Intronic
999182960 5:149682965-149682987 CATCAAGTAACAGCATTTCAAGG - Intergenic
1001052902 5:168426999-168427021 CCTCAGATCAGAGACTTTCAAGG + Intronic
1002802985 6:544030-544052 GCTCAGAGAACAGAAATACAGGG + Intronic
1003104907 6:3208054-3208076 CCACAGTTGAGAGAATTTCAGGG + Intergenic
1003840117 6:10111430-10111452 CCGCATAACACAGAATTTCAAGG + Intronic
1003895930 6:10607569-10607591 CCTCACCTAACAGTATGTCATGG + Intronic
1004897669 6:20164311-20164333 CCTCAAATAAGAGACTTACAAGG + Intronic
1006891839 6:37435350-37435372 TGTCAGATAACAGAAAGTCATGG - Intronic
1007681732 6:43638343-43638365 CCTCAGGCAAAAGAAGTTCATGG - Intronic
1008415464 6:51234718-51234740 GCTCAGCTAACAGAATTGGAAGG - Intergenic
1008486569 6:52042431-52042453 CCTCAGAAAGCAGAAAGTCATGG + Intronic
1011185239 6:84667889-84667911 CATCAGATAACAAAAGGTCAGGG + Intergenic
1011283781 6:85703334-85703356 CATTAGATAAAAGAATTTAAAGG - Intergenic
1012375914 6:98561356-98561378 CTTTAGAAAACAGAATTCCATGG + Intergenic
1013760115 6:113508512-113508534 CCACAGAAAACATAATTTCTTGG + Intergenic
1014553203 6:122812753-122812775 CATCAGATAACAAAATTATAAGG + Intergenic
1015176411 6:130313762-130313784 CCTCTGATAGCAGGACTTCAGGG - Intronic
1015327336 6:131937858-131937880 GCTCAGCTAACCGAATTACATGG - Intergenic
1016359039 6:143248527-143248549 CCTCAGAGAACAGCTTTTCTGGG + Intronic
1016549561 6:145262663-145262685 TCACAGATAACAAAATTTTAAGG + Intergenic
1016899303 6:149085828-149085850 CTTCAGATAACACATTTACATGG - Intergenic
1017617203 6:156258134-156258156 CCTGCTATAACAGAATATCATGG - Intergenic
1017897275 6:158691588-158691610 CATCAAGTAACAGAATGTCATGG - Intronic
1021511077 7:21433101-21433123 CCTCAGAGAACAGATTTTGGTGG + Intronic
1022041492 7:26586169-26586191 CCTGGGATCACAGAATTTCGAGG - Intergenic
1022634217 7:32116668-32116690 CCTCAGCTTCCAGATTTTCAAGG - Intronic
1025555216 7:62299059-62299081 CATCACAGAACAGAATTGCATGG + Intergenic
1027899198 7:84087783-84087805 TTTCAGAGAACAGAAGTTCATGG - Intronic
1027935322 7:84594452-84594474 CCCCAAATCACAGAATTACATGG + Intergenic
1028037664 7:86004696-86004718 CATTAAATAACAGATTTTCATGG - Intergenic
1028326777 7:89537529-89537551 CCTCAGAAAGCAAAATTTCTTGG + Intergenic
1028371258 7:90095146-90095168 CCACAGAGAACACAATTTCCAGG - Intergenic
1028392572 7:90334159-90334181 CCTCAGAATAAAGAATTTGATGG - Intergenic
1028729685 7:94131372-94131394 CCTCAGCTAAGAGATTCTCATGG + Intergenic
1029035073 7:97510915-97510937 ACTCAGATAACAATATATCAGGG - Intergenic
1031278936 7:119770427-119770449 CCTCTGAAAATAAAATTTCATGG + Intergenic
1031785873 7:126031192-126031214 AATCAGATAACAGAATTGAAAGG - Intergenic
1034462738 7:151206957-151206979 CCTCAGCTCACAGAACCTCAAGG + Intergenic
1034655725 7:152728224-152728246 CTCCAGATAATAAAATTTCATGG - Intergenic
1038207710 8:25483179-25483201 CTTTAGAAAACAGAATTTTAGGG - Intronic
1038428606 8:27481789-27481811 CCATAGAAAACAGAATTTCAAGG - Intergenic
1039558445 8:38494113-38494135 CCTCAGATAACCAAAGATCAGGG + Intergenic
1039641268 8:39225682-39225704 CCTCAGCTGACAGAAATGCATGG + Intronic
1040395384 8:46993950-46993972 CCTCAGATCTCTAAATTTCAGGG + Intergenic
1041544797 8:59030904-59030926 CATCATACATCAGAATTTCATGG + Intronic
1041605647 8:59779817-59779839 CCTCAGAAGAAAGAATTTGACGG - Intergenic
1044310122 8:90684014-90684036 CCACAGGTCACAGAATCTCAAGG - Intronic
1044634592 8:94309935-94309957 CCTCAGAAGAAAGAATTTGAGGG + Intergenic
1044706282 8:95011719-95011741 ACTCCTAAAACAGAATTTCAGGG + Intronic
1046062801 8:109158986-109159008 TCTATGATAAGAGAATTTCACGG + Intergenic
1046298367 8:112252888-112252910 CCCCAAATAACATAAATTCAGGG + Intronic
1047152948 8:122285033-122285055 CCTCAGAAGAAAGAATTTGACGG - Intergenic
1048566357 8:135601999-135602021 CCTCAGATAAAAAAATCTTAAGG + Intronic
1049557207 8:143289095-143289117 CCTTAGCAAACAGAATTCCAGGG + Intergenic
1049874592 8:145008080-145008102 CCTCAGAAGAAAGAATTTGACGG + Intergenic
1049964406 9:765482-765504 CCTCAGAAGAAAGAATTTGAGGG - Intergenic
1050654731 9:7814865-7814887 CCTCACATAACAAAATGTCATGG - Intronic
1051333930 9:16049542-16049564 CCTTGGATATCAGAACTTCAGGG + Intronic
1051339517 9:16098620-16098642 CCTTAGAACACAGAATTACAAGG + Intergenic
1052528290 9:29650075-29650097 CCTCAGAAGAAAGAATTTGAGGG + Intergenic
1052604677 9:30683820-30683842 CCTCAGAAAACAAAATCTGAGGG + Intergenic
1052669616 9:31539104-31539126 CCTCAGAAGAAAGAATTTGATGG - Intergenic
1054876465 9:70102360-70102382 CATTAGCTAACAGAATTCCATGG + Intronic
1055422995 9:76163229-76163251 TCTCAGAAAACAGACTTTCAAGG - Intronic
1061462228 9:130749411-130749433 GCTCAGAAAACAGAATTACATGG + Intronic
1062372015 9:136245025-136245047 CCTCAGAGAACAGGAATTCTGGG + Intronic
1186503990 X:10075387-10075409 CCTCAGATAATATAATAACAAGG - Intronic
1187313462 X:18168793-18168815 CCTCAAATAACAAAATATTAGGG + Intronic
1187694680 X:21907039-21907061 ACTCAGAAAACAAAATTCCATGG - Intergenic
1188820564 X:34769905-34769927 TCTCAGATACCAGCAGTTCAAGG - Intergenic
1190084073 X:47380200-47380222 CCTCAGAAAAAAGAATTTGAGGG + Intronic
1192247119 X:69382694-69382716 TCTCAAATAACAGAATTCCAGGG - Intergenic
1195277376 X:103294866-103294888 CATCAGTTGACAGAACTTCATGG - Intergenic
1195850120 X:109273721-109273743 CCTCAGATATCAGAATACCCGGG + Intergenic
1196942061 X:120786880-120786902 CCTCTGATAGCAGACTTTCTGGG + Intergenic
1197059474 X:122160243-122160265 CCTCAGCTAACAGAGCTGCATGG + Intergenic
1198927710 X:141817468-141817490 CCTCACTTACGAGAATTTCAAGG + Intergenic
1199347314 X:146756899-146756921 CCTCAGAAAAAAGAATTCGACGG + Intergenic
1199723116 X:150557476-150557498 CCTCAGGAAACAGAATCTCTGGG + Intergenic
1199749901 X:150805690-150805712 CCTCACTGAACAGTATTTCATGG - Intronic
1201565452 Y:15360757-15360779 CCTCAAATACCAATATTTCAAGG - Intergenic
1202108869 Y:21400865-21400887 CTTCAGTTAACAGTATTTCTAGG - Intergenic
1202187299 Y:22199078-22199100 CTTCACTTAACAGCATTTCAAGG + Intergenic
1202188124 Y:22210057-22210079 CTTCACTTAACAGCATTTCAAGG + Intergenic
1202204061 Y:22387318-22387340 CTTCACTTAACAGCATTTCAAGG - Intronic
1202240952 Y:22769106-22769128 CCTCACTTAACAGAATTTCAAGG - Intergenic
1202393938 Y:24402849-24402871 CCTCACTTAACAGAATTTCAAGG - Intergenic
1202476847 Y:25267243-25267265 CCTCACTTAACAGAATTTCAAGG + Intergenic