ID: 903874307

View in Genome Browser
Species Human (GRCh38)
Location 1:26462309-26462331
Sequence TAGAATATGACGGCCAGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 879
Summary {0: 1, 1: 1, 2: 4, 3: 89, 4: 784}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903874307 Original CRISPR TAGAATATGACGGCCAGGCA TGG (reversed) Intronic
900110367 1:1002930-1002952 TAGAATCTCCTGGCCAGGCACGG - Intergenic
900221320 1:1510782-1510804 CAGAAAATGCCGGCCAGGCGCGG - Intergenic
900784466 1:4639051-4639073 TAGCAAAAGAGGGCCAGGCATGG - Intergenic
901155464 1:7134596-7134618 AAGAAAATGTGGGCCAGGCATGG - Intronic
901212326 1:7533620-7533642 TAGAAAACGTCGGCCGGGCACGG + Intronic
901277756 1:8005910-8005932 AAGAAAAAGAAGGCCAGGCACGG - Intronic
901430984 1:9214793-9214815 TAAAAAAAGAAGGCCAGGCATGG + Intergenic
901620844 1:10585627-10585649 TAGAATCAGAAGGCCAGGCGTGG + Intronic
901869464 1:12129121-12129143 AAGAATTTTAAGGCCAGGCATGG - Intronic
902307390 1:15552195-15552217 TAAAATATGTTGGCCAGGCGTGG + Intronic
903488090 1:23706505-23706527 TAAAATAAAAAGGCCAGGCACGG + Intergenic
903874307 1:26462309-26462331 TAGAATATGACGGCCAGGCATGG - Intronic
904040703 1:27583156-27583178 TAGAAATAAACGGCCAGGCATGG - Intronic
904047975 1:27620321-27620343 AATAATATCAAGGCCAGGCATGG + Intronic
904146540 1:28396981-28397003 AAGCATATCACGGCCAGGCACGG - Intronic
905071992 1:35234515-35234537 TACAATTTGTTGGCCAGGCACGG + Intergenic
905136628 1:35805587-35805609 TAGAGTATGGTGGCCGGGCATGG + Intergenic
905147611 1:35900435-35900457 TAAAATATGAAGGTCAGGCATGG + Intronic
905425986 1:37885121-37885143 TAAAATAAGAAGGCCGGGCACGG + Intronic
905441336 1:37998098-37998120 TGGAATATGGAGGCCAGACATGG - Exonic
905663582 1:39747754-39747776 GAGAAGATGTGGGCCAGGCATGG - Intronic
905755762 1:40507934-40507956 GACAATATGAAGGCCGGGCACGG - Intergenic
905767979 1:40618858-40618880 TAGATAATCTCGGCCAGGCATGG - Intergenic
905944392 1:41889620-41889642 TAGAGTATGAAAGCCCGGCAGGG + Intronic
906066842 1:42986735-42986757 TAGAGTATCTTGGCCAGGCATGG + Intergenic
906103466 1:43277664-43277686 TAGAAGCTGAGGGCCAGGCCCGG + Intergenic
906170099 1:43717796-43717818 TAGAAAATACAGGCCAGGCACGG - Intronic
907169321 1:52447157-52447179 TGGAAAATTAGGGCCAGGCACGG + Intronic
907368944 1:53985730-53985752 TATACAATGTCGGCCAGGCACGG - Intergenic
907434858 1:54438734-54438756 AAGAAAATTAAGGCCAGGCATGG - Intergenic
908047079 1:60182651-60182673 TAAAAGATGACAGCCAGGCACGG - Intergenic
908392128 1:63693222-63693244 AATAATATGAGGGCCAGGCATGG + Intergenic
909509445 1:76435079-76435101 TATAAAATGGTGGCCAGGCACGG - Intronic
909746520 1:79104615-79104637 AAAAATATGCCAGCCAGGCATGG - Intergenic
910971199 1:92857611-92857633 AACAATATGACAGCCGGGCACGG - Intronic
911053126 1:93688925-93688947 TAATATATGCTGGCCAGGCATGG - Intronic
911404192 1:97415610-97415632 TTGTAAATGAAGGCCAGGCATGG - Intronic
911613042 1:99977827-99977849 AAGCATACGAGGGCCAGGCACGG - Intronic
912375496 1:109206303-109206325 TTGAACATGTAGGCCAGGCACGG - Intronic
912422244 1:109550822-109550844 AAGAAAATGCTGGCCAGGCACGG - Intronic
912829716 1:112941571-112941593 AAGAAGATGTGGGCCAGGCATGG - Intronic
912841849 1:113045810-113045832 AAGAAAATGTCGGCCGGGCATGG + Intergenic
912871807 1:113313656-113313678 TACAATAAGATGGCCAGGCACGG + Intergenic
912986734 1:114441015-114441037 TAAAATACAAAGGCCAGGCATGG + Intronic
914315668 1:146509190-146509212 AACAGTATGAGGGCCAGGCATGG + Intergenic
914498687 1:148224171-148224193 AACAGTATGAGGGCCAGGCATGG - Intergenic
914700953 1:150133257-150133279 TAAAAGATGAAGGCCAGGCGTGG + Intronic
914748941 1:150519564-150519586 TACAAAATTAGGGCCAGGCACGG + Intergenic
916251166 1:162739595-162739617 AAGAAAATGTGGGCCAGGCATGG - Intronic
917546517 1:175974740-175974762 AAGAATACGTGGGCCAGGCATGG + Intronic
918010307 1:180580662-180580684 AAGAATAACTCGGCCAGGCATGG + Intergenic
918191991 1:182184699-182184721 AAGAAAATGGGGGCCAGGCATGG + Intergenic
918971148 1:191421088-191421110 TAGAGAATGTCGGCCGGGCACGG + Intergenic
919671475 1:200342163-200342185 TAAAATATGGAGGCCAGGCTCGG - Intergenic
919903234 1:202059207-202059229 TACACTAAGGCGGCCAGGCATGG - Intergenic
920360117 1:205409127-205409149 AATAATATGCCGGCCAGGCTTGG - Intronic
922459447 1:225803594-225803616 TAGAATAGGAGGGCCGGGCGTGG - Intergenic
924063348 1:240198814-240198836 TAGAACATGACAGCCTGGCGCGG + Intronic
924292387 1:242550162-242550184 TATAATAGTGCGGCCAGGCATGG - Intergenic
924528773 1:244875819-244875841 TAGAATTTCCCGGCCGGGCAGGG + Intergenic
924662024 1:246029379-246029401 GAAAATATGCAGGCCAGGCACGG + Intronic
924724901 1:246660433-246660455 AAGACTATGTCCGCCAGGCACGG + Intronic
1063398406 10:5715929-5715951 TAAAAAATTGCGGCCAGGCAGGG - Intronic
1064046941 10:12025258-12025280 AAGGCTATGATGGCCAGGCACGG + Intronic
1064543595 10:16429486-16429508 TAAAAGATGTAGGCCAGGCATGG - Intergenic
1064724026 10:18259273-18259295 TAGACTTTAAAGGCCAGGCATGG + Intronic
1065038019 10:21660324-21660346 TTGAAGATTAAGGCCAGGCACGG + Intronic
1065233513 10:23622751-23622773 TAGTATATATAGGCCAGGCATGG + Intergenic
1065452937 10:25877846-25877868 TAGAATATGTAGACCAGGCTTGG + Intergenic
1065463918 10:25999186-25999208 TATCATATAAAGGCCAGGCACGG - Intronic
1065546456 10:26826547-26826569 TAGCCTTTGAAGGCCAGGCATGG + Intronic
1065601110 10:27369682-27369704 TAAAATAATTCGGCCAGGCATGG + Intergenic
1066566051 10:36723245-36723267 AAAAAAATTACGGCCAGGCACGG + Intergenic
1066632761 10:37472747-37472769 TAGAATAAGTGGGCCGGGCACGG + Intergenic
1066707162 10:38192984-38193006 AAAAACATGGCGGCCAGGCATGG + Intergenic
1066982540 10:42431720-42431742 AAAAACATGGCGGCCAGGCATGG - Intergenic
1067378169 10:45747432-45747454 TAAAATAAGGAGGCCAGGCATGG - Intronic
1068031131 10:51706542-51706564 AAGAAAATGACGCCCAGGAAAGG + Intronic
1068358404 10:55942594-55942616 TAGAATAAGTCGGCCGGGCGCGG - Intergenic
1068892680 10:62164073-62164095 TATATTATGAGGGCTAGGCATGG - Intergenic
1069105454 10:64378261-64378283 TAAAGAATGCCGGCCAGGCATGG - Intergenic
1069316418 10:67109552-67109574 AAGAAAATGAAGGCCAGGCGTGG + Intronic
1069380523 10:67839639-67839661 TAGAATTTTAAGGCCAGGCACGG + Intergenic
1069409133 10:68134504-68134526 TAGGATATGTGGGCCAGACATGG + Intronic
1069646304 10:70000755-70000777 TAGAAATTGAAGGCCAGGCATGG - Intergenic
1069845473 10:71367930-71367952 TAAAATAAGCCGGCCAGGCATGG + Intergenic
1069898153 10:71691697-71691719 TTGGATGTGACTGCCAGGCAGGG - Intronic
1070031916 10:72685207-72685229 TAGAAGAGGGAGGCCAGGCATGG - Intergenic
1070114312 10:73514243-73514265 AAGAATAATAAGGCCAGGCATGG - Intronic
1070150000 10:73799638-73799660 TAAGAAATGACGGCCGGGCATGG + Intronic
1070894318 10:79969183-79969205 TAAAAAATAAGGGCCAGGCATGG + Intronic
1071273457 10:84030239-84030261 TAGAATATGACTGAGAGTCATGG - Intergenic
1071813956 10:89212385-89212407 TGGAATTTGATGGCCAGCCATGG - Intergenic
1071826560 10:89331461-89331483 TGGAAAATGTTGGCCAGGCACGG - Intronic
1072064728 10:91855459-91855481 AAGAATATGAGGGCTGGGCATGG - Intronic
1072138337 10:92568523-92568545 TAGAATAATACAGCCGGGCACGG + Intronic
1072323027 10:94269392-94269414 TAAAGAATGAAGGCCAGGCACGG - Intronic
1072592302 10:96837543-96837565 AAGAATCTGTCGGCCGGGCACGG - Intronic
1072676900 10:97473850-97473872 TAGAAAAAGTTGGCCAGGCATGG + Intronic
1072976437 10:100062889-100062911 AAGAATAATAAGGCCAGGCATGG - Intronic
1073052252 10:100674985-100675007 TAAAAAAAGACAGCCAGGCATGG + Intergenic
1073133265 10:101204567-101204589 AAGAAAAAGACGGCCAGGCGCGG - Intergenic
1073264235 10:102215206-102215228 AAAAATATGAAGGCCGGGCACGG + Intergenic
1073310486 10:102536650-102536672 AAGAAAATGCAGGCCAGGCATGG - Intronic
1073320644 10:102614263-102614285 TAGAATGTTGGGGCCAGGCACGG + Intronic
1073331277 10:102671378-102671400 AAGAAACTGAGGGCCAGGCACGG + Intergenic
1073373393 10:103010901-103010923 ATAAATATCACGGCCAGGCACGG - Intronic
1073788816 10:106919125-106919147 CACAATATGCAGGCCAGGCATGG - Intronic
1075301163 10:121325459-121325481 TAAAACATGTCGGCTAGGCATGG + Intergenic
1075360011 10:121822998-121823020 GAGAAGAGGTCGGCCAGGCATGG + Intronic
1075669273 10:124252697-124252719 TGGGAGATGAGGGCCAGGCATGG - Intergenic
1075921568 10:126217680-126217702 TACAATATTTTGGCCAGGCATGG + Intronic
1076021293 10:127076209-127076231 AAGAAAATATCGGCCAGGCACGG + Intronic
1076387928 10:130071912-130071934 TAGAATATGACGGCCAGGCGCGG - Intergenic
1077057806 11:603991-604013 TAAAATAAGAGGGCCAGGCATGG - Intronic
1077604880 11:3602666-3602688 AAGAAGATGCCGGGCAGGCACGG - Intergenic
1077623827 11:3752225-3752247 AAGGAAATGACAGCCAGGCACGG + Intronic
1077820166 11:5729408-5729430 AAGAATATCTCGGCCGGGCACGG - Intronic
1077943299 11:6867500-6867522 TTGAATATCGAGGCCAGGCACGG - Intergenic
1078634633 11:13037692-13037714 TAGAAAATGTTGGCCAGGCACGG - Intergenic
1079009868 11:16819091-16819113 AATAAGATGGCGGCCAGGCATGG - Intronic
1079043709 11:17081549-17081571 TAGAATCATAAGGCCAGGCACGG + Intronic
1079065638 11:17288843-17288865 TAGACTTTAAGGGCCAGGCACGG - Intronic
1079113007 11:17616345-17616367 TAGAATAGCTAGGCCAGGCACGG - Intronic
1079976875 11:27102898-27102920 AATAATTTGATGGCCAGGCATGG + Intronic
1080104588 11:28498446-28498468 AAGAATTTGGAGGCCAGGCACGG - Intergenic
1080354882 11:31431519-31431541 TATAATATTGGGGCCAGGCATGG + Exonic
1080482993 11:32672058-32672080 TATAATAGGCAGGCCAGGCATGG + Intronic
1080515259 11:33014511-33014533 TAGAAAAAGCTGGCCAGGCACGG - Intergenic
1080533549 11:33199667-33199689 AAGAACATGAAGGCCAGGCACGG - Intergenic
1080591748 11:33730136-33730158 TAAAATGTGTCAGCCAGGCATGG + Intronic
1081133176 11:39405256-39405278 TAGAAAATGGCGGCCGGGCATGG + Intergenic
1081305388 11:41505348-41505370 TAAAAAAAGAAGGCCAGGCACGG - Intergenic
1081512224 11:43787230-43787252 AAGAATTTAAAGGCCAGGCAAGG - Intronic
1082037733 11:47658829-47658851 AAGAGTATGGGGGCCAGGCATGG + Intergenic
1082061654 11:47866270-47866292 AAGAAAATTCCGGCCAGGCACGG - Intergenic
1083215446 11:61215945-61215967 ATGCATATGCCGGCCAGGCACGG + Intergenic
1083218330 11:61234774-61234796 ATGCATATGCCGGCCAGGCACGG + Intergenic
1083312488 11:61791550-61791572 TAGAAATTGAGGGCCAGGCGCGG - Intronic
1083801845 11:65050980-65051002 TATAATATATGGGCCAGGCACGG - Intronic
1083937139 11:65875580-65875602 TGGAATACGTGGGCCAGGCACGG - Intergenic
1084239547 11:67809555-67809577 GAGAGAATGAGGGCCAGGCATGG + Intergenic
1084256573 11:67946962-67946984 TAGAACAAGAGGGCCGGGCATGG - Intergenic
1085249335 11:75131870-75131892 AAGAAAATCAAGGCCAGGCATGG + Intronic
1085290830 11:75398342-75398364 TTGAAAAAGAAGGCCAGGCACGG + Intergenic
1085452603 11:76644264-76644286 TACCATCTCACGGCCAGGCAAGG - Intergenic
1085777352 11:79378725-79378747 AAGAAGATGAGAGCCAGGCATGG + Intronic
1086093956 11:83031815-83031837 GAGAATATGCAGGCCAGGCCTGG - Intronic
1086939614 11:92782017-92782039 AAGGATAGGAAGGCCAGGCATGG + Intronic
1087006067 11:93473311-93473333 TAGTATATGTTGGCCAGGCGCGG + Intergenic
1087114452 11:94509727-94509749 TAGAAAATTCAGGCCAGGCAAGG - Intergenic
1087380914 11:97403683-97403705 ATGAAGATGAAGGCCAGGCATGG - Intergenic
1087758052 11:102074995-102075017 TAGAATGTGAAGGCTGGGCATGG - Intronic
1088226070 11:107621734-107621756 ATGAATGTGAGGGCCAGGCATGG + Intronic
1088260369 11:107938070-107938092 AAGAATGAGATGGCCAGGCATGG + Intronic
1088297637 11:108318069-108318091 AAAAATAATACGGCCAGGCACGG + Intronic
1088316027 11:108507865-108507887 AAGAAAATGTGGGCCAGGCACGG + Exonic
1088887124 11:114016575-114016597 TTGAATCTGTAGGCCAGGCACGG + Intergenic
1088977485 11:114828761-114828783 TAAAGTATAAAGGCCAGGCATGG + Intergenic
1089277351 11:117346571-117346593 TAAAATAAGTTGGCCAGGCATGG + Intronic
1089805115 11:121080105-121080127 AAGAAAAATACGGCCAGGCATGG - Intronic
1090028758 11:123189715-123189737 TAGAAGAAAATGGCCAGGCACGG + Intronic
1090377152 11:126298698-126298720 AAGAATATTCTGGCCAGGCATGG - Intronic
1090993176 11:131839250-131839272 TAAAATATACAGGCCAGGCATGG - Intronic
1092018581 12:5181040-5181062 AAGAATATTCAGGCCAGGCACGG + Intergenic
1092344218 12:7702233-7702255 AAGAATCTCACGTCCAGGCACGG + Intergenic
1092374449 12:7943618-7943640 TAAAAGATGCTGGCCAGGCATGG - Intergenic
1092426786 12:8381662-8381684 TAGGACAAGAGGGCCAGGCATGG - Intergenic
1092621457 12:10275178-10275200 TACAAAATAACGGCTAGGCACGG - Intergenic
1092823045 12:12371582-12371604 TAGAAAATATAGGCCAGGCATGG - Intronic
1092955314 12:13544072-13544094 GAGAATGTGACGCCCAGGGAGGG - Exonic
1093121176 12:15273429-15273451 AAGAATATTACGGCCGGGCGCGG - Intronic
1093132869 12:15413522-15413544 TAAAAGATGGAGGCCAGGCACGG + Intronic
1093871614 12:24298942-24298964 TAGAAAAAGATGGCCAGGAAAGG + Intergenic
1094600536 12:31905372-31905394 AAAAATAGGAAGGCCAGGCATGG + Intergenic
1094637932 12:32244915-32244937 TAGCCTATGTCGGCCGGGCATGG - Intronic
1096154395 12:49333901-49333923 TAAAATTTGTCGGCCAGGCGCGG + Intronic
1096198462 12:49664249-49664271 TAAAATAAAATGGCCAGGCATGG + Intronic
1096200937 12:49682358-49682380 AATAGTATGAGGGCCAGGCACGG - Intronic
1096316944 12:50576046-50576068 AAAAATATCAGGGCCAGGCACGG - Intronic
1096349351 12:50882312-50882334 AAGAATATTACAGCCAGACATGG + Intronic
1096349846 12:50888264-50888286 AAGAAAATGAGGGCCAGGCATGG + Intergenic
1096818279 12:54215377-54215399 TAGCGTAAGAAGGCCAGGCACGG + Intergenic
1097164510 12:57076371-57076393 TAATAAATGAAGGCCAGGCATGG + Intronic
1098486169 12:71024336-71024358 AAGAATATGTAGTCCAGGCACGG - Intergenic
1098589836 12:72197812-72197834 GAAAATATGATGGCCAGGGAAGG - Intronic
1099037396 12:77605913-77605935 AAGAATATGAAAGCAAGGCAAGG - Intergenic
1099999233 12:89812903-89812925 TAAAAAATCAAGGCCAGGCACGG - Intergenic
1100473069 12:94911024-94911046 TATAATATGTTGGCCAGGCACGG + Intronic
1100725352 12:97402817-97402839 TAGACTATGGTGGCCAGGCATGG + Intergenic
1100835556 12:98563770-98563792 TAGATTAAGGAGGCCAGGCAAGG + Intergenic
1100843736 12:98638935-98638957 TACAATAACTCGGCCAGGCATGG - Intronic
1100967679 12:100030395-100030417 AAGAAAAAGATGGCCAGGCATGG - Intronic
1101152562 12:101896471-101896493 TAGAACATGTTGGCCAGACATGG + Intronic
1101980229 12:109399619-109399641 TAGCATCTGAAGGCCAGGCATGG + Intronic
1102928491 12:116844523-116844545 TAAAACATAATGGCCAGGCACGG - Intronic
1103120982 12:118379100-118379122 TAGAATATCCAGGCCAGGCATGG - Intronic
1103542067 12:121673049-121673071 TCCAGTGTGACGGCCAGGCACGG - Intergenic
1103574847 12:121869813-121869835 AAGAAAGTGAAGGCCAGGCATGG - Intergenic
1104033359 12:125080979-125081001 TAAAATAAAAAGGCCAGGCACGG - Intronic
1104179391 12:126363688-126363710 TTAAAAATGAAGGCCAGGCACGG - Intergenic
1104323184 12:127771467-127771489 CAGAGTATTCCGGCCAGGCAGGG - Intergenic
1104871347 12:131999726-131999748 TAATGTATGAGGGCCAGGCACGG - Intronic
1106046759 13:26149295-26149317 TAGAGGCAGACGGCCAGGCATGG + Intronic
1106291693 13:28369232-28369254 TGGAAAATGAAGGCCAGGCACGG + Intronic
1106342594 13:28844905-28844927 AAGAAAATGCTGGCCAGGCATGG - Intronic
1107944268 13:45403645-45403667 AAGAAGATGCAGGCCAGGCACGG + Intronic
1108887795 13:55209624-55209646 CAGGAAATGGCGGCCAGGCACGG - Intergenic
1108953417 13:56119588-56119610 TACAACTTAACGGCCAGGCATGG + Intergenic
1109162300 13:58990985-58991007 TAGAAAGAGAAGGCCAGGCAAGG - Intergenic
1109282880 13:60377526-60377548 TAGATTATTAGGGCCGGGCATGG + Intergenic
1111538167 13:89631244-89631266 AAGATAATGACAGCCAGGCATGG - Intergenic
1112303323 13:98250430-98250452 AAAAATATGAGGGCCGGGCACGG + Intronic
1112566458 13:100555232-100555254 AAGAAAATTACAGCCAGGCATGG + Intronic
1113239313 13:108318600-108318622 GAAAATATGGGGGCCAGGCACGG - Intergenic
1113464658 13:110504896-110504918 AAAAATAAGACGACCAGGCACGG - Intronic
1113557217 13:111247559-111247581 ATGAATATGAAGGCCAGGCGTGG - Intronic
1115551748 14:34511259-34511281 TTTAATATGATGACCAGGCACGG - Intergenic
1115558896 14:34565365-34565387 TAGAATATGTCAGCCGGGCGCGG - Intronic
1115595042 14:34901245-34901267 TAGAAGATGCAGGCCAGGCGCGG + Intergenic
1115771971 14:36673154-36673176 TAGAAAAAGGCGGCCGGGCACGG - Intronic
1116315674 14:43389166-43389188 GAGAAGATGACGGCCGGGCGCGG + Intergenic
1116909613 14:50445859-50445881 TAGAAAAAGGCGGCCAGGCGTGG - Intronic
1116931621 14:50696322-50696344 GAGAAAAAGAGGGCCAGGCACGG - Intergenic
1116979624 14:51154556-51154578 TAGAAAATTAAGGCCAGGCATGG + Intergenic
1116981704 14:51177793-51177815 AAGAATATTCAGGCCAGGCAAGG + Intergenic
1116996076 14:51326456-51326478 TAGAAGTTCAAGGCCAGGCACGG - Intergenic
1117382418 14:55177960-55177982 TTGATAATTACGGCCAGGCACGG + Intronic
1117840287 14:59853778-59853800 TAGAATGGGAGGGCCATGCATGG - Intronic
1117906340 14:60592647-60592669 AAGCATATGAAGGCCAGGCATGG + Intergenic
1118341542 14:64897837-64897859 TGAAAAATGAAGGCCAGGCATGG + Intergenic
1118744595 14:68764603-68764625 TAAAATATAATGGCTAGGCATGG - Intergenic
1118872355 14:69753873-69753895 TAGAAAATAACTTCCAGGCAGGG - Intronic
1118900874 14:69984550-69984572 TAGAAAATGGTGGCCTGGCATGG + Intronic
1119366524 14:74096813-74096835 TAGAATATGAGGGGTAGGGAAGG - Intronic
1119464022 14:74839270-74839292 TAAAATATTTCAGCCAGGCACGG - Intronic
1120456662 14:84739442-84739464 TAAGAAATGACAGCCAGGCAAGG + Intergenic
1121765112 14:96479365-96479387 AAGAGTTTGTCGGCCAGGCACGG - Intronic
1202890590 14_KI270722v1_random:153622-153644 AATAATATTAAGGCCAGGCATGG - Intergenic
1123713480 15:23008546-23008568 TAGAAAATGGAGGCCAGGCACGG - Intronic
1123767423 15:23495454-23495476 TAAAAATTGAAGGCCAGGCACGG + Intergenic
1123781411 15:23632591-23632613 TAAAAAGAGACGGCCAGGCATGG - Intergenic
1123907885 15:24938416-24938438 TAGAAGCAGAAGGCCAGGCATGG - Intronic
1124108574 15:26764838-26764860 AAGAATGTCAAGGCCAGGCACGG + Intronic
1124547240 15:30641628-30641650 AAGAAAATTATGGCCAGGCATGG - Intronic
1124780840 15:32631588-32631610 AAGAAAATTATGGCCAGGCATGG - Intronic
1124923731 15:34050176-34050198 TAGAATGTTGAGGCCAGGCATGG - Intronic
1125595151 15:40880367-40880389 AAGAACACCACGGCCAGGCACGG + Intergenic
1125610692 15:40967655-40967677 TAAAATAACATGGCCAGGCACGG - Intergenic
1125643297 15:41249442-41249464 AAGAAGGTGAAGGCCAGGCATGG - Intronic
1125979055 15:43983219-43983241 TAGAAGATTGGGGCCAGGCATGG - Intronic
1126287009 15:47025235-47025257 TGTAATATTAAGGCCAGGCATGG + Intergenic
1126607157 15:50489662-50489684 TAAAATATGAAGGGCAGCCAAGG + Intronic
1127062403 15:55200557-55200579 TAGACTAGGTTGGCCAGGCACGG + Intergenic
1127137244 15:55937081-55937103 TAGCAAATTATGGCCAGGCACGG - Intronic
1127449486 15:59102829-59102851 AAGAATCTGAAGGCCTGGCATGG - Intergenic
1127564745 15:60176236-60176258 TAAAATAAGTAGGCCAGGCATGG + Intergenic
1127590939 15:60422544-60422566 TAGCTTATGCTGGCCAGGCACGG + Exonic
1127650928 15:61006255-61006277 AAAAATATTACGGCCGGGCACGG - Intronic
1127893497 15:63275508-63275530 TCCAAAATGAAGGCCAGGCACGG + Intergenic
1128049019 15:64646338-64646360 TACAAAATGGCGGCCAGGCATGG + Intronic
1128132085 15:65235511-65235533 AAAAATTTGCCGGCCAGGCATGG + Intronic
1128372886 15:67053423-67053445 AAGAAACTGAGGGCCAGGCATGG - Intergenic
1129274993 15:74439375-74439397 TAAATGATGTCGGCCAGGCATGG + Intergenic
1129384401 15:75187994-75188016 TAAAAAATGAGGGCCGGGCACGG - Intergenic
1130643115 15:85698175-85698197 GAGAATATAAGGGCCAGGCACGG + Intronic
1132763433 16:1522548-1522570 GAGAATATGTCGGCCAAGCATGG + Intronic
1133009049 16:2900152-2900174 TATAAAATCAGGGCCAGGCATGG - Intergenic
1133176274 16:4017352-4017374 TAGATAATGTGGGCCAGGCATGG + Intronic
1133244689 16:4440298-4440320 TACAAAGTGAGGGCCAGGCACGG + Intronic
1133664989 16:7958160-7958182 AAGAAAATGCTGGCCAGGCACGG - Intergenic
1134114875 16:11540452-11540474 TATAATATAATGGCCAGGCACGG - Intergenic
1134117511 16:11560318-11560340 TTAAATGTGGCGGCCAGGCACGG + Intronic
1134785668 16:16940531-16940553 TACAAGATGGCGGCCAGGGAGGG + Intergenic
1134826880 16:17291894-17291916 TATGATAGGATGGCCAGGCACGG + Intronic
1135022384 16:18973508-18973530 GAGAATATCCAGGCCAGGCACGG - Intergenic
1135073621 16:19374169-19374191 AAGAGTTTGACAGCCAGGCATGG + Intergenic
1135318903 16:21477590-21477612 TAAAATATTCCAGCCAGGCACGG + Intergenic
1135371798 16:21909383-21909405 TAAAATATTCCAGCCAGGCACGG + Intergenic
1135439989 16:22461321-22461343 TAAAATATTCCAGCCAGGCACGG - Intergenic
1135653966 16:24231613-24231635 TAGTATCTGCCGGCCAGGCATGG - Intergenic
1135685249 16:24493583-24493605 TAAAAAAAGATGGCCAGGCATGG - Intergenic
1135709636 16:24704387-24704409 TATAACATTAAGGCCAGGCATGG + Intergenic
1135929674 16:26725951-26725973 AAGAATCATACGGCCAGGCACGG - Intergenic
1135995979 16:27248697-27248719 TAAAAAATGCAGGCCAGGCATGG - Intronic
1136101620 16:28000925-28000947 TAGAAGATGAGGAACAGGCAAGG - Intronic
1136219250 16:28817605-28817627 AAGAATTTGAAGCCCAGGCATGG - Intergenic
1136329207 16:29559656-29559678 TAAAATATTCCAGCCAGGCACGG + Intergenic
1136559028 16:31027608-31027630 TAAAAAATAAAGGCCAGGCATGG - Intergenic
1137236086 16:46619742-46619764 TATAACCTGATGGCCAGGCACGG + Intronic
1137435298 16:48449548-48449570 TAGTATATGACAATCAGGCAAGG + Intergenic
1137641536 16:50035059-50035081 TAGAATAAAGAGGCCAGGCATGG + Intronic
1137709550 16:50556629-50556651 GAGAATCTGAAGCCCAGGCAGGG - Intronic
1139174530 16:64671220-64671242 AAGAAAATTAGGGCCAGGCACGG - Intergenic
1139567359 16:67786946-67786968 TAGAATAAATAGGCCAGGCATGG + Intronic
1139610160 16:68050424-68050446 TAAAATAGTTCGGCCAGGCATGG - Intronic
1139809650 16:69603465-69603487 TAGAACATATCAGCCAGGCACGG + Intronic
1139927066 16:70495098-70495120 AAGAATATGATAACCAGGCACGG + Intronic
1140145882 16:72308114-72308136 TAGATTTTGACAGACAGGCATGG - Intergenic
1140450608 16:75068061-75068083 TAGTATTAGAGGGCCAGGCATGG + Intronic
1142015462 16:87743986-87744008 TAGAATTTGAGGGCCAGGCGTGG + Intronic
1142111069 16:88331948-88331970 AGGAATATGAAGGCCTGGCATGG + Intergenic
1142381836 16:89737229-89737251 AAGAATTTGTAGGCCAGGCACGG + Intronic
1142750331 17:1983691-1983713 TAGAAAATGTTAGCCAGGCATGG - Intronic
1142834536 17:2575277-2575299 TAGTATAGCTCGGCCAGGCATGG + Intergenic
1142945574 17:3423640-3423662 AAGAATTTGATGACCAGGCATGG + Intergenic
1142973542 17:3629438-3629460 AAGGATATGCCGGCCGGGCATGG + Intronic
1143152759 17:4817370-4817392 AAGCACATCACGGCCAGGCACGG + Intronic
1144437477 17:15254665-15254687 AATAATAAGATGGCCAGGCATGG + Intronic
1144525518 17:15986332-15986354 TAAAATAAGATGGCCAGGCGTGG - Intronic
1144665140 17:17097335-17097357 AAGAATATTCTGGCCAGGCATGG + Intronic
1144805156 17:17960675-17960697 TAAAATATGACTGACAGGCCTGG + Intronic
1145213489 17:21034037-21034059 TAGAATATTTAGGCCGGGCACGG - Intronic
1145220403 17:21083863-21083885 TAGAGTGTCAAGGCCAGGCATGG - Intergenic
1145375073 17:22339471-22339493 CAGAATATATAGGCCAGGCATGG + Intergenic
1146069423 17:29666390-29666412 TTAAAAATGAGGGCCAGGCATGG + Intronic
1146139318 17:30351150-30351172 CAGAAAAAAACGGCCAGGCATGG - Intergenic
1146324304 17:31872375-31872397 AAGAAAAAGAAGGCCAGGCATGG + Intronic
1146394886 17:32456819-32456841 TACAAAATTAGGGCCAGGCACGG - Intronic
1146904113 17:36607328-36607350 TAGAATAGGAGAGGCAGGCATGG + Intronic
1147609907 17:41795628-41795650 TTGAATATTTTGGCCAGGCACGG + Intergenic
1147656529 17:42094271-42094293 AAGAAGGTGACAGCCAGGCACGG - Intergenic
1147843778 17:43390854-43390876 AAGTATATGAGGGCCAAGCACGG + Intergenic
1148331320 17:46815528-46815550 TGGAATCTGACTGCCAGGCGGGG + Intronic
1148629496 17:49095980-49096002 TTCAAGATTACGGCCAGGCATGG - Intergenic
1149530326 17:57389945-57389967 AAGAATCTGAAGGCCAGGCATGG + Intronic
1149926933 17:60710719-60710741 TAAAAAATGTTGGCCAGGCATGG - Intronic
1150048501 17:61936410-61936432 TAAAAGATGAGGGCCAGGCATGG + Intergenic
1150495958 17:65607917-65607939 TCTAAAATGAGGGCCAGGCACGG + Intronic
1150536276 17:66045358-66045380 TAAAATATTTTGGCCAGGCATGG - Intronic
1150691898 17:67374253-67374275 TAAAAAATGAAGGCCGGGCATGG - Intergenic
1151022474 17:70633279-70633301 AAGAATATATTGGCCAGGCACGG - Intergenic
1151545797 17:74792158-74792180 AAGAATTTAATGGCCAGGCATGG + Intronic
1151835879 17:76582457-76582479 AAGAATATGAAGGCCGGGCATGG - Intronic
1151838313 17:76598977-76598999 AAGTATGTGATGGCCAGGCACGG - Intergenic
1151905337 17:77044668-77044690 TGCAAAATAACGGCCAGGCAAGG + Intergenic
1152481499 17:80556801-80556823 TAAAACATGCTGGCCAGGCACGG + Intronic
1152657160 17:81525133-81525155 AAGAACCAGACGGCCAGGCACGG + Intergenic
1153789987 18:8570030-8570052 TGGAAAATCACAGCCAGGCAAGG - Intergenic
1153912797 18:9718977-9718999 TACAATTTGAAGGCCAGGCATGG + Intronic
1154047498 18:10920761-10920783 AAGAATGTGCAGGCCAGGCACGG + Intronic
1154152983 18:11921459-11921481 TAGAACCTGTCGGCCAGGCGCGG - Intergenic
1154173292 18:12066445-12066467 GAGAATGTGCAGGCCAGGCACGG - Intergenic
1154928701 18:20968594-20968616 TAGAATTTCAAGGCCAGGCGCGG - Intronic
1154952271 18:21221943-21221965 TATGATATGAGGGCCGGGCACGG - Intergenic
1154990805 18:21596540-21596562 TAGAAAATATTGGCCAGGCATGG + Intronic
1155009339 18:21759529-21759551 TGGAATACAAAGGCCAGGCACGG - Intronic
1155010218 18:21769911-21769933 AACAAAATGAGGGCCAGGCATGG + Intronic
1155424042 18:25687471-25687493 TAGAAAAAGAGGGCCAGGCATGG + Intergenic
1157468111 18:47965928-47965950 TAAAATCTAACGGCCAGGGATGG - Intergenic
1157790701 18:50528556-50528578 TAGAACATGGAGGCCAGGCGTGG - Intergenic
1157825892 18:50812029-50812051 TACCATATGATGGCCAGGCTAGG - Intronic
1157851998 18:51063140-51063162 AAGAAAATGAGGGCCAGGCACGG - Intronic
1158224797 18:55189780-55189802 TAAAAAATGTAGGCCAGGCATGG - Intergenic
1158450812 18:57563289-57563311 CAAAGTATGTCGGCCAGGCACGG + Intronic
1159055628 18:63460393-63460415 TAGAAAATACAGGCCAGGCATGG - Intergenic
1160748293 19:721554-721576 TAAAAAAAGAAGGCCAGGCACGG - Intronic
1160925588 19:1543500-1543522 TAGAAAATTAAGGCCAGGCGCGG + Intergenic
1161127934 19:2570383-2570405 CAGACTATGACAGTCAGGCACGG + Intronic
1161277052 19:3424316-3424338 TAAAACAAAACGGCCAGGCACGG - Intronic
1161359685 19:3840899-3840921 TAGATTTTGATGGCCATGCATGG + Intronic
1161467773 19:4441614-4441636 TAAAAAATAAAGGCCAGGCATGG + Intronic
1161710091 19:5842885-5842907 AATAATAGGCCGGCCAGGCACGG - Exonic
1162124606 19:8492704-8492726 TAAAATATCATGGCCAGGCATGG + Intronic
1162242552 19:9366545-9366567 TAGAAAATGAAGGCCAGGCATGG - Intronic
1162348017 19:10132294-10132316 TAAAAAATGCTGGCCAGGCATGG + Intergenic
1162546534 19:11334180-11334202 TAGAACAAAACAGCCAGGCACGG + Intronic
1162649671 19:12078117-12078139 TAGAGAATAACGGCCGGGCACGG - Exonic
1162723827 19:12677929-12677951 AAGAATTAGACGGCCGGGCACGG - Intronic
1163048023 19:14659331-14659353 AAGAATTTGGAGGCCAGGCACGG - Intronic
1163512542 19:17744265-17744287 TAGAAGATCACAGACAGGCAAGG + Intergenic
1163571949 19:18087498-18087520 AAGAATTTGGCAGCCAGGCACGG - Intronic
1163855057 19:19695104-19695126 AAAAAAATGAAGGCCAGGCATGG - Intergenic
1164004475 19:21135986-21136008 TATCATATGGCGGCCAGGCACGG + Intergenic
1164223819 19:23224119-23224141 TTGCATAAGAAGGCCAGGCATGG + Intronic
1164932433 19:32186090-32186112 AAAAAGATGAGGGCCAGGCAGGG + Intergenic
1165378382 19:35460107-35460129 TAGAACATGACTCCCAGGAAGGG + Intergenic
1165466563 19:35978392-35978414 TGGACCATGAGGGCCAGGCACGG - Intergenic
1166021128 19:40030590-40030612 TTAAAAATCACGGCCAGGCACGG - Exonic
1166255053 19:41598190-41598212 TAAAATATATAGGCCAGGCATGG + Intronic
1166394546 19:42429315-42429337 TTAAATGTGAAGGCCAGGCATGG - Intronic
1167118468 19:47501950-47501972 TATAAAATTACGGCCAGGCGCGG + Intronic
1167443101 19:49521212-49521234 TAGAAAATGTTAGCCAGGCATGG - Intronic
1167534828 19:50043142-50043164 AAGAATATGGGGGCCAGGCGTGG + Intronic
1167617354 19:50542764-50542786 TAAAATATCATGGCCAGGCGCGG - Intronic
1168052305 19:53838597-53838619 TAAAAAATAAGGGCCAGGCATGG + Intergenic
1168188847 19:54723726-54723748 TAGAATGTCCCGGCCAGGCATGG + Intergenic
1168621941 19:57886586-57886608 AAAAAAAAGACGGCCAGGCACGG + Intronic
1202666013 1_KI270708v1_random:120460-120482 AAGAATATTAAGGCCAGGCATGG - Intergenic
925867367 2:8240523-8240545 TAGAAGGTAAGGGCCAGGCACGG - Intergenic
925881763 2:8358697-8358719 TAAAATATCAAGGCCAGGCATGG + Intergenic
926021945 2:9504154-9504176 AAGAAAATAAAGGCCAGGCACGG + Intronic
926267488 2:11337931-11337953 AAGAAACTGATGGCCAGGCATGG - Intronic
926496072 2:13590043-13590065 TAAAATAAAAAGGCCAGGCACGG - Intergenic
927561953 2:24080064-24080086 TAAAAAATGGAGGCCAGGCATGG + Intronic
927598250 2:24416697-24416719 TAAAACATTATGGCCAGGCATGG + Intergenic
928684311 2:33732381-33732403 AAGAATATGACGGCCGGGCGCGG - Intergenic
928825232 2:35412921-35412943 TTGAAGATGTAGGCCAGGCACGG + Intergenic
930655386 2:54002633-54002655 TAAAATAAAATGGCCAGGCATGG - Intronic
930786099 2:55272953-55272975 TACAATATGGAGGCCGGGCACGG + Intergenic
931311386 2:61084242-61084264 TAGAGTATTTTGGCCAGGCATGG - Intronic
932258802 2:70309664-70309686 AACATTATGCCGGCCAGGCATGG - Intergenic
932714345 2:74090584-74090606 TACAGTATGACCGCTAGGCACGG + Intronic
933438280 2:82276759-82276781 AAGAATTTCATGGCCAGGCACGG - Intergenic
933516613 2:83311657-83311679 AAGCATATGTAGGCCAGGCAAGG - Intergenic
933670944 2:85006817-85006839 TAGAACATCTCGGCCAGGCGCGG + Intronic
934086746 2:88516160-88516182 GAAGAAATGACGGCCAGGCACGG - Intergenic
934477010 2:94600439-94600461 TAGGATATTCTGGCCAGGCATGG + Intronic
934932921 2:98443117-98443139 TTGATTATGACTGCCAGGCGTGG + Intergenic
935115578 2:100133081-100133103 TAAAATATGAGAGCCAGGTATGG - Intronic
935212643 2:100951857-100951879 TAAAAAATGATGGCCAGGCGCGG + Intronic
935213006 2:100954372-100954394 CAGAAAATGTGGGCCAGGCACGG + Intronic
935225559 2:101049436-101049458 CAAAATATGTCAGCCAGGCACGG + Intronic
936737608 2:115465530-115465552 TGGAAAATGTAGGCCAGGCATGG + Intronic
937697488 2:124824206-124824228 AAGAACATAAGGGCCAGGCATGG - Intronic
937930805 2:127203972-127203994 AAGAAAAAGAGGGCCAGGCATGG + Intronic
938290442 2:130146532-130146554 GAAAATGTGAAGGCCAGGCAGGG + Intergenic
938385950 2:130867524-130867546 TACAATATATTGGCCAGGCATGG - Intronic
938466096 2:131526435-131526457 GAAAATGTGAAGGCCAGGCAGGG - Intergenic
938655347 2:133425979-133426001 TAGAAAATGCAGGCCAGGCACGG + Intronic
938992154 2:136640547-136640569 TGGAATATTATGGCCAGGCATGG - Intergenic
939488835 2:142852139-142852161 TTGAATATTAGGTCCAGGCATGG - Intergenic
939831753 2:147080781-147080803 TAAAATATTTCAGCCAGGCACGG - Intergenic
941156870 2:161989540-161989562 TATAACATCACAGCCAGGCATGG - Intergenic
941795526 2:169594910-169594932 TAAAATAAAACTGCCAGGCATGG - Intronic
941949170 2:171135508-171135530 AAGAAAAAGATGGCCAGGCACGG + Intronic
942104686 2:172620987-172621009 TAGAACATGTCGGCTGGGCACGG + Intergenic
942477261 2:176340450-176340472 TAGAATATCACAACCAGGCCAGG - Intergenic
942517272 2:176767248-176767270 AAGAATATGTCGGCCGGGCGCGG + Intergenic
942549573 2:177100855-177100877 TTGAAAATGGTGGCCAGGCATGG - Intergenic
942608143 2:177713432-177713454 TTGCATATGCCGGCCAGGCACGG + Intronic
942671299 2:178378873-178378895 TTGAAGAGGAAGGCCAGGCATGG + Intronic
942672143 2:178387712-178387734 TTGAACATGTAGGCCAGGCACGG + Intronic
942721211 2:178954992-178955014 TAGAACATTCAGGCCAGGCACGG + Intronic
943029819 2:182671907-182671929 TAGAAAGTCACGGCCGGGCACGG - Intergenic
943248930 2:185492619-185492641 TAAAATATGAAGGCTAGGCCAGG - Intergenic
943752043 2:191519640-191519662 TAGAATATGAAGCTCAGGCCGGG - Intergenic
944249840 2:197570436-197570458 TATTATATGAAGGCCAGGCATGG + Exonic
944416831 2:199487391-199487413 AAGAAGATGCAGGCCAGGCATGG - Intergenic
944705070 2:202280620-202280642 AAAAAAATGATGGCCAGGCACGG - Intronic
944793909 2:203162454-203162476 TACAAATTGAGGGCCAGGCATGG + Intronic
945354498 2:208823412-208823434 AAGCATATGACAGCCAGGCGCGG + Intronic
946228897 2:218279593-218279615 TAGAGTATGGTGGCCAGGCAGGG - Intronic
946392065 2:219422145-219422167 TAAAATATTACTGCCAGTCAAGG + Intronic
946840310 2:223813235-223813257 TGGCATATGTGGGCCAGGCATGG - Intronic
947397451 2:229700622-229700644 TAAGATATGGTGGCCAGGCACGG + Intronic
947422732 2:229955250-229955272 TGAAATATGTTGGCCAGGCATGG + Intronic
948038929 2:234883726-234883748 TTGAAACTGACTGCCAGGCATGG + Intergenic
1168737220 20:151535-151557 TAGAAGATATAGGCCAGGCACGG + Intergenic
1169233700 20:3911599-3911621 GAGAGTATTAGGGCCAGGCACGG + Intronic
1169542180 20:6611719-6611741 AAGAAAAGAACGGCCAGGCATGG - Intergenic
1169716994 20:8631024-8631046 TAGAACATCACAGCCAGGGAAGG - Intronic
1170027755 20:11908955-11908977 TAGCATAAAACGGCCAGGCGCGG + Intronic
1170839267 20:19910461-19910483 GAGAGTATGAAGGCCAAGCATGG - Intronic
1172085558 20:32379533-32379555 TAAGATGTCACGGCCAGGCATGG + Intronic
1172353825 20:34265230-34265252 AATAATATGAGGGCCAGGCACGG + Intronic
1172558262 20:35862435-35862457 CAGAATTTTAAGGCCAGGCATGG + Intronic
1172831550 20:37839741-37839763 TAGAATATGAACACCAGCCATGG - Intronic
1173593535 20:44243645-44243667 AGCAATATGAAGGCCAGGCATGG - Intergenic
1173731696 20:45333376-45333398 TAGAATTTCAAGGCCAGGCGCGG + Intronic
1173979815 20:47215080-47215102 TTAAAAATGTCGGCCAGGCATGG + Intronic
1173991969 20:47310505-47310527 CAGATTAGGAGGGCCAGGCACGG + Intronic
1174081890 20:47975971-47975993 AAGAACAAGAAGGCCAGGCACGG - Intergenic
1174428219 20:50448449-50448471 AAGAAGAAGAAGGCCAGGCACGG - Intergenic
1174602576 20:51736643-51736665 TACAATGTGAGGGCCAGGCGCGG - Intronic
1174712123 20:52717810-52717832 TAGCATTTTTCGGCCAGGCATGG - Intergenic
1175027224 20:55915055-55915077 TAGAAGATGAGGCCAAGGCAGGG - Intergenic
1176924309 21:14728716-14728738 TAGAATTTGCAGGCCAGGCCAGG + Intergenic
1177690473 21:24500050-24500072 AAGAATATGCAGGCCAGGCGTGG + Intergenic
1178120939 21:29469435-29469457 AAGAAAATCACGGCCTGGCATGG - Intronic
1178300931 21:31452281-31452303 TACAAAATGTTGGCCAGGCATGG + Intronic
1178303710 21:31473138-31473160 AAGAACATGGCAGCCAGGCACGG + Intronic
1179275027 21:39884504-39884526 TAGACTATTCTGGCCAGGCATGG + Intronic
1179832190 21:44003960-44003982 TTGAAAGTGAAGGCCAGGCACGG - Intergenic
1180045801 21:45304565-45304587 TGGACCATGACTGCCAGGCACGG - Intergenic
1180213385 21:46309704-46309726 TAGAAAATGCAGGCCAGGCATGG + Intronic
1180258069 21:46647653-46647675 TAGAATCAGAAGGCCAGGCAGGG - Intronic
1180622992 22:17174311-17174333 GGGAATATTATGGCCAGGCATGG - Intergenic
1180782980 22:18531302-18531324 GAGAAAATGTTGGCCAGGCACGG - Intergenic
1181126541 22:20705350-20705372 GAGAAAATGTTGGCCAGGCACGG - Intergenic
1181134440 22:20754657-20754679 TAAAAAATGTTGGCCAGGCATGG + Intronic
1181239878 22:21470664-21470686 GAGAAAATGTTGGCCAGGCACGG - Intergenic
1181612078 22:24021973-24021995 AAGAATATGCTGGCCGGGCACGG - Intronic
1182837240 22:33352461-33352483 TAGAAGATGCTGGCCAGGCATGG + Intronic
1183682618 22:39342219-39342241 TATAATATACAGGCCAGGCACGG - Intergenic
1183733166 22:39629522-39629544 GAATGTATGACGGCCAGGCAGGG + Intronic
1183758802 22:39796555-39796577 TACAATATACCAGCCAGGCATGG - Intronic
1183851422 22:40592135-40592157 AAGAATGTGTGGGCCAGGCATGG + Intronic
1183969009 22:41461949-41461971 TAAAATGTAAGGGCCAGGCACGG - Intronic
1184137791 22:42559409-42559431 TAGAATACAAGGTCCAGGCACGG + Intronic
1184211850 22:43040733-43040755 AAGAAAATGGGGGCCAGGCACGG - Intronic
1184837633 22:47033382-47033404 TAGAGGAGGACGGCCAGGCTGGG + Intronic
1184845469 22:47081865-47081887 TATTAATTGACGGCCAGGCATGG + Intronic
949317103 3:2769171-2769193 TAAAATAAGGTGGCCAGGCACGG + Intronic
949959143 3:9297603-9297625 GAGAAAATTAGGGCCAGGCACGG + Intronic
950295300 3:11824582-11824604 TACAAAAGGAAGGCCAGGCATGG - Intronic
950733928 3:14989502-14989524 AAGAATATTAGGGCCAGGCATGG + Intronic
951271963 3:20636229-20636251 TAGAATGATAAGGCCAGGCACGG - Intergenic
952372457 3:32736482-32736504 TAGAAAATTTGGGCCAGGCATGG + Intronic
952717162 3:36491716-36491738 TAAAATATGACTGTCAGGCCAGG + Intronic
952819363 3:37472684-37472706 TAGAAGATCTTGGCCAGGCATGG - Intronic
953086519 3:39673644-39673666 TAGAGGATGTGGGCCAGGCATGG + Intergenic
953325387 3:42008424-42008446 TAGTTTGTGAAGGCCAGGCATGG - Intergenic
953600310 3:44356673-44356695 GAGAATATCACGGCCAGGTATGG + Intronic
953788152 3:45926672-45926694 TAGAATATTCCGGCCAGGCACGG + Intronic
953944343 3:47133457-47133479 AAGAATATGTGGGCCAGGCGTGG + Intronic
953969578 3:47336661-47336683 GAGGATATGACGGCCAGCTACGG + Exonic
954202906 3:49035360-49035382 AAGAAAAGGAAGGCCAGGCATGG - Intronic
954230763 3:49215337-49215359 AAAACTATGAAGGCCAGGCATGG - Intronic
954470329 3:50688752-50688774 AAGAAAATACCGGCCAGGCATGG - Intronic
954781642 3:53066334-53066356 TCTAATATGATGGCCAGGGAGGG + Intronic
955332276 3:58057268-58057290 TAGAAGTTGCAGGCCAGGCATGG - Intronic
955921601 3:63962693-63962715 TAGAAGTTGTAGGCCAGGCATGG - Intronic
956480924 3:69673378-69673400 TAGAGAATGAGGGCCAGGCATGG - Intergenic
956871636 3:73424239-73424261 AAGAATATGCAGGCCAGGCATGG + Intronic
957055475 3:75439324-75439346 AAGAGAATGAGGGCCAGGCATGG + Intergenic
957089885 3:75719001-75719023 AAGAATATTAAGGCCAGGCACGG + Intronic
957616064 3:82528999-82529021 ACGAATATGATGGCCAGGCAGGG - Intergenic
957828880 3:85488817-85488839 TAGAATAAATAGGCCAGGCACGG - Intronic
958069658 3:88593867-88593889 TAGAGTATGAGGGCCGGGCACGG + Intergenic
958121656 3:89297742-89297764 TGAAATATGTTGGCCAGGCATGG + Intronic
958556756 3:95688133-95688155 AAGAATACTAGGGCCAGGCACGG - Intergenic
958792240 3:98664813-98664835 TAGAAAGTCACGGCCGGGCACGG - Intergenic
958794394 3:98691541-98691563 TAGAATTTGTTGGCCAGGCACGG + Intergenic
958980318 3:100711389-100711411 TAAAATTTGAGGGCCGGGCACGG - Intronic
959309827 3:104720506-104720528 TAGAATATCACAGACAGGCGAGG - Intergenic
959458444 3:106592806-106592828 AAGCATATCAGGGCCAGGCACGG - Intergenic
959751661 3:109844085-109844107 ATGCATATGCCGGCCAGGCACGG + Intergenic
960768074 3:121159920-121159942 TAGAAAATGTCGGCCGGGCGCGG - Intronic
961282653 3:125775763-125775785 TAGGACAAGAGGGCCAGGCATGG + Intergenic
961538217 3:127582851-127582873 TACAAAATTAGGGCCAGGCACGG + Intronic
961752028 3:129102338-129102360 TAAAATATCACAGCCAGGCATGG + Intronic
962449211 3:135497892-135497914 AAGAAAATTCCGGCCAGGCATGG - Intergenic
962771786 3:138618135-138618157 TATAATAAGCCAGCCAGGCATGG - Intronic
962780739 3:138713380-138713402 TAAAAGAACACGGCCAGGCACGG + Intronic
962798131 3:138866446-138866468 TAAAATAAAGCGGCCAGGCACGG + Intergenic
963796176 3:149633231-149633253 TAAAATAAGCCAGCCAGGCATGG + Intronic
964180104 3:153873403-153873425 TGGATTATTAAGGCCAGGCACGG - Intergenic
964342260 3:155720082-155720104 AAGAAAATGTAGGCCAGGCATGG - Intronic
966370838 3:179249368-179249390 AAGAAAATCATGGCCAGGCATGG + Intronic
966412016 3:179653915-179653937 TAGAATGTCAGGGCCAGGCGCGG + Intronic
966838189 3:184066029-184066051 TACACTATGACGGCCAGGCGCGG + Intergenic
967911887 3:194549329-194549351 AAGAATATGCAGGCCAGGGACGG + Intergenic
968267333 3:197372403-197372425 TAGAAAATGAAGGCCAGGAAGGG - Intergenic
968409649 4:378556-378578 TATAATATTCTGGCCAGGCACGG - Intronic
968543763 4:1184642-1184664 TACAATAAGCTGGCCAGGCACGG + Intronic
968763162 4:2452765-2452787 AAAAATATGAAGGCCAGGCCAGG + Intronic
969362897 4:6676438-6676460 TTGGATCTGAGGGCCAGGCATGG + Intergenic
969999984 4:11355301-11355323 TAATATATCCCGGCCAGGCACGG - Intergenic
970436658 4:16042102-16042124 GAGAAAATGCTGGCCAGGCACGG - Intronic
971283558 4:25264579-25264601 TAAAATATATGGGCCAGGCATGG + Intronic
971858094 4:32069115-32069137 TAAAAAATGGTGGCCAGGCACGG - Intergenic
971951858 4:33361223-33361245 TAGCATGTGTAGGCCAGGCACGG + Intergenic
971966275 4:33561114-33561136 TTAAATATGAAGGCCAGGCATGG + Intergenic
972500630 4:39674883-39674905 TAAGATTTGACGGCCAGGCGCGG + Intergenic
972541060 4:40039767-40039789 AAAAATTAGACGGCCAGGCATGG + Intergenic
972637099 4:40893996-40894018 TAGATTATGAGGGCCGGGCGCGG + Intronic
972889569 4:43540134-43540156 TAGAATATTTTGGCCAGGCACGG + Intergenic
974692047 4:65308767-65308789 TAGTATGTGAAGGCCAGGCGCGG + Intergenic
974892571 4:67899570-67899592 AAGAGTATGTAGGCCAGGCACGG + Intergenic
975932635 4:79544221-79544243 TAGTAGATGTTGGCCAGGCACGG + Intergenic
976179263 4:82383626-82383648 TAGAATAAGAAGGCAAAGCAAGG + Intergenic
976192803 4:82504489-82504511 TAGTATATGGCAGCCGGGCACGG - Intronic
976470654 4:85424888-85424910 AACAGTATGAAGGCCAGGCACGG - Intergenic
976937927 4:90662285-90662307 TAGTATAGGACGGCCAGGCATGG - Intronic
977879663 4:102189436-102189458 AAGAGTATGACTGCCAGGAAAGG + Intergenic
978223566 4:106306373-106306395 AAGAATATCAAGGCCAAGCATGG - Intronic
978507947 4:109480767-109480789 TTGAAAATGAAGGCCGGGCATGG - Intronic
978790606 4:112659935-112659957 AAAAATGTGATGGCCAGGCATGG + Intergenic
978831387 4:113089534-113089556 AAGCAGATGAAGGCCAGGCATGG + Intronic
979101420 4:116620649-116620671 TAGAATAAAAAGGCCAGGCATGG + Intergenic
979250919 4:118565807-118565829 TTGCAAATGAAGGCCAGGCAAGG + Intergenic
979635172 4:122948847-122948869 AAGAATGTGAGGGCCACGCAAGG - Intronic
980551268 4:134338830-134338852 AAAAATAAGTCGGCCAGGCACGG + Intergenic
980673781 4:136047907-136047929 TAAAATATTGAGGCCAGGCACGG + Intergenic
981060796 4:140422905-140422927 TAATAAATGAAGGCCAGGCATGG - Intronic
981502175 4:145463518-145463540 GGGAAGATGATGGCCAGGCATGG - Intergenic
982416377 4:155137405-155137427 TAGCAAATTAAGGCCAGGCACGG - Intergenic
982514589 4:156328423-156328445 AAGAATATACAGGCCAGGCATGG - Intergenic
982664827 4:158249193-158249215 AAGAATATCAGGGCCGGGCACGG - Intronic
983804995 4:171983645-171983667 AAGAATTTCAAGGCCAGGCATGG - Intronic
984598407 4:181697922-181697944 TAAAATGTGTTGGCCAGGCATGG + Intergenic
984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG + Exonic
985146582 4:186900219-186900241 AAGCATATCATGGCCAGGCATGG + Intergenic
985737990 5:1595937-1595959 TAAAAAATTAAGGCCAGGCACGG - Intergenic
985755965 5:1717318-1717340 TAAAAGTTGATGGCCAGGCACGG + Intergenic
986662030 5:10067840-10067862 AAGAACATGGTGGCCAGGCACGG + Intergenic
987548965 5:19353365-19353387 TACATTATCAAGGCCAGGCACGG + Intergenic
987763238 5:22192222-22192244 TAATATTTGACTGCCAGGCATGG - Intronic
987815771 5:22899985-22900007 ATGAATATCACGGCCAGGCGCGG + Intergenic
988125193 5:27023759-27023781 TAGCATGTAAGGGCCAGGCATGG + Intronic
988159120 5:27496209-27496231 TAGAGGATGCTGGCCAGGCACGG - Intergenic
988856922 5:35236042-35236064 AAAAATATGGAGGCCAGGCACGG - Intergenic
989220606 5:38957945-38957967 AAGAAAATGTCAGCCAGGCACGG + Intronic
989389408 5:40884845-40884867 AAGAAGAAGAGGGCCAGGCATGG - Intergenic
991006730 5:61835323-61835345 TAGAATCTGACAGCAAAGCAGGG + Intergenic
991285915 5:64975772-64975794 TAGCATATTTAGGCCAGGCATGG + Intronic
991392322 5:66159838-66159860 AAGGATATTACGGCCAGGCGCGG + Intronic
991715677 5:69448787-69448809 TAGAAATTGAGGGCCAAGCACGG - Intergenic
991897960 5:71425306-71425328 TAATATTTGACTGCCAGGCATGG - Intergenic
992025108 5:72662478-72662500 TAGAATATGTTGGCCAGGGAAGG - Intergenic
992404028 5:76438731-76438753 ATGAAAATGAAGGCCAGGCACGG - Intronic
992467907 5:77025244-77025266 AATCATATGACAGCCAGGCACGG + Intergenic
992488941 5:77222331-77222353 ATGAATATGATGGCCGGGCATGG + Intronic
992840059 5:80679969-80679991 TAGAAAATCGAGGCCAGGCACGG + Intronic
993036139 5:82759657-82759679 TAAGATATCAGGGCCAGGCACGG - Intergenic
993712442 5:91239798-91239820 TAGGATCACACGGCCAGGCATGG + Intergenic
994021256 5:95028869-95028891 TAAAATATGTAGGCCGGGCACGG + Intronic
994508159 5:100667946-100667968 GAAAATATCAGGGCCAGGCATGG + Intergenic
994519313 5:100810885-100810907 TTAAAAATGTCGGCCAGGCACGG + Exonic
994580451 5:101634866-101634888 TAGTATATGGTGGCCGGGCACGG + Intergenic
994805003 5:104434235-104434257 AAGAATATTCCGGCCAGGCGCGG - Intergenic
994930002 5:106169868-106169890 TAAGAAATGAAGGCCAGGCATGG - Intergenic
994974823 5:106788588-106788610 TATATTCTGAAGGCCAGGCATGG - Intergenic
997161957 5:131618338-131618360 CAGAAAATTATGGCCAGGCATGG + Intronic
997300523 5:132800317-132800339 CAGAAGAGGAGGGCCAGGCACGG - Intronic
997460148 5:134046459-134046481 AAGAATCTTAGGGCCAGGCATGG - Intergenic
997493034 5:134295305-134295327 AACAATATCAAGGCCAGGCATGG - Intronic
997553266 5:134772231-134772253 TCAAATGTGAAGGCCAGGCATGG + Intronic
997931496 5:138076108-138076130 TAGAAAATTAAGGCCAGGCATGG + Intergenic
997945826 5:138200420-138200442 TAAAACATTATGGCCAGGCACGG - Intronic
998832459 5:146174791-146174813 GAGAAGATTAAGGCCAGGCATGG + Intronic
999536347 5:152521718-152521740 TAAAAAATTAGGGCCAGGCATGG - Intergenic
999814689 5:155164190-155164212 TAAAAAATCAGGGCCAGGCATGG + Intergenic
1000095959 5:157971073-157971095 GACAATATGTCGGCCAGGCACGG + Intergenic
1000724077 5:164746584-164746606 TAAGAAATTACGGCCAGGCACGG - Intergenic
1000747236 5:165048556-165048578 TAGAAAATTTCAGCCAGGCATGG - Intergenic
1000883793 5:166727531-166727553 TACAACTTGCCGGCCAGGCACGG + Intergenic
1001055353 5:168445023-168445045 AAGAAGAAGAGGGCCAGGCACGG + Intronic
1001619333 5:173069610-173069632 TTGAATTTCATGGCCAGGCATGG - Intronic
1002127164 5:177054687-177054709 TAAAAAATGCCGGCCAGGCACGG - Intronic
1002150487 5:177225431-177225453 TAGACTAAGACGGCTGGGCACGG - Intronic
1002467830 5:179416601-179416623 TGGAATATGACGGCGGGGCCAGG - Intergenic
1002647506 5:180667670-180667692 TTAAATATTAGGGCCAGGCATGG - Intergenic
1004295847 6:14409594-14409616 TAAAATATAGTGGCCAGGCATGG - Intergenic
1004365161 6:15006645-15006667 AAGAATATTGAGGCCAGGCATGG + Intergenic
1004687812 6:17963843-17963865 TAGAACATATTGGCCAGGCATGG - Intronic
1004909164 6:20266587-20266609 AAGAACAAGAGGGCCAGGCATGG - Intergenic
1005294039 6:24406481-24406503 TACAAAATCAGGGCCAGGCACGG + Intronic
1005335027 6:24787291-24787313 AAGAAAATTAAGGCCAGGCACGG - Intergenic
1005380754 6:25231981-25232003 AATAATATGCCGGCCAGGCACGG + Intergenic
1005397320 6:25396650-25396672 AAGATTAAAACGGCCAGGCATGG - Intronic
1005452219 6:25984586-25984608 TAAAAATTGATGGCCAGGCATGG + Exonic
1005583993 6:27258659-27258681 AAGAAGATCTCGGCCAGGCATGG + Intergenic
1005741229 6:28792810-28792832 TAGAAAATGAAGGCTGGGCACGG + Intergenic
1005934698 6:30511866-30511888 TAGAAATTGTCGGCCAGGCACGG + Intergenic
1006115084 6:31771700-31771722 TTGAAAATGGCGGCCGGGCACGG + Intronic
1006206316 6:32346303-32346325 GAGGATATGACGGCCGGGCGCGG - Intronic
1006486846 6:34349798-34349820 TAGATTATCTAGGCCAGGCACGG + Intronic
1006488463 6:34365137-34365159 TAAAATAAATCGGCCAGGCAAGG + Intronic
1006955717 6:37869446-37869468 GACAAAATAACGGCCAGGCACGG - Intronic
1007003940 6:38342243-38342265 TAGGATTTGAGGGCCGGGCATGG + Intronic
1007595560 6:43049060-43049082 AAGAATATAAAGGCCGGGCATGG - Intronic
1007620451 6:43210264-43210286 TTAAAAATGTCGGCCAGGCATGG - Intronic
1007669220 6:43537774-43537796 AAGAAAAAGAGGGCCAGGCATGG + Intronic
1007884958 6:45217184-45217206 AATAAAATGATGGCCAGGCATGG + Intronic
1008013921 6:46496574-46496596 TTAAATAAGAGGGCCAGGCATGG + Intergenic
1008191785 6:48467763-48467785 AAGAAAATGTGGGCCAGGCATGG + Intergenic
1009838935 6:69041880-69041902 TAAAACATCATGGCCAGGCATGG - Intronic
1010277688 6:73988752-73988774 TAGAATTTGTCAGCCGGGCACGG - Intergenic
1010415301 6:75604780-75604802 TAAAATATTCCGGCCAGGCGTGG + Intronic
1011854738 6:91675548-91675570 GAGAAGAAGATGGCCAGGCACGG - Intergenic
1012211599 6:96525190-96525212 AAGAAATTGCCGGCCAGGCATGG - Intronic
1012229451 6:96743424-96743446 TAGAAAATTGTGGCCAGGCATGG - Intergenic
1012328510 6:97955450-97955472 AAGAATAAGAAGGCCAGGTATGG + Intergenic
1012368502 6:98472888-98472910 TAGAATTTCAAGGCCAGGCATGG + Intergenic
1013101092 6:106987303-106987325 TAGAAAAGAAAGGCCAGGCATGG + Intergenic
1013200974 6:107895730-107895752 TAGAAACTGAAAGCCAGGCATGG + Intronic
1013265895 6:108498682-108498704 TGAAATATATCGGCCAGGCACGG + Intronic
1013336563 6:109168884-109168906 TAAAAAATGCTGGCCAGGCATGG - Intergenic
1013456294 6:110332615-110332637 AAGAATGTTTCGGCCAGGCACGG + Intronic
1013481024 6:110552854-110552876 AAGAATATCCAGGCCAGGCATGG - Intergenic
1014004132 6:116397495-116397517 AACAATATACCGGCCAGGCACGG - Intronic
1014091915 6:117413689-117413711 AAGAAAATTACGGCCAGGCTTGG + Intronic
1014195512 6:118554018-118554040 TTAAAAATGAGGGCCAGGCATGG + Intronic
1014292881 6:119580723-119580745 TACATTATGAGGGTCAGGCATGG + Intergenic
1014451214 6:121583769-121583791 AAATATATGATGGCCAGGCATGG - Intergenic
1014921408 6:127218086-127218108 AAGAATAGGGAGGCCAGGCACGG - Intergenic
1014938427 6:127411243-127411265 TAGAATATTAAGGCCAGGTGTGG + Intergenic
1015653258 6:135487054-135487076 TAAAATATCAGGACCAGGCATGG - Intronic
1016288761 6:142504855-142504877 TAGAAAAAGAAGGCCAGGCAGGG - Intergenic
1016426753 6:143943152-143943174 AAGAATATTCTGGCCAGGCACGG - Intronic
1016558168 6:145363374-145363396 TAGAATATAATGGCCAGAAACGG + Intergenic
1016598394 6:145827714-145827736 AAGAAAATGTGGGCCAGGCAGGG + Intergenic
1017094276 6:150790729-150790751 AAGAATATCTCGGCCGGGCATGG + Intronic
1017201380 6:151758468-151758490 TAGAAGAGGAAGGCCAGGGATGG + Intronic
1018095655 6:160385258-160385280 GAGAAGATGCTGGCCAGGCAGGG - Intronic
1018773288 6:166991256-166991278 TAAAAATTGAAGGCCAGGCATGG - Intergenic
1018833566 6:167465684-167465706 TAGAACAGGACGTCCAGACATGG + Intergenic
1019066846 6:169309528-169309550 AAGAAAATAATGGCCAGGCATGG + Intergenic
1019335576 7:481046-481068 TAGGAAAAGAGGGCCAGGCAGGG + Intergenic
1020923157 7:14290850-14290872 TAGAGAATGTTGGCCAGGCATGG + Intronic
1021183811 7:17539191-17539213 TACAAAAAGATGGCCAGGCACGG + Intergenic
1021445646 7:20731062-20731084 AAAAATAAGAAGGCCAGGCACGG + Intronic
1022065444 7:26851127-26851149 TAGGAATTGACAGCCAGGCAGGG + Intronic
1022332097 7:29389761-29389783 AAGAATCAGCCGGCCAGGCACGG + Intronic
1022507108 7:30914151-30914173 TAAAAAATGAAGGCCAGGGAGGG - Intronic
1022835722 7:34112202-34112224 TAGACAATGAAGGCCAGGCGCGG + Intronic
1023065569 7:36374060-36374082 TAAAATAAAATGGCCAGGCATGG - Intronic
1023371980 7:39520878-39520900 TAGAATATTCCTGCCAGACATGG + Intergenic
1023912148 7:44563794-44563816 TAGAGTCTCACGGCCAGGCATGG + Intergenic
1024078149 7:45833923-45833945 GAGAATGAGAGGGCCAGGCATGG + Intergenic
1024321568 7:48076427-48076449 TTGAAAATTAAGGCCAGGCATGG + Intergenic
1025085969 7:56023551-56023573 TAAAAAATAAAGGCCAGGCATGG - Intronic
1025094244 7:56085249-56085271 TATAAAATTAAGGCCAGGCATGG - Intronic
1025277622 7:57597347-57597369 AAGAATTTTACGGCCAGGCGTGG - Intergenic
1025297918 7:57790936-57790958 CAGAATATACAGGCCAGGCATGG + Intergenic
1025602135 7:63011052-63011074 TAAAAAAAGAGGGCCAGGCATGG - Intergenic
1026041915 7:66875247-66875269 TACAAAATTAGGGCCAGGCATGG - Intergenic
1026688260 7:72531097-72531119 TAGAAAATGTTGTCCAGGCATGG - Intergenic
1026723496 7:72852981-72853003 TAGAAAATGTTGTCCAGGCATGG - Intergenic
1026951617 7:74351164-74351186 TAAAATATTTTGGCCAGGCACGG + Intronic
1027210285 7:76141638-76141660 TAGCACACGAAGGCCAGGCATGG - Intergenic
1027372697 7:77522932-77522954 AAGAATGTGAAGGCCAGGCATGG - Intergenic
1027960096 7:84934820-84934842 TACAAAATGAAAGCCAGGCATGG + Intergenic
1028241866 7:88431356-88431378 TCCAATATGTAGGCCAGGCATGG - Intergenic
1029073750 7:97920292-97920314 TAGGACAAGAGGGCCAGGCATGG - Intergenic
1029266575 7:99346687-99346709 TACATTATAAAGGCCAGGCACGG + Intronic
1029508503 7:100977856-100977878 TAGAAAAGGCTGGCCAGGCACGG - Intronic
1029548876 7:101226012-101226034 TGGAGTGTTACGGCCAGGCAAGG + Intergenic
1029901587 7:104046850-104046872 TATAAAATGTGGGCCAGGCACGG + Intergenic
1030488146 7:110197481-110197503 TAGAACAGGTAGGCCAGGCATGG - Intergenic
1030793293 7:113756143-113756165 TAGCATACAATGGCCAGGCACGG - Intergenic
1031013293 7:116546397-116546419 AAGAATATGCAGGCCAGGCGTGG + Intronic
1031168515 7:118261143-118261165 AAGAACATTTCGGCCAGGCACGG - Intergenic
1031237411 7:119194879-119194901 TACAATATGAGTGCCAGGCCAGG + Intergenic
1031726236 7:125243048-125243070 TAGTATGTTATGGCCAGGCATGG - Intergenic
1032561849 7:132900704-132900726 TAGAATTTGGAGGCTAGGCATGG + Intronic
1032830487 7:135620241-135620263 TAAAATATCTCGGCCTGGCATGG + Intronic
1033237542 7:139650057-139650079 TAGGATATTTAGGCCAGGCATGG + Intronic
1033527832 7:142233743-142233765 AAGAATATGATGGCCGGGAATGG - Intergenic
1033722407 7:144075537-144075559 TAGAACGTGCCGGCCAGACACGG + Intergenic
1033802199 7:144914282-144914304 TAAAACATGCAGGCCAGGCATGG - Intergenic
1034638100 7:152583317-152583339 TAGAGAATGAGGGCCAAGCATGG - Intergenic
1034662079 7:152780061-152780083 AAGAATATTAGGGCCAGGCACGG + Intronic
1035040514 7:155923419-155923441 TAGAAGATGTCAGCCAGGCATGG - Intergenic
1035831496 8:2699387-2699409 TACATTATTAGGGCCAGGCATGG - Intergenic
1036190883 8:6669799-6669821 GAGCACCTGACGGCCAGGCAGGG + Intergenic
1036243942 8:7100967-7100989 TAGAACAAGAGGGCCAGGCATGG + Intergenic
1036291507 8:7496588-7496610 TAGAATATGCTGGCCAGGCGCGG - Intronic
1036329982 8:7814955-7814977 TAGAATATGCTGGCCAGGCGCGG + Intronic
1036458908 8:8934589-8934611 AAGTATATGCAGGCCAGGCATGG + Intergenic
1036547434 8:9785574-9785596 AAGAATCTGCCGGCCAGGCGCGG + Intergenic
1036897902 8:12650455-12650477 TAGGACAAGAGGGCCAGGCATGG - Intergenic
1037220458 8:16513044-16513066 AAGCTTATGTCGGCCAGGCATGG - Intronic
1037405786 8:18541058-18541080 TAGATTTTGATGGCCAGGGAAGG - Intronic
1037504569 8:19517145-19517167 AAGAAAAAGAGGGCCAGGCATGG + Intronic
1037641838 8:20751584-20751606 AAAAATATGTTGGCCAGGCACGG - Intergenic
1037978489 8:23232162-23232184 TAGCCTATGACGGCCGGGCACGG + Intergenic
1038046004 8:23765965-23765987 AAAAACATGATGGCCAGGCACGG - Intergenic
1038412878 8:27371836-27371858 TAGATTCTGTTGGCCAGGCATGG - Intronic
1038546898 8:28432764-28432786 AAGAATATTCCAGCCAGGCATGG + Intronic
1038578594 8:28727174-28727196 CAGAATAAAAGGGCCAGGCATGG - Intronic
1038762813 8:30400376-30400398 AAGAAAATGAGGGCCAGGCGTGG - Intronic
1038974104 8:32672332-32672354 TAGAAGATGAAGGCCAGGCATGG - Intronic
1039271382 8:35884279-35884301 TAGCATTTGTGGGCCAGGCATGG - Intergenic
1039304439 8:36246289-36246311 TAAAAACTCACGGCCAGGCACGG - Intergenic
1039501805 8:38023646-38023668 AAGAAAAGGAGGGCCAGGCATGG - Intergenic
1040056895 8:43066547-43066569 AAGAATATTCAGGCCAGGCAAGG - Intronic
1040509038 8:48077350-48077372 TAAAATAAAAAGGCCAGGCATGG - Intergenic
1040894451 8:52351008-52351030 CAAAAAAAGACGGCCAGGCACGG - Intronic
1041081703 8:54220821-54220843 TAAAATAAGACAGCCAGGCATGG - Intergenic
1041499307 8:58522662-58522684 TAAAAAATCAGGGCCAGGCACGG + Intergenic
1042328373 8:67552481-67552503 TAAAAAATGATGGCCGGGCACGG + Intronic
1042458878 8:69039045-69039067 TAGAGTATTTGGGCCAGGCATGG + Intergenic
1043089642 8:75881891-75881913 GAAAATAAGAGGGCCAGGCACGG - Intergenic
1043361969 8:79483544-79483566 AAGAATTTGATGGCAAGGCAGGG - Intergenic
1043399848 8:79873089-79873111 AAGATTATGAAGGCCAGGCACGG - Intergenic
1043477908 8:80622855-80622877 TACATTCTGAAGGCCAGGCAAGG + Intergenic
1043967075 8:86490865-86490887 TAGAAATTGTCAGCCAGGCATGG + Intronic
1044234459 8:89814462-89814484 TATATTATAAAGGCCAGGCATGG + Intergenic
1044285013 8:90400747-90400769 AACAATATGGAGGCCAGGCACGG - Intergenic
1044993134 8:97814217-97814239 AAGAAGTTGAAGGCCAGGCATGG + Intronic
1045260461 8:100568827-100568849 AAGAATATACAGGCCAGGCATGG + Intergenic
1045665352 8:104478388-104478410 CAGAAAATACCGGCCAGGCATGG - Intergenic
1046039402 8:108884004-108884026 AAGAATGTGGCGGACAGGCATGG - Intergenic
1047017699 8:120741316-120741338 TAGTGTTTTACGGCCAGGCACGG + Intronic
1047038754 8:120969500-120969522 TAGTAGATGAGGGCCGGGCATGG - Intergenic
1047132801 8:122039716-122039738 TATAATTTCAAGGCCAGGCATGG - Intergenic
1047483963 8:125311786-125311808 AAAAATAAGATGGCCAGGCACGG + Intronic
1049091330 8:140516439-140516461 GAGATAATGAAGGCCAGGCATGG - Exonic
1049827256 8:144677056-144677078 AAAAATATGCAGGCCAGGCACGG - Intergenic
1049946643 9:603662-603684 TAAAAAATGTAGGCCAGGCATGG + Intronic
1049977291 9:871762-871784 AAGACTAGGCCGGCCAGGCACGG - Intronic
1050126604 9:2362494-2362516 AAGCATATGACAGCCAGGCCTGG + Intergenic
1050130862 9:2410431-2410453 AAGAATTTCAAGGCCAGGCACGG - Intergenic
1050414355 9:5399696-5399718 TAAAATACGCAGGCCAGGCACGG + Intronic
1050475004 9:6031973-6031995 TAGAGGATAAGGGCCAGGCATGG + Intergenic
1051503584 9:17804197-17804219 CAGAAAATGGAGGCCAGGCACGG - Intergenic
1051553379 9:18355714-18355736 TAAAAAATGCTGGCCAGGCATGG + Intergenic
1051939879 9:22492878-22492900 AAGAAAATTTCGGCCAGGCATGG - Intergenic
1052853019 9:33389463-33389485 TAGGATATTCTGGCCAGGCATGG - Intronic
1053667898 9:40329247-40329269 TAGATTTTGAAGGCAAGGCAAGG - Intergenic
1053681059 9:40485653-40485675 TAGGATATTCTGGCCAGGCATGG - Intergenic
1053931048 9:43113967-43113989 TAGGATATTCTGGCCAGGCATGG - Intergenic
1054282654 9:63139281-63139303 TAGGATATTCTGGCCAGGCATGG + Intergenic
1054294145 9:63321168-63321190 TAGGATATTCTGGCCAGGCATGG - Intergenic
1054379043 9:64469286-64469308 TAGATTTTGAAGGCAAGGCAAGG - Intergenic
1054392167 9:64625657-64625679 TAGGATATTCTGGCCAGGCATGG - Intergenic
1054426814 9:65130868-65130890 TAGGATATTCTGGCCAGGCATGG - Intergenic
1054503561 9:65890672-65890694 TAGGATATTCTGGCCAGGCATGG + Intronic
1054516713 9:66047036-66047058 TAGATTTTGAAGGCAAGGCAAGG + Intergenic
1054677207 9:67868987-67869009 TAGAAAAGTAAGGCCAGGCATGG - Intronic
1055431640 9:76250014-76250036 AAGAAAGTGAAGGCCAGGCACGG + Intronic
1055693461 9:78858236-78858258 TGGAAGAGGAGGGCCAGGCAGGG + Intergenic
1056345248 9:85687797-85687819 AAGAAAATGGCGGCCAGGCGCGG + Intronic
1056433833 9:86556125-86556147 AAACATATGCCGGCCAGGCACGG + Intergenic
1056607276 9:88096625-88096647 TAAAAAATTAGGGCCAGGCATGG - Intergenic
1057188857 9:93074900-93074922 AAGAATCTGCTGGCCAGGCATGG - Intronic
1057419515 9:94899457-94899479 AAAATTATGAAGGCCAGGCACGG + Intronic
1057664044 9:97029402-97029424 AAGAAAATCATGGCCAGGCACGG - Intergenic
1058239393 9:102538043-102538065 TAAAATTTTCCGGCCAGGCATGG + Intergenic
1058659104 9:107252659-107252681 GAAAATATGGCGGCCAGGCGTGG + Intergenic
1058953139 9:109922127-109922149 TGGAAAAAGAGGGCCAGGCACGG + Intronic
1060001320 9:119961627-119961649 TAGAATATGACAGCTGGGAAGGG + Intergenic
1060070417 9:120542211-120542233 GAGAAAAGCACGGCCAGGCATGG + Intronic
1060419598 9:123458289-123458311 TAGCAGATGGGGGCCAGGCACGG - Intronic
1060697812 9:125724262-125724284 TAGAACTTCACGGCCAGGCGTGG + Intergenic
1060877807 9:127095876-127095898 TAGAACCTGACGGGAAGGCAGGG + Intronic
1061022856 9:128027516-128027538 TACTAAATGAAGGCCAGGCATGG + Intergenic
1061109845 9:128561077-128561099 AATAATATGTCGGCCAGGCACGG + Intronic
1061139893 9:128759465-128759487 TACAATATTCGGGCCAGGCACGG - Intronic
1061358618 9:130125528-130125550 TATAAAATGAAAGCCAGGCATGG - Intronic
1061682598 9:132250335-132250357 AGGAACATGAGGGCCAGGCAGGG + Intergenic
1062092635 9:134686540-134686562 AAGAATTTGATGGCCAGGCGCGG - Intronic
1062175171 9:135157829-135157851 TAAAAAATGTTGGCCAGGCATGG - Intergenic
1062593717 9:137287976-137287998 GAGAATATTTGGGCCAGGCACGG + Intergenic
1062639065 9:137507687-137507709 TAAAATACGGGGGCCAGGCATGG + Intronic
1062639075 9:137507761-137507783 TAAAATACGGGGGCCAGGCATGG + Intronic
1062702708 9:137916321-137916343 TAAAAAATGCAGGCCAGGCACGG - Intronic
1203487687 Un_GL000224v1:72727-72749 AAGAATATTAAGGCCAGGCATGG - Intergenic
1203500308 Un_KI270741v1:14622-14644 AAGAATATTAAGGCCAGGCATGG - Intergenic
1185710198 X:2297411-2297433 TAGGAAAGGATGGCCAGGCAAGG - Intronic
1186861533 X:13677369-13677391 TAAAATATGTAGGCCGGGCATGG + Intronic
1187063501 X:15810724-15810746 CAGAATATCAGGGCCAGGCGCGG + Intronic
1187435331 X:19262667-19262689 TAGAAAATTTTGGCCAGGCAAGG - Intergenic
1188934824 X:36161134-36161156 AAGAAAATTACGGCCAGGCGCGG - Intergenic
1189015395 X:37091615-37091637 AAGAAAATGAGGGCCAGGCGTGG - Intergenic
1189124694 X:38433871-38433893 AAGAATTTTAGGGCCAGGCACGG - Intronic
1189161792 X:38816798-38816820 TTAAATATGAGGGCCAGGGAAGG + Intergenic
1189298332 X:39934807-39934829 AAAAAAATGACAGCCAGGCATGG + Intergenic
1189425315 X:40895259-40895281 TTGAGAATGAGGGCCAGGCATGG - Intergenic
1190011006 X:46784716-46784738 TAGAAATAGATGGCCAGGCATGG + Intergenic
1190716458 X:53108177-53108199 AAAAATTTGAAGGCCAGGCACGG - Intergenic
1190865570 X:54381900-54381922 TAGAATATCACGGCTGGGCGCGG + Intergenic
1191834482 X:65449326-65449348 AAGAAAATGTGGGCCAGGCATGG + Intronic
1192121356 X:68459311-68459333 AAGAAAATGTAGGCCAGGCACGG + Intergenic
1192350851 X:70355104-70355126 TAGATGATGCCAGCCAGGCAGGG - Intronic
1193137806 X:77992351-77992373 AAGAATCTAAAGGCCAGGCATGG - Intronic
1194085057 X:89516207-89516229 AAGACTAGGATGGCCAGGCATGG - Intergenic
1194103840 X:89742848-89742870 AAGAATATGTGGGACAGGCACGG - Intergenic
1194295384 X:92120446-92120468 TAGAAAATGGTGGCCAGGCGCGG - Intronic
1195043212 X:101032963-101032985 AAGAAATTGGCGGCCAGGCACGG + Intronic
1195043416 X:101034430-101034452 CAGAAAATGTAGGCCAGGCATGG - Intronic
1195139495 X:101944695-101944717 TGGAAAATGTGGGCCAGGCATGG - Intergenic
1195170615 X:102264504-102264526 TTGTATGTGGCGGCCAGGCACGG + Intergenic
1195188244 X:102422595-102422617 TTGTATGTGGCGGCCAGGCACGG - Intronic
1195375951 X:104228421-104228443 TAGAAAATACAGGCCAGGCACGG - Intergenic
1195519707 X:105816862-105816884 TAGGAAATGATAGCCAGGCATGG + Intergenic
1195600319 X:106739447-106739469 TAAAATATGAGGGCCGGGCATGG - Intronic
1195610031 X:106855878-106855900 TTGAATTTGTTGGCCAGGCATGG + Intronic
1195976658 X:110534586-110534608 TAGAATTTGGAGGCCAGGCATGG + Intergenic
1196070049 X:111510494-111510516 TAGAATATGCTGGTAAGGCAAGG + Intergenic
1197751652 X:129968110-129968132 TAGAAAATTCCGGCCTGGCAGGG - Intergenic
1198149066 X:133890425-133890447 TAAAATATATAGGCCAGGCATGG + Intronic
1198628328 X:138604881-138604903 TAAAATATGTTGGCCAGGCACGG + Intergenic
1198655418 X:138908365-138908387 AAGAAAATGATGGCCAGGCACGG - Intronic
1198735572 X:139781421-139781443 TAAAGTATGCAGGCCAGGCACGG + Intronic
1198849754 X:140953622-140953644 TAGAAATTGTTGGCCAGGCATGG - Intergenic
1200126565 X:153817953-153817975 CATAAGATGACGGCCAGGCACGG + Intronic
1200278394 X:154756023-154756045 TATAAAAAGACAGCCAGGCATGG + Intergenic
1200306690 X:155032565-155032587 TAAGAAATGAAGGCCAGGCATGG - Intronic
1200437706 Y:3172091-3172113 AAGACTAGGATGGCCAGGCATGG - Intergenic
1200455793 Y:3390599-3390621 AAGAATATGTGGGGCAGGCACGG - Intergenic
1200612886 Y:5344954-5344976 TAGAAAATGGTGGCCAGGCGCGG - Intronic
1200764737 Y:7070899-7070921 TAAAATCTGCCAGCCAGGCATGG + Intronic
1201104492 Y:10753359-10753381 TAGAATGGGACGGAAAGGCATGG - Intergenic
1201237701 Y:11927512-11927534 TTGAAAATGAGGGCCAGGCATGG + Intergenic
1202045133 Y:20730108-20730130 TAAAATCTGCCAGCCAGGCATGG + Intergenic