ID: 903872056

View in Genome Browser
Species Human (GRCh38)
Location 1:26442985-26443007
Sequence TGTTAGTTAGATATCTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903872050_903872056 30 Left 903872050 1:26442932-26442954 CCTTGAAATTCTGTTATCTGAGG 0: 1
1: 1
2: 6
3: 25
4: 248
Right 903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG 0: 1
1: 0
2: 1
3: 7
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903872056 Original CRISPR TGTTAGTTAGATATCTTGGG TGG Intronic
901247181 1:7741265-7741287 TGCTAGTTAGAAATGTTGGCCGG + Intronic
903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG + Intronic
909241254 1:73216803-73216825 TGTAAGTATGAAATCTTGGGGGG - Intergenic
911849678 1:102802345-102802367 TGGTAGTTATATATCTAGGATGG + Intergenic
918233281 1:182555027-182555049 TGTTACATGGATATATTGGGAGG + Intronic
919888044 1:201949446-201949468 TTTTAGTTAGGTATGTTGGGTGG + Intergenic
921030286 1:211330252-211330274 AGTAAGTGAGATATCCTGGGAGG - Intronic
923351027 1:233106840-233106862 TGTAAGTTAGATATCCAGAGAGG - Intronic
923900664 1:238322791-238322813 TCTTAGTCAGATATCTGGAGAGG + Intergenic
1067857970 10:49813492-49813514 TGTTAGGAAGATATCTTTGGGGG - Intergenic
1068444914 10:57108538-57108560 TGTTAAATTGATATCTTTGGGGG - Intergenic
1072419947 10:95281810-95281832 AGTTATTTAGATATCTTGTTTGG - Intronic
1086730963 11:90249232-90249254 TTTTAGTTAGATATATGGAGTGG - Intergenic
1087336145 11:96847516-96847538 TGTTTGTCAGATATCTTGAAAGG - Intergenic
1089854410 11:121529937-121529959 TTTTATTTAGATTTTTTGGGGGG + Intronic
1093084149 12:14848094-14848116 AGTTACTTACATATCTAGGGAGG + Intronic
1093102182 12:15040582-15040604 TTTTAGTGAGATATGCTGGGAGG + Intergenic
1095922589 12:47545655-47545677 TGTAAGTGACATATCTTGGAGGG - Intergenic
1096947587 12:55424529-55424551 TGTTAGCCAGGTATCTGGGGAGG - Intergenic
1099075900 12:78107853-78107875 GGTTAGTTAGATTTCTCTGGTGG - Intronic
1099473424 12:83077963-83077985 TGCTAGTTAGGTATTGTGGGGGG - Intronic
1103014979 12:117487310-117487332 TGTTAGTCAAAGATCATGGGTGG - Intronic
1106099837 13:26684612-26684634 TGTGATTTTGATATTTTGGGTGG + Intronic
1106651933 13:31700632-31700654 AGTGAGTTAGATCTCATGGGAGG - Intergenic
1106919217 13:34545172-34545194 TTTTAATCAGATAACTTGGGGGG + Intergenic
1108488162 13:50949515-50949537 TGTGACTAAGATATCTTTGGGGG + Intronic
1112140783 13:96639591-96639613 TGTTATTTGGATATATTGTGTGG + Intronic
1112429605 13:99339142-99339164 TGTCTATTAGATATCTTGGGGGG - Intronic
1115903731 14:38183936-38183958 TGTAAGCTAGATCTCTTGAGGGG + Intergenic
1119955517 14:78794458-78794480 TTTTAGTGAGTTATCTTGGAAGG + Intronic
1120815193 14:88849452-88849474 TCATATTTAGATACCTTGGGTGG + Intronic
1126518835 15:49565725-49565747 TGATAGTTAAAGATCTTCGGTGG + Intronic
1129222586 15:74140252-74140274 TGTTATTTTGATGTCATGGGTGG - Intergenic
1130874609 15:88002480-88002502 TGTTAGTTAGATATATTAATTGG - Intronic
1131016948 15:89065771-89065793 TGTTATTTCTATATCATGGGGGG - Intergenic
1131665959 15:94571372-94571394 TTTTAGTTAAATATCTGGGAAGG + Intergenic
1141842442 16:86581946-86581968 TGTTTGTATGTTATCTTGGGAGG + Exonic
1147255062 17:39176453-39176475 TGTTACCTAGAGATCTGGGGTGG + Intronic
1150524419 17:65907374-65907396 TGTTAGTTTGATATTTTGCCAGG + Intronic
1153575903 18:6521542-6521564 TTTTAGTCAGATATTTTTGGGGG + Intronic
1153762803 18:8348092-8348114 TGTCATTTTGATTTCTTGGGTGG - Intronic
1154094634 18:11401047-11401069 TGTTAGTTAGCTACCTTGTGAGG + Intergenic
1155351316 18:24910123-24910145 TGTTAGTGAGTTATCTGGGATGG - Intergenic
1156212497 18:34960406-34960428 TGTTAGTTAGATGGCTTTGTGGG - Intergenic
1158750544 18:60254209-60254231 TGTTAGTTAGAAGTCTTGGTTGG - Intergenic
1165521359 19:36316764-36316786 AGTGGGTTAGTTATCTTGGGAGG - Intergenic
1165622702 19:37261825-37261847 AGTGGGTTAGTTATCTTGGGAGG + Intergenic
1165634408 19:37328459-37328481 GGTGGGTTAGTTATCTTGGGAGG + Intronic
1168535171 19:57163078-57163100 TGGAAGTTAGATATCATGGCAGG - Intronic
925422160 2:3721452-3721474 TTTTAGTTGGATATTTTGTGTGG + Intronic
925753558 2:7111173-7111195 TGTCCTTTAGATATCTTGAGGGG + Intergenic
932441667 2:71741182-71741204 TGCTAGTTAAGTATCTTAGGTGG + Intergenic
935828753 2:106977290-106977312 TGTTAGTCTTAGATCTTGGGAGG + Intergenic
940063841 2:149604170-149604192 TGTCATATAGCTATCTTGGGAGG - Intergenic
943986219 2:194622561-194622583 TGTCAATTAGATATTTTGGCTGG + Intergenic
944677326 2:202044574-202044596 TGTTAGTTAGATATCATGGAGGG + Intergenic
944911462 2:204314441-204314463 TGGTAGTTAACTATATTGGGGGG - Intergenic
1170330223 20:15201285-15201307 GGTATGTTAGATATCTGGGGAGG - Intronic
1170831236 20:19842657-19842679 TCTCAGTTAGAACTCTTGGGTGG - Intergenic
1172862080 20:38062442-38062464 TATTAGTTGGATATCTTGATAGG + Intronic
1180938132 22:19639395-19639417 TGATGTTTTGATATCTTGGGAGG + Intergenic
1180997178 22:19971375-19971397 GGTTAGTTAGAGCTCCTGGGGGG + Intronic
955038095 3:55288611-55288633 TTTTAGTTTGAAGTCTTGGGTGG - Intergenic
959452257 3:106518029-106518051 TGTTAGTGAGGTATTTTTGGTGG - Intergenic
959651524 3:108755699-108755721 TTTGAGTTAGATTTCTTGGTTGG + Exonic
962873325 3:139517134-139517156 TGTTGGTTGGATCTCTAGGGTGG + Intergenic
963291655 3:143496383-143496405 TGTTAGGTAAATATCTCTGGAGG + Intronic
976979681 4:91211853-91211875 AGTTTGTTAGAGATCTTTGGAGG - Intronic
977512266 4:97976292-97976314 TGTTATTTATATATCTTAAGTGG - Intronic
981050430 4:140304377-140304399 TTCTAGTTAGATATCCTGGTAGG + Intronic
981154094 4:141413580-141413602 TTTTAATTAGATATATTGTGTGG + Intergenic
988128391 5:27073080-27073102 TGTTAGCTAGAGACCTTGGTGGG - Intronic
988616043 5:32775852-32775874 TGTTATTAAGAAAGCTTGGGAGG - Intronic
994515979 5:100773470-100773492 TGTTAGGACCATATCTTGGGGGG + Intergenic
996806582 5:127462302-127462324 TGAGAGTCAGCTATCTTGGGTGG + Intronic
996973367 5:129399658-129399680 TGTTAGATGGATATTTTGGGTGG + Intergenic
997393918 5:133541190-133541212 TGTAGGTCAGATATCTGGGGAGG + Intronic
998020291 5:138764415-138764437 TGTGAGTTTGATCCCTTGGGAGG + Intronic
999950138 5:156640197-156640219 TGATAGTAAGATTTCATGGGAGG - Intronic
1008155594 6:48010246-48010268 TGTTAGATAAACATCTTGGCAGG - Intronic
1012530120 6:100225510-100225532 GGTTAGTGTGATCTCTTGGGTGG + Intergenic
1013015017 6:106153068-106153090 TGTTAGTCAACTTTCTTGGGTGG + Intergenic
1022419411 7:30206433-30206455 TGTTGGTTGGATATCCTAGGAGG - Intergenic
1024433959 7:49326972-49326994 TGTCAATTAGATATTTTGGCTGG - Intergenic
1027515972 7:79142239-79142261 TGTTATTTGGATATCTTGATTGG + Intronic
1029959990 7:104680499-104680521 TGATAGGGAGATATTTTGGGCGG - Intronic
1031295567 7:119998181-119998203 GGTGGGCTAGATATCTTGGGAGG + Intergenic
1031627245 7:124005088-124005110 TGTCAGTTAGAGAGCTTGGGTGG + Intergenic
1035968875 8:4225341-4225363 TGTTAATTACATATTTTAGGTGG - Intronic
1039429176 8:37512162-37512184 TGTTAGTAAGATTTCATGTGGGG + Intergenic
1039811613 8:41054198-41054220 GGGTAGTGAGATATCTAGGGTGG - Intergenic
1040071232 8:43190398-43190420 TGTTAGTTATCTAGTTTGGGGGG + Intronic
1043771935 8:84214160-84214182 TGTTAGGTTGTTACCTTGGGTGG + Intronic
1044125796 8:88457049-88457071 TGTTGGCTAGAGAGCTTGGGTGG - Intergenic
1047089183 8:121555052-121555074 GGTTGGTTAGATATCTTTGCTGG - Intergenic
1048030372 8:130626025-130626047 TTTTAGATAAATATTTTGGGAGG - Intergenic
1056818601 9:89820316-89820338 TCATAGCTAAATATCTTGGGTGG - Intergenic
1058999625 9:110335150-110335172 TGTCAGTTAGGGATCATGGGAGG - Intronic
1187107199 X:16255747-16255769 AGATAGATAGATATATTGGGGGG + Intergenic
1188093811 X:25997271-25997293 TGTTAGTTTGCTATCTTGTCAGG + Intergenic
1196970382 X:121101348-121101370 GGTTACCTAGATATTTTGGGGGG + Intergenic
1196989174 X:121308951-121308973 TGTTAGTTGGACATCTTGCCAGG + Intergenic
1197100083 X:122642440-122642462 CATGAGTTAGATACCTTGGGGGG + Intergenic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic