ID: 903874945

View in Genome Browser
Species Human (GRCh38)
Location 1:26467534-26467556
Sequence CTGGAGACAGACATGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 380}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903874945_903874950 11 Left 903874945 1:26467534-26467556 CCCTGCTCCATGTCTGTCTCCAG 0: 1
1: 0
2: 1
3: 41
4: 380
Right 903874950 1:26467568-26467590 TCCCTCACAGCTCCATTGTGAGG 0: 1
1: 0
2: 2
3: 27
4: 247
903874945_903874954 22 Left 903874945 1:26467534-26467556 CCCTGCTCCATGTCTGTCTCCAG 0: 1
1: 0
2: 1
3: 41
4: 380
Right 903874954 1:26467579-26467601 TCCATTGTGAGGGTCAAGTGAGG 0: 1
1: 0
2: 0
3: 15
4: 149
903874945_903874952 12 Left 903874945 1:26467534-26467556 CCCTGCTCCATGTCTGTCTCCAG 0: 1
1: 0
2: 1
3: 41
4: 380
Right 903874952 1:26467569-26467591 CCCTCACAGCTCCATTGTGAGGG 0: 1
1: 0
2: 1
3: 17
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903874945 Original CRISPR CTGGAGACAGACATGGAGCA GGG (reversed) Intronic
900754280 1:4423031-4423053 CTGGCGAGGGAGATGGAGCAGGG - Intergenic
900932477 1:5745981-5746003 CTGGTGGCAGCCATGGGGCATGG + Intergenic
901013312 1:6213066-6213088 CTGGAGAAGGTCATGGAGCTGGG - Exonic
901952002 1:12756690-12756712 CAGCAGACAGACATGGATTAAGG + Intronic
902585456 1:17436567-17436589 CTGGAGACAGAGGTGGGCCAGGG + Intronic
902709530 1:18229196-18229218 CTGGAGGAAGTGATGGAGCATGG + Intronic
902846048 1:19111400-19111422 CTGGAGACAGGGATGCAGTAGGG - Intronic
903361469 1:22779872-22779894 CTGGGCACAGAATTGGAGCATGG + Intronic
903539296 1:24087715-24087737 AAGGAGAAAGACATTGAGCAGGG - Intronic
903874945 1:26467534-26467556 CTGGAGACAGACATGGAGCAGGG - Intronic
904255311 1:29250913-29250935 CTAGAGACGGACATGGGTCAGGG + Intronic
904282714 1:29432627-29432649 GTGGAGGTAGACATGGAGCAAGG + Intergenic
904950341 1:34233224-34233246 CTTGAAAGAGAAATGGAGCAGGG - Intergenic
904982418 1:34517858-34517880 TTGGAGAAAGAAAGGGAGCAAGG - Intergenic
906128987 1:43444729-43444751 CTGGAGAGGAACATAGAGCAGGG - Intronic
906325829 1:44844721-44844743 CAGGAGAGAGACATGAATCAAGG - Intergenic
907525815 1:55053387-55053409 CTGTGGCCAGACATTGAGCAAGG + Intronic
908683414 1:66687818-66687840 GTGGAGACAGAGAGGGAGCAGGG + Intronic
908790212 1:67773590-67773612 AAGGAGAGAGACATGGAGCAAGG + Intronic
909218837 1:72928081-72928103 CTGAAAAGAGACAAGGAGCAGGG - Intergenic
910731145 1:90398766-90398788 CAGGAGAGAGAGAGGGAGCAAGG + Intergenic
911361815 1:96885982-96886004 CTAGAGAAAAACCTGGAGCAGGG - Intergenic
911507144 1:98767406-98767428 CTAGAGACAGAAATGTAGCTGGG + Intergenic
913207069 1:116548967-116548989 TTGCTGAGAGACATGGAGCAAGG - Intronic
914783502 1:150807205-150807227 TTGGAGACAGACAAATAGCAAGG + Intronic
914951161 1:152115556-152115578 GTGGAGACAGAGGTGGAGCTGGG - Intergenic
915334207 1:155131129-155131151 CAGGAGACAGTGATGGTGCAGGG + Intronic
915461304 1:156072267-156072289 GTGGAGACAGCCCTGGGGCAGGG - Exonic
915591608 1:156874173-156874195 GAGGAGACAGCCATGCAGCAGGG + Intronic
918363691 1:183784492-183784514 CAGGAGTCAGACCTGGAACATGG + Intronic
919757036 1:201072723-201072745 CTGGAGACTGGACTGGAGCAGGG - Intronic
920089452 1:203441841-203441863 CGAGAGACAGAGATGCAGCAGGG + Intergenic
920691552 1:208150734-208150756 CTGTAGGAAGGCATGGAGCAGGG - Intronic
921211372 1:212902373-212902395 ATGGAAACAGAAATAGAGCAGGG + Intergenic
921669665 1:217912132-217912154 CTGGAGACAGACATGGGGTCGGG + Intergenic
922096924 1:222450563-222450585 CTGGAGAAAGAAAAGAAGCAGGG + Intergenic
922650893 1:227337381-227337403 CTGAATAAAGACATGCAGCAAGG + Intergenic
1063102057 10:2958886-2958908 CTGGTGACAGACATGCAGAATGG + Intergenic
1063283905 10:4662045-4662067 CTAGAGACAGACAAGAGGCATGG - Intergenic
1063691598 10:8292845-8292867 CTGGAGGAAGAAATGCAGCACGG - Intergenic
1064312781 10:14226612-14226634 TTGGACACAGACATGGACCATGG - Intronic
1066519291 10:36197643-36197665 CTGGGGACTGTCAGGGAGCAGGG + Intergenic
1066995704 10:42561032-42561054 CTGGAGACTGAGATGCTGCAGGG - Intergenic
1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG + Intergenic
1067581855 10:47451355-47451377 CTGCAGAAAGACAAGAAGCAGGG + Intergenic
1068633565 10:59323347-59323369 CTGGAGACAGCCCTGGATCCAGG - Intronic
1068853908 10:61777093-61777115 CTGGAGACAGACATTAAACATGG - Intergenic
1068991658 10:63157183-63157205 TGGGAGACAGACATGGGGCAGGG - Intergenic
1070451904 10:76567493-76567515 CTAAAGTCAGACATAGAGCAAGG - Intergenic
1070755928 10:78993271-78993293 CTGGTTACAGACATAGATCATGG + Intergenic
1071686076 10:87758786-87758808 CTGTAGACATACATGTAACATGG + Intronic
1074002988 10:109390895-109390917 CTGGAGACAGTCAGAGAACAGGG + Intergenic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1075103035 10:119519317-119519339 CTGGGGACAGACAGGGAGACAGG - Intronic
1075838545 10:125477260-125477282 CTGGAGCCAGGCAGGGTGCAGGG - Intergenic
1076035740 10:127196937-127196959 CAGCAGACAGTCATGCAGCAGGG - Intronic
1076744871 10:132507774-132507796 CTGGAGCCAGGGATGGGGCAAGG + Intergenic
1077265176 11:1645076-1645098 CTGGCCAGAGAGATGGAGCAGGG - Intergenic
1077524843 11:3057765-3057787 CAGGAGGCCGACCTGGAGCAGGG + Intergenic
1077785876 11:5382945-5382967 TTGGAGACTGGCATGAAGCAAGG - Intronic
1079351183 11:19693358-19693380 TTGGAGACAGAAATAGGGCATGG - Intronic
1081641274 11:44755975-44755997 ATGGAGAGAGAGATGGAGGAGGG + Intronic
1081711924 11:45222679-45222701 CTGAAGTCAAACATGGGGCAGGG + Intronic
1081777465 11:45685334-45685356 CTGGAGACAGGGTGGGAGCAAGG - Intergenic
1083319852 11:61838900-61838922 GTGGAGAGAGCCAAGGAGCAAGG - Intronic
1083612684 11:64011655-64011677 CGGGACGAAGACATGGAGCAGGG + Intronic
1083627562 11:64079353-64079375 GGGGAGACAGATTTGGAGCAAGG + Intronic
1083778627 11:64906754-64906776 CTGGTGCTGGACATGGAGCACGG - Exonic
1085386360 11:76160451-76160473 CTGGAGAGAGACCTGGGGCCCGG + Intergenic
1087092555 11:94288729-94288751 CTGGAGAAAGAGGTGGAGAATGG + Intergenic
1087417264 11:97872392-97872414 CTGGCAACAGCCATGCAGCATGG - Intergenic
1087433841 11:98088042-98088064 TTGGAGAGAGAGATGCAGCATGG - Intergenic
1087574914 11:99977554-99977576 ATGCAGACAGACAAGAAGCAAGG + Intronic
1087576524 11:99996793-99996815 CAGGAGAGAGAGAGGGAGCATGG + Intronic
1089294725 11:117460827-117460849 CTGGAGCCAGGCACGCAGCAAGG - Intronic
1089655216 11:119942159-119942181 CTGAAGACAGATATGTAGCTGGG - Intergenic
1089762495 11:120738591-120738613 CTGAAGATAGACCTGCAGCAGGG + Intronic
1090030078 11:123198522-123198544 CTGGACAAAGACATGGAGTTAGG + Intergenic
1090246744 11:125221448-125221470 CTGCAGACGGGCCTGGAGCAGGG - Intronic
1090422748 11:126586880-126586902 CTTGAGGCAGGCATGCAGCAAGG + Intronic
1090856957 11:130618218-130618240 CTGGAGACAGCTATGTGGCAGGG + Intergenic
1090864944 11:130691408-130691430 GTGGAGAGAGAGAGGGAGCAAGG - Intronic
1091222258 11:133936442-133936464 CCCGAGCCAGACATGCAGCAGGG + Intronic
1091775872 12:3184548-3184570 CTTGAGAGAGACAGGTAGCAAGG + Intronic
1092273503 12:7041517-7041539 CAGGACACCGACATGGAACAGGG - Intronic
1092748261 12:11693720-11693742 CTGGGGACAGAGATAGTGCAGGG - Intronic
1094698112 12:32841735-32841757 CTGTTGACAGGCATGGAGAAAGG - Intronic
1095779967 12:46048655-46048677 CCTGAGATAGAGATGGAGCAGGG + Intergenic
1097321855 12:58234314-58234336 CTGGAGACAGACATTGAATTGGG + Intergenic
1098066620 12:66625136-66625158 CTGGGGACAGATTTGGAGAAAGG + Intronic
1099173946 12:79398930-79398952 CTGGACAGTGACTTGGAGCAGGG - Intronic
1101001308 12:100360972-100360994 CTGAAGACAGACACGATGCAGGG - Intronic
1102540852 12:113618061-113618083 CAGGAGACAGCAATGGGGCAGGG + Intergenic
1102545378 12:113650790-113650812 CTGGAGGCTGACATGAAGGAAGG - Intergenic
1102575880 12:113855908-113855930 CTCCAGACAGACCTGGAGCTGGG + Intronic
1104680525 12:130748147-130748169 CTGGAGGCCTGCATGGAGCAGGG - Intergenic
1104805675 12:131587803-131587825 TTCGAGTCAGGCATGGAGCAGGG - Intergenic
1107010678 13:35667448-35667470 CTGGAGACAGATATCAAGCGTGG - Exonic
1107051309 13:36053410-36053432 CTGGAAATAGCCATGGAGAAAGG + Intronic
1107126427 13:36851348-36851370 CTGGAAGGAGACATGGAGCTAGG - Intronic
1107432194 13:40350183-40350205 CTGGAGAACAGCATGGAGCAAGG - Intergenic
1108692284 13:52870373-52870395 GTATAGAGAGACATGGAGCAGGG + Intergenic
1108827331 13:54429656-54429678 CTGGAGACAGAGATAGTGAAAGG - Intergenic
1109438366 13:62336152-62336174 CTGGAGATAGACTTGGAAAAAGG + Intergenic
1109872178 13:68346345-68346367 ATGTAGATAGACATGGAACAGGG + Intergenic
1110038114 13:70714982-70715004 CTGGGGACAGACATGTAAAATGG - Intergenic
1110495315 13:76161344-76161366 CTGGAGTCAGTCATGGAGTAAGG - Intergenic
1111235587 13:85404031-85404053 CTGGAGATAGACAGTGAGGATGG - Intergenic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1113420748 13:110169996-110170018 CTTGAGACAGAAATTGAGGAAGG + Intronic
1113471548 13:110550261-110550283 ATGAAGAGACACATGGAGCAAGG - Intronic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1118839880 14:69502201-69502223 CTTGAGCCAGACATGCAGTAAGG + Intronic
1120037070 14:79709800-79709822 CTGAAGACAGACAAGGAGAGAGG + Intronic
1121545170 14:94757906-94757928 CTGGAGAGCAACATGGAGCATGG + Intergenic
1121642858 14:95497633-95497655 CTGGAGACGGTCAGAGAGCAAGG + Intergenic
1122083206 14:99281233-99281255 CTGGATCGAGACATGGAGGAAGG + Intergenic
1122283714 14:100638830-100638852 CTGGAGACAAACAGTGACCAAGG - Intergenic
1122798863 14:104219983-104220005 CTGGAGTCAGACATGGTGCGGGG + Intergenic
1124713147 15:32031167-32031189 CTGGGGACAGACTCAGAGCATGG - Intronic
1126293208 15:47105993-47106015 CTGGAGACATAAATAGAGGAAGG - Intergenic
1126340789 15:47639001-47639023 CAGGAGACAGACATAGTGCACGG - Intronic
1126949258 15:53862237-53862259 ATGCAGACAGACTTGGAACAAGG + Intergenic
1128699942 15:69796804-69796826 CTTGGGACAGAGATGGGGCAGGG - Intergenic
1128889530 15:71318319-71318341 GTGGAGACAGACAGAGAGCCAGG + Intronic
1129722399 15:77884926-77884948 CTGAAGAAAGTCATGGACCAGGG - Intergenic
1130012647 15:80163545-80163567 CTGCAGAAGGACATGGGGCAAGG - Intronic
1130876027 15:88015401-88015423 CAGGAGGCAGACAGGGGGCAGGG - Intronic
1131264369 15:90906897-90906919 GTGGAGGCAGACATGGGGTAAGG + Exonic
1131622583 15:94083109-94083131 CTGGAGCCAGGATTGGAGCATGG - Intergenic
1131981553 15:97999519-97999541 TTGGACACAGACATGCACCAAGG + Intergenic
1132958221 16:2607796-2607818 CTGGTGCCAGGCATGGGGCAGGG - Intergenic
1133234172 16:4380167-4380189 CTGGTGACAGAGCTGGAGCTGGG - Intronic
1133324596 16:4935512-4935534 CTGGACGCAGCCATGGAGGAGGG + Intronic
1133657029 16:7875439-7875461 CTGCAGGAAGACATGGAGAAGGG + Intergenic
1133977182 16:10607570-10607592 CTGGACACAGACATGTACAAGGG + Intergenic
1133978639 16:10617833-10617855 CTGGAGAGGGAGAGGGAGCAAGG + Intergenic
1134797647 16:17056695-17056717 CTGGAGACAAGCCTGGAGCCTGG + Intergenic
1135007171 16:18836073-18836095 CTCCAGACAGCCACGGAGCACGG + Exonic
1135481069 16:22821039-22821061 CTGGCTACAGAGATGAAGCAGGG - Intronic
1135645605 16:24159022-24159044 CTGGAGACAGGCCTGCAGGAGGG - Intronic
1136065452 16:27755323-27755345 CAGAAGGCAGAGATGGAGCAGGG - Intronic
1136174614 16:28508164-28508186 CTGGAGACGGACAGGGAACTGGG + Intronic
1137769509 16:51004705-51004727 CTGGGGACAGTCCAGGAGCAGGG - Intergenic
1137822240 16:51457313-51457335 CTGGTGACAGAGATGCATCATGG + Intergenic
1138928979 16:61629159-61629181 CGGGAGAAAGACAAGGAGGAAGG + Intergenic
1141772086 16:86095720-86095742 GTGAAGTCAGACGTGGAGCAGGG - Intergenic
1143410707 17:6706767-6706789 CTGGACACACACCTGGAGCGTGG + Exonic
1144130554 17:12242671-12242693 GTGCAGACAGACAAGCAGCAAGG - Intergenic
1144136700 17:12302117-12302139 CTGGAGACCGAGAAGGAGAATGG - Intergenic
1145900439 17:28487567-28487589 CTGGCCAGAGACAAGGAGCAGGG - Intronic
1147322981 17:39657115-39657137 CCGGAGGCAGAGAGGGAGCAGGG + Intronic
1147550356 17:41437506-41437528 CAGGAGGGAGACGTGGAGCACGG + Exonic
1147585541 17:41652338-41652360 CAGGACACAGACACAGAGCAGGG + Intergenic
1148977470 17:51542171-51542193 CTGTAGGCAGCCCTGGAGCATGG + Intergenic
1149046299 17:52249680-52249702 CTGTAGACAGGCATGGAGCAGGG + Intergenic
1151009267 17:70474525-70474547 CAGGAGACAGAGAGAGAGCAAGG + Intergenic
1151800356 17:76375870-76375892 CTGGAAAAAGACATGGAGCCCGG - Intronic
1152060695 17:78072439-78072461 CTAGAGAGAGACATGGAGATGGG + Intronic
1152850922 17:82634980-82635002 ATGGAGACAGAAAAGTAGCACGG + Intronic
1152935802 17:83135971-83135993 CTGCAGACAGACATGCAGGGAGG - Intergenic
1154145213 18:11861284-11861306 CTGGAGACAGAGGGGCAGCAGGG - Intronic
1154459949 18:14572914-14572936 CTGTAGACAAACATGGACCCTGG + Intergenic
1155482660 18:26306087-26306109 AAGGAGGCAAACATGGAGCACGG - Intronic
1155905190 18:31442329-31442351 AGGGAGACAGACAAGGAGGAGGG + Intergenic
1156095866 18:33531078-33531100 CTGGGAACAGACATGGAGTGGGG + Intergenic
1156914832 18:42453612-42453634 GTGAAGACAGAAATGGAGCTGGG + Intergenic
1157175051 18:45443977-45443999 CTGGAAACACACATGGAGAGTGG + Intronic
1157274238 18:46298846-46298868 CTGGAGAGAGTCATGGAGCGGGG + Intergenic
1157616861 18:48992222-48992244 CTCGGGTCAGACATGGAGGAGGG + Intergenic
1159903970 18:74074220-74074242 TCAGAGACAGGCATGGAGCATGG - Intronic
1159909623 18:74133336-74133358 CTGGAATCAGATTTGGAGCATGG - Intronic
1160463790 18:79058984-79059006 CTCTAGAAAAACATGGAGCAGGG + Intergenic
1160471030 18:79133892-79133914 CTGGAGTCAGAGCTGGAGCCAGG - Intronic
1160902251 19:1434391-1434413 TTGGAGACACACATGGCCCAAGG - Intronic
1161115244 19:2493091-2493113 CTGGAGACAGACACAGAGGTGGG + Intergenic
1161380697 19:3963670-3963692 CTGGGGACAGACAAGAGGCAAGG + Intronic
1161761040 19:6173035-6173057 CTGGGAAAAGACATGGAGAAGGG - Intronic
1162937261 19:13987407-13987429 CTGGACCCAGACTTGGAGCCTGG - Intronic
1163149668 19:15403502-15403524 TTGGAGACAGACATGATGCAAGG - Exonic
1163507430 19:17716494-17716516 CTTGAAACAGTCATGGAGCTGGG + Intergenic
1163738440 19:18995938-18995960 CTGGAGACAGACAGGGCCCTGGG + Intronic
1163871467 19:19824809-19824831 CTGGGGAGAGACAGAGAGCATGG + Intergenic
1163935688 19:20441117-20441139 CTGGAGAGAGAAAGAGAGCATGG - Intergenic
1164530747 19:29046438-29046460 TAGGAGCCAGACATGAAGCAAGG + Intergenic
1165102069 19:33444802-33444824 GTGGAGAGAGACATGGTGGATGG - Intronic
1165320813 19:35084131-35084153 CTGGAGAGAGACATGGTCCTGGG + Intergenic
1166001438 19:39879841-39879863 CAGGAGACATGCAAGGAGCAGGG - Exonic
1166004221 19:39896092-39896114 CAGGAGACATGCAAGGAGCAGGG - Exonic
1166202632 19:41248474-41248496 GTGGACAGAGTCATGGAGCAGGG - Intronic
1166206344 19:41272084-41272106 ATGAAGACAGAGATGAAGCAAGG + Exonic
1166315946 19:41989953-41989975 ATGGAGACAGACATCATGCAAGG - Intronic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1166574062 19:43820378-43820400 GTGGTGACAGACATGGTGTAGGG - Intronic
1166690682 19:44820047-44820069 TTGGAGACAGGCATGGAGTTGGG - Intronic
1166939079 19:46352063-46352085 CTGGAGCCACTCATGGAGCCTGG + Intronic
1167157969 19:47750735-47750757 CTGGAGACAGACGTGGGGAGAGG + Intronic
1167822498 19:51941371-51941393 TTGGAGACAGACATGGAAGGAGG - Intronic
925944589 2:8849360-8849382 CTGGAGCCAGCCAGGGAGGAGGG + Intergenic
926310193 2:11669506-11669528 CTGGATAAAGACTTGGAGCGCGG + Exonic
926796276 2:16621691-16621713 CTGGAGAAAGTGAGGGAGCAAGG - Intronic
928320971 2:30282554-30282576 CAGGTGACAGAGATGGAGCAAGG + Intronic
929524489 2:42687868-42687890 CTGGAGTCAGAGATGAAGAAGGG - Intronic
930741396 2:54836130-54836152 CTGGAGACAGATTTGCAGCCAGG + Intronic
930831205 2:55745187-55745209 CTGGAGAAAGAAAAGGAGCTTGG - Intergenic
931296151 2:60928010-60928032 GTTAAGAGAGACATGGAGCAGGG + Exonic
931839352 2:66132167-66132189 CAGGAGGCAGACCTGGAGCATGG + Intergenic
931867064 2:66425022-66425044 ATGGAGTCAGGGATGGAGCAGGG + Intergenic
932449202 2:71798880-71798902 CTGGAGACAGACAGCGGGAAGGG + Intergenic
932501316 2:72185327-72185349 GTGAAGACAGACATGGAGGAAGG - Intronic
933537722 2:83597396-83597418 CTGGAGCAAGCCAAGGAGCATGG - Intergenic
934035859 2:88088098-88088120 GAGGAGACAGACAGGGAGGATGG - Intronic
934673725 2:96234411-96234433 CAGGAGACAGGAATGGAGGAGGG - Intergenic
935296739 2:101656386-101656408 CTGGAAACAGACCTGGAGGTGGG - Intergenic
937078643 2:119125069-119125091 CTGGGCAGAGACATGCAGCAGGG - Intergenic
937998857 2:127715990-127716012 GTGGAGACAGACACAGGGCAGGG + Intronic
938184580 2:129218450-129218472 CTGGGGAGGGAAATGGAGCAGGG - Intergenic
938777454 2:134554471-134554493 GTGGAGACAGACTGGGAGCCCGG - Intronic
939002886 2:136756604-136756626 TTGGATACAGAATTGGAGCATGG + Intergenic
939798575 2:146678924-146678946 CTGGAGACAGACGTACTGCAGGG - Intergenic
941494605 2:166184138-166184160 CTGGAGAGAGCAATGGTGCACGG + Intergenic
943090729 2:183371769-183371791 CTGTAGACAGAGTTGGTGCAGGG - Intergenic
943763892 2:191639475-191639497 CTGGAATCATACATGGAGGATGG + Intergenic
945012244 2:205477989-205478011 TTGGAGAAGGACACGGAGCAAGG + Intronic
945067200 2:205957277-205957299 CTGGGGACAGCCATTGACCATGG + Intergenic
946392747 2:219426326-219426348 CTGGAGACAGCCCCAGAGCAGGG + Exonic
947345077 2:229182269-229182291 CTGGTGAGAGACATTGATCAAGG + Intronic
947883595 2:233544236-233544258 ATGGAGACAGACATAGGGCAAGG + Intronic
1168895749 20:1322277-1322299 CAGGAGTAGGACATGGAGCAGGG - Intronic
1169191687 20:3662163-3662185 CTGGAGACAGAGAAGGTGCCTGG + Intronic
1170472446 20:16681787-16681809 ATGGAGTCTGACATGAAGCAGGG + Intergenic
1170566557 20:17611230-17611252 CTGGAGCCTGACATGGAACCTGG + Intergenic
1171084093 20:22219958-22219980 CTGGAGAAAGATAAGGAGCCAGG - Intergenic
1171536162 20:25892577-25892599 CTGGAGACAGAAATAGAGGAAGG + Intergenic
1171804936 20:29668581-29668603 CTGGAGACATAAATAGAGGAAGG - Intergenic
1171839123 20:30187847-30187869 CTGGAGACATAAATAGAGGAAGG + Intergenic
1172595958 20:36151353-36151375 CCAGTGACAGACATGGGGCAGGG + Intronic
1172770332 20:37378835-37378857 CTGGAGATAGACAGGGTGGAGGG + Intronic
1172907032 20:38378023-38378045 GGGGAGAAATACATGGAGCATGG + Intergenic
1173585176 20:44176911-44176933 CTGGAGTCACACATGGAGGCTGG - Intronic
1174502766 20:50997667-50997689 CTGGAGACTGTCATGGGGAAGGG - Intergenic
1175008716 20:55712648-55712670 GAGAAGACAGAAATGGAGCAGGG + Intergenic
1175987243 20:62770258-62770280 CAGGAGACAGCCATGGTGTAGGG + Intergenic
1176423551 21:6534003-6534025 CTGGAGGCAGACCTGGAGGCAGG + Intergenic
1176814166 21:13579914-13579936 CTGTAGACAAACATGGACCCTGG - Intergenic
1178678775 21:34653975-34653997 CTAGAGACAAGCATGGAGCAGGG + Intergenic
1179109344 21:38432959-38432981 CTGAAGACAGTCATGGATGAGGG + Intronic
1179318459 21:40268171-40268193 CTTGAGAAAGACATGGAGATGGG - Intronic
1179438073 21:41375593-41375615 CTGGAGACACACAGGGAGAAGGG - Intronic
1179699045 21:43142319-43142341 CTGGAGGCAGACCTGGAGGCAGG + Intergenic
1180198807 21:46212815-46212837 CTGCAGACAGACATCGAGAACGG + Intronic
1181425852 22:22838193-22838215 CTGGATACAGACCTGGAGATAGG + Intronic
1181429877 22:22872808-22872830 CTGGGTACAGACATGGAGACAGG + Intronic
1181690481 22:24556125-24556147 CTGGAGAAAGACTTGCTGCATGG + Intronic
1181737496 22:24893241-24893263 CTGAAGACACAAAGGGAGCAAGG - Intronic
1182109877 22:27715530-27715552 CTGCAGGCAGACAGGAAGCAGGG + Intergenic
1182330656 22:29549483-29549505 ATGGAGACACACATGGTGCCTGG - Intronic
1182534269 22:30988563-30988585 CAGGAGACATACATAGAACATGG + Intergenic
1182924453 22:34109248-34109270 ATGGAGACAGACAGGAAGGAAGG - Intergenic
1183022098 22:35035442-35035464 CTGCAGACATTCCTGGAGCAGGG - Intergenic
1183119645 22:35720545-35720567 CTGGAGATGGACAAGGATCAGGG - Intronic
1183264601 22:36817478-36817500 GTGGAGAGAGAAAGGGAGCAGGG - Intronic
1183432470 22:37774169-37774191 CTGGAGACAGAGGGGGACCAGGG - Exonic
1183469358 22:37997407-37997429 CTGGAGAGAGACAGGGAGCCAGG - Intronic
1183720819 22:39560364-39560386 GTGGAGACAGCCACGGATCAAGG - Intergenic
1184099993 22:42336953-42336975 GGGGAGACAGACAGTGAGCAAGG - Intronic
1184313970 22:43667923-43667945 CCTGAGACAGTCATGGAGAATGG + Intronic
1184615724 22:45637020-45637042 CAGAAGACAGAGGTGGAGCAGGG - Intergenic
1184812989 22:46849778-46849800 CAGGCGACAGTCACGGAGCACGG - Intronic
949420425 3:3859294-3859316 CTGCAGGCAGAAAAGGAGCAAGG - Intronic
950488277 3:13285582-13285604 ATGGAGACAGAGAATGAGCAAGG + Intergenic
950674123 3:14544491-14544513 CTGGAGTCAGAGATGAAGGACGG - Intergenic
951765065 3:26188493-26188515 CTGGAGATAGTCATGAAGAAGGG + Intergenic
953170565 3:40503053-40503075 CAAGACACACACATGGAGCAGGG - Intergenic
954197020 3:49002958-49002980 CTGGAGAGATGGATGGAGCAGGG - Intronic
954424652 3:50437009-50437031 CTGCACACAGACATGGTGCTTGG - Intronic
954955601 3:54516038-54516060 CTGGAGCCTGACATGCATCAGGG + Intronic
955608808 3:60735329-60735351 CTGGAGTCAGAACTGGAGAAGGG - Intronic
956663720 3:71622918-71622940 ATGGAGGCAGAGATGGAGCCAGG + Intergenic
957429586 3:80084885-80084907 GTGGACACAAACATGGGGCAGGG - Intergenic
958741475 3:98078795-98078817 CTGAAAACATCCATGGAGCAGGG - Intergenic
959434039 3:106290970-106290992 GGGGAGAAAGACATGAAGCAGGG + Intergenic
962937312 3:140092827-140092849 CTGGAGACTGAAATGCACCATGG - Intronic
963307606 3:143670567-143670589 CTGGAGAGAAACATGGCTCATGG + Intronic
964026126 3:152077222-152077244 ATAGAAACAGACATGGAGAAGGG - Intergenic
966678534 3:182615911-182615933 CTGGAGACAGAGAAGAAGTAAGG + Intergenic
967010740 3:185431028-185431050 CAGGAGACAGAGAAGGGGCAAGG + Intronic
967301718 3:188020927-188020949 CTGGTGACAGACATAGAGTCAGG - Intergenic
968361150 3:198147860-198147882 CTGGAGACAGACACTGGGCAGGG - Intergenic
968972153 4:3801631-3801653 ATGTAGCCAGACATGGGGCAGGG + Intergenic
969213667 4:5707278-5707300 CTAAAGACAGAAAGGGAGCAGGG + Intronic
969456147 4:7300782-7300804 CTGCAGACAGAAATCAAGCAAGG - Intronic
969718020 4:8877755-8877777 CTGGAGACTGCCCTGGAGCCTGG + Intergenic
970517053 4:16843156-16843178 CTGGATATAGACATTGAACAAGG - Intronic
970938435 4:21602237-21602259 CTGTAATGAGACATGGAGCAAGG - Intronic
971157527 4:24099476-24099498 CTGCAGCCAGGCAAGGAGCACGG + Intergenic
971267121 4:25105580-25105602 CAGGAGGCAGACAAGGAGCCGGG - Intergenic
971615573 4:28786567-28786589 CTGCAGACAGAGGTGGAGGAAGG + Intergenic
971849279 4:31962490-31962512 CTGGAGTGAGACATTGAGCAAGG - Intergenic
976627074 4:87197330-87197352 ATGGAGACAGTCATGTAGCAGGG + Intronic
979067367 4:116155434-116155456 CTGAAGACAAACATGCATCAGGG - Intergenic
981745566 4:148049329-148049351 CTGGAGGCAGGCAAGGAGCAGGG - Intronic
982586696 4:157250407-157250429 CTGGTGCTAAACATGGAGCAGGG + Intronic
984571725 4:181403485-181403507 CTGGAGACAGAGAGAGGGCAGGG + Intergenic
985213987 4:187629222-187629244 GTGGGGACTGACATGGAGCTTGG - Intergenic
985664996 5:1177457-1177479 CTGAAGACAGCCCTGGAGTAAGG + Intergenic
985766816 5:1784444-1784466 CTGGAGGAAGACTGGGAGCACGG - Intergenic
987191905 5:15487126-15487148 GTGGAGAGGGGCATGGAGCAGGG + Intergenic
987706690 5:21468346-21468368 CTGGAGGAAGAAATGCAGCACGG + Intergenic
996352455 5:122560615-122560637 CTGGAGCCCCACATGGTGCAGGG - Intergenic
996965331 5:129301203-129301225 CAGGACACAGACATGGACAAAGG - Intergenic
996984288 5:129539871-129539893 CTGGAAACAAATATGGAGAAAGG - Intronic
999317529 5:150593997-150594019 ATGAAGTCAGACATGGGGCAGGG + Intergenic
999587693 5:153109086-153109108 GTGGAGATAGACAAGTAGCAAGG - Intergenic
1000810847 5:165858918-165858940 CAGGAAACAGTCATGGAGAAAGG + Intergenic
1000834118 5:166134220-166134242 CTGAAGACTGACATGGCCCAGGG - Intergenic
1002078837 5:176725956-176725978 CTAGAGACAAAAAGGGAGCATGG - Intergenic
1003333871 6:5152569-5152591 CCGGAGACAGACACGCAGCTGGG - Intronic
1005414162 6:25583546-25583568 CTGGAGACATAGATGGATGAAGG + Intronic
1007770261 6:44186389-44186411 CTGGAGACGGAGAGGAAGCAGGG - Intergenic
1009338658 6:62526384-62526406 AGGCAGACAGACATGGACCAAGG - Intergenic
1009527250 6:64763382-64763404 CTGGAGAGAGAGACAGAGCAAGG + Intronic
1009764938 6:68060166-68060188 CTGGAGACAAACTTGGAGCGAGG + Intergenic
1009825967 6:68866317-68866339 CAGGAGAAAGAAAGGGAGCAAGG - Intronic
1011551141 6:88532032-88532054 TAGGAGAGAAACATGGAGCAGGG + Intergenic
1012677281 6:102132553-102132575 CAGGACAGAGACATGGAGAAAGG + Intergenic
1013420480 6:109962334-109962356 CTGCAGAGAGCCATGGGGCAGGG + Intergenic
1013475808 6:110506311-110506333 CTGGAAACAGAGATGGAGGAAGG - Intergenic
1015318818 6:131848085-131848107 CTGGAGGAAGTCAGGGAGCATGG - Intronic
1015603524 6:134933392-134933414 CTGGACACCAAGATGGAGCAGGG - Intronic
1016894862 6:149041744-149041766 CTGGAGGCAGGCATGTAGCGGGG - Intronic
1018594117 6:165460090-165460112 CAGGAGACAGACATTGTACAGGG - Intronic
1019254537 7:40861-40883 CTGGAGACAGACACTGGGCAGGG + Intergenic
1019777324 7:2919579-2919601 CTGGTGAAGGACATGGAGGACGG - Exonic
1019885364 7:3899728-3899750 CTGGGGAGAGAGATGCAGCATGG - Intronic
1021249526 7:18306883-18306905 TTGGAAACAGACATGGAGAATGG - Intronic
1022324566 7:29319478-29319500 CTGGAGCCAGGCATGGTGCATGG + Intronic
1022443463 7:30451930-30451952 CAGGAGAGAGACATGCAGCTGGG - Exonic
1023800143 7:43826846-43826868 CTGCAGACAGACATCCACCATGG - Intergenic
1025287636 7:57679285-57679307 CTGGAGACATAAATAGAGGAAGG + Intergenic
1026912072 7:74096815-74096837 TGGGAGAGAGACCTGGAGCATGG - Intronic
1026931533 7:74225454-74225476 CTGGAAACAGACAGGAGGCAGGG + Intronic
1026937059 7:74263590-74263612 ATGGAGACAGGCATGGAGGGAGG - Intergenic
1026953006 7:74360082-74360104 TGGGAGACAGGCAAGGAGCAGGG - Intronic
1028093141 7:86728147-86728169 GGGGAGACAGGCATGGAGCTGGG - Intronic
1029298591 7:99560662-99560684 CAGGACACCGACATGGAACAGGG + Exonic
1029451213 7:100642632-100642654 GTGGTGACAGACATGGGGCGGGG - Intronic
1030627063 7:111855782-111855804 CTGTAAACAGACAGAGAGCAGGG + Intronic
1031134733 7:117873051-117873073 CTGGACGCAGACAGGGAGCTGGG + Intronic
1031136244 7:117887424-117887446 CTGGAGACAGACGGGGGGAAAGG - Intergenic
1031808330 7:126334696-126334718 CTTGAGACTGACATGGATGAGGG - Intergenic
1033471823 7:141656936-141656958 CTGGAAACAGAGAGAGAGCACGG + Exonic
1033609851 7:142954544-142954566 CTGGAGAGAAGCAGGGAGCATGG + Intronic
1034066804 7:148144794-148144816 CTGGAGACACACATTAAGCGAGG + Intronic
1034313404 7:150109969-150109991 CTGGGGACAGTCATGGAGGGAGG + Intergenic
1034677187 7:152900413-152900435 CTGGACACAGACACCCAGCAGGG - Intergenic
1034793457 7:153990695-153990717 CTGGGGACAGTCATGGAGGGAGG - Intronic
1035496412 7:159331171-159331193 CTAGATGCAGACATGGAGGACGG - Intergenic
1035670317 8:1412074-1412096 CTGGAGGCAGGAATGGAGAAAGG - Intergenic
1036224025 8:6943260-6943282 GAGGAGTCAGACATGGGGCATGG + Intergenic
1036563095 8:9914070-9914092 CTGGAGAACGGCATGGAGCATGG - Intergenic
1036610676 8:10347196-10347218 CTGGAGCCAGACACGGTGCAAGG - Intronic
1036976039 8:13413713-13413735 CAGGAGACAGCAATAGAGCAGGG - Intronic
1037329570 8:17730878-17730900 CTGGAGATGGATATGGAGGATGG + Intronic
1037383999 8:18318136-18318158 CTGAAGACAGACATCAGGCAGGG + Intergenic
1037922098 8:22814679-22814701 CTGCAGACAGAGAGGGACCATGG - Intronic
1040580821 8:48697367-48697389 CTGAAGAGAGACAGGGATCAGGG - Intergenic
1041022299 8:53650086-53650108 TTGGAGACAGACCAGGAGCAGGG + Intergenic
1041185372 8:55294652-55294674 CTGGAGACAGTGAGGGAGTAAGG - Intronic
1042717792 8:71793763-71793785 GTGGAGACAGACTTGGAGTTTGG - Intergenic
1044316707 8:90757536-90757558 TTGGAGCCAGACATGGAACCGGG + Intronic
1045537728 8:103048044-103048066 CTAGAGGCAGACATGGAATAAGG + Intronic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1047909388 8:129510743-129510765 CTGGAGACAGACATGCACAGAGG - Intergenic
1048209386 8:132442400-132442422 GGGGAGACAGACATTGATCAAGG - Intronic
1048416159 8:134229888-134229910 GTGGAGGGAGATATGGAGCAAGG - Intergenic
1048427550 8:134336820-134336842 CTGGGGAGACACAAGGAGCAAGG - Intergenic
1048686600 8:136911498-136911520 CAGGAGACAGACATTGTACAGGG + Intergenic
1048707769 8:137173295-137173317 CTGGAGACACATATGGAAAAGGG - Intergenic
1048936517 8:139362149-139362171 CTGGAGACAGCCATGGGGAAGGG + Intergenic
1049254843 8:141608324-141608346 ATGGGGACAGATATGGAGCCTGG - Intergenic
1049283494 8:141762353-141762375 CTGGGGACAGACAGGGGACAGGG + Intergenic
1050302400 9:4273168-4273190 ATGAAGACAGAAATGCAGCAAGG + Intronic
1051497753 9:17744047-17744069 TTGGAGACAGCCATGTAGAATGG + Intronic
1051516834 9:17939143-17939165 CTGGAGACTGAAAGGAAGCAAGG - Intergenic
1052141090 9:24984917-24984939 CAAGAGAGAGACATGGAGAAGGG + Intergenic
1052464516 9:28813599-28813621 CAGGAGACACACATTGAACAAGG + Intergenic
1056112293 9:83407981-83408003 CTGGAGACTGCCATGGTGTAAGG - Intronic
1057076142 9:92139113-92139135 AAGGAGACAGAGAAGGAGCAGGG - Intergenic
1059098811 9:111449719-111449741 CTGGAGAAAGACTTGGAGTAGGG - Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1060282585 9:122224347-122224369 CTGGAGTCAGGCCTAGAGCAGGG + Intronic
1060672831 9:125485397-125485419 CTGGAGACAGATAAGAAGCCTGG + Intronic
1061483233 9:130907344-130907366 CTGGAGAAAGCCAAAGAGCAAGG - Intronic
1061801421 9:133115252-133115274 CTGGAGCCATCCATGGGGCAGGG - Intronic
1062204663 9:135329386-135329408 GAGGAGAGAGGCATGGAGCAGGG + Intergenic
1062745749 9:138210962-138210984 CTGCGGCCAGACAGGGAGCAGGG - Intergenic
1062745862 9:138211692-138211714 CTGGAGACAGACACTGGGCAGGG - Intergenic
1185499479 X:585722-585744 CCGGAGACAGGGATGGAGGAGGG - Intergenic
1185836158 X:3347021-3347043 CAGGAGAGAGAGAAGGAGCAGGG + Intergenic
1186174144 X:6907430-6907452 GTGGGGACAGACATGGAGAGCGG - Intergenic
1188776987 X:34231761-34231783 GTGGAGACAAACATGGATTAAGG - Intergenic
1188821786 X:34784979-34785001 CTGGAGACAGAGATAGGGAAAGG + Intergenic
1190263425 X:48813958-48813980 CTGGAGGCCCAAATGGAGCATGG - Intronic
1192495732 X:71615791-71615813 CTGCAGACAGACATTGATGAAGG + Intergenic
1193062240 X:77219582-77219604 ATGGAGTCAGAAATGGAGAATGG + Intergenic
1193533709 X:82686994-82687016 CTTGGGAGACACATGGAGCAAGG - Intergenic
1193599227 X:83488727-83488749 CTGGAGTGAAACAGGGAGCAAGG + Intergenic
1194067316 X:89277290-89277312 CTGGGAACAGACGTGGAGAAGGG + Intergenic
1194217387 X:91147892-91147914 ATGAACACAGACATGGAGGATGG - Intergenic
1195681242 X:107548098-107548120 CTAGAGACTGTCATGGATCATGG - Intronic
1195993278 X:110704664-110704686 CTGGGGACAGTGATTGAGCAGGG + Intronic
1196385998 X:115151882-115151904 CAGGAGACAGAGCTGGAGCCAGG + Intronic
1197075317 X:122345739-122345761 CAGGAGAGAGACAGAGAGCAAGG + Intergenic
1197368533 X:125597835-125597857 CAGGAGACAAGCATGGAACATGG + Intergenic
1197602244 X:128543865-128543887 CTTGAGAGCCACATGGAGCAGGG - Intergenic
1197759565 X:130018079-130018101 CTGGAGCCAGACACGGAGCCTGG + Intronic
1197761654 X:130032354-130032376 CTGGAGAGATCCATGGGGCAGGG - Intronic
1198319813 X:135509592-135509614 CTGGAGAAAGGCATGTACCAAGG + Intergenic
1199474128 X:148227473-148227495 CTGGAAACAGATTTGAAGCAAGG - Intergenic
1200553901 Y:4611684-4611706 ATGAACACAGACATGGAGGATGG - Intergenic
1200721475 Y:6611504-6611526 CTGGGAACAGACGTGGAGAAGGG + Intergenic
1200884134 Y:8252241-8252263 CTGGACACAGACATGGGGAGTGG - Intergenic