ID: 903875141

View in Genome Browser
Species Human (GRCh38)
Location 1:26468918-26468940
Sequence GGAGCGGAAGAGGCAGCAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 829
Summary {0: 1, 1: 0, 2: 8, 3: 89, 4: 731}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903875132_903875141 19 Left 903875132 1:26468876-26468898 CCCCACTTTTCTCTAGCAGAAGG 0: 1
1: 1
2: 3
3: 36
4: 221
Right 903875141 1:26468918-26468940 GGAGCGGAAGAGGCAGCAGCTGG 0: 1
1: 0
2: 8
3: 89
4: 731
903875129_903875141 26 Left 903875129 1:26468869-26468891 CCCCAATCCCCACTTTTCTCTAG 0: 1
1: 1
2: 0
3: 37
4: 334
Right 903875141 1:26468918-26468940 GGAGCGGAAGAGGCAGCAGCTGG 0: 1
1: 0
2: 8
3: 89
4: 731
903875135_903875141 17 Left 903875135 1:26468878-26468900 CCACTTTTCTCTAGCAGAAGGCC 0: 1
1: 0
2: 2
3: 30
4: 202
Right 903875141 1:26468918-26468940 GGAGCGGAAGAGGCAGCAGCTGG 0: 1
1: 0
2: 8
3: 89
4: 731
903875128_903875141 29 Left 903875128 1:26468866-26468888 CCACCCCAATCCCCACTTTTCTC 0: 1
1: 0
2: 2
3: 90
4: 774
Right 903875141 1:26468918-26468940 GGAGCGGAAGAGGCAGCAGCTGG 0: 1
1: 0
2: 8
3: 89
4: 731
903875138_903875141 -5 Left 903875138 1:26468900-26468922 CCGAGACATGTATGCAGAGGAGC 0: 1
1: 0
2: 1
3: 7
4: 152
Right 903875141 1:26468918-26468940 GGAGCGGAAGAGGCAGCAGCTGG 0: 1
1: 0
2: 8
3: 89
4: 731
903875127_903875141 30 Left 903875127 1:26468865-26468887 CCCACCCCAATCCCCACTTTTCT 0: 1
1: 0
2: 3
3: 168
4: 685
Right 903875141 1:26468918-26468940 GGAGCGGAAGAGGCAGCAGCTGG 0: 1
1: 0
2: 8
3: 89
4: 731
903875131_903875141 24 Left 903875131 1:26468871-26468893 CCAATCCCCACTTTTCTCTAGCA 0: 1
1: 0
2: 1
3: 26
4: 260
Right 903875141 1:26468918-26468940 GGAGCGGAAGAGGCAGCAGCTGG 0: 1
1: 0
2: 8
3: 89
4: 731
903875130_903875141 25 Left 903875130 1:26468870-26468892 CCCAATCCCCACTTTTCTCTAGC 0: 1
1: 0
2: 2
3: 24
4: 228
Right 903875141 1:26468918-26468940 GGAGCGGAAGAGGCAGCAGCTGG 0: 1
1: 0
2: 8
3: 89
4: 731
903875134_903875141 18 Left 903875134 1:26468877-26468899 CCCACTTTTCTCTAGCAGAAGGC 0: 1
1: 0
2: 0
3: 24
4: 152
Right 903875141 1:26468918-26468940 GGAGCGGAAGAGGCAGCAGCTGG 0: 1
1: 0
2: 8
3: 89
4: 731
903875137_903875141 -4 Left 903875137 1:26468899-26468921 CCCGAGACATGTATGCAGAGGAG 0: 1
1: 0
2: 0
3: 24
4: 154
Right 903875141 1:26468918-26468940 GGAGCGGAAGAGGCAGCAGCTGG 0: 1
1: 0
2: 8
3: 89
4: 731

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903875141 Original CRISPR GGAGCGGAAGAGGCAGCAGC TGG Exonic
900150199 1:1175270-1175292 GCTGCAGAAGAAGCAGCAGCTGG - Intronic
900247650 1:1645189-1645211 GGAGCAGCAGAAGGAGCAGCGGG - Exonic
900258877 1:1712327-1712349 GGAGCAGCAGAAGGAGCAGCGGG - Exonic
900413943 1:2526549-2526571 CGAGCGGCAGCGGGAGCAGCGGG - Exonic
900507615 1:3037493-3037515 GGAGGGGCAGAGGCAGCATTTGG + Intergenic
900827334 1:4937237-4937259 GGGGCAGAAGAGGCGGGAGCTGG + Intergenic
900970131 1:5987465-5987487 GGTGGGGCAGAGGCAGCAGCAGG + Intronic
900983553 1:6060116-6060138 GGAGCCTGTGAGGCAGCAGCAGG - Intronic
902123101 1:14184508-14184530 AGAGCGGAAGCAGCAGCAGGAGG + Intergenic
902239332 1:15077833-15077855 GGAGCAGGAGAGGTAGCAGGGGG + Intronic
902607329 1:17575998-17576020 GAAGCGGGGGAAGCAGCAGCTGG - Intronic
902654815 1:17859927-17859949 GGAGTGGCAGAGGGAGGAGCAGG + Intergenic
902692516 1:18118677-18118699 GGAAGGGAAGAGGCATCAGAAGG + Intronic
902811879 1:18892592-18892614 GGAGAGGGAGAGGCAGGGGCAGG + Intronic
902920729 1:19664956-19664978 CGAGAGGAAGAGGCGGCCGCGGG - Intergenic
902954639 1:19917158-19917180 GCAGCCGCAGAAGCAGCAGCAGG - Intergenic
903006121 1:20300006-20300028 GGAGAGGAGCAGGCAGCAGGGGG + Intronic
903359646 1:22768851-22768873 GGAGGGAAAGAGGAAGCACCAGG - Intronic
903875141 1:26468918-26468940 GGAGCGGAAGAGGCAGCAGCTGG + Exonic
904045871 1:27607884-27607906 GGAGGCGAAGAGGCAGGAGACGG - Intergenic
904316689 1:29670490-29670512 GGAGGGAAAGAGGGAGCTGCAGG + Intergenic
904476592 1:30769070-30769092 GGAGAGGTAGGGGAAGCAGCTGG + Intergenic
904789594 1:33009087-33009109 GGAGCAGAAGAGGGAGGGGCTGG + Intronic
905016403 1:34781637-34781659 GGCGCGGAGGAGGGAGCAGGAGG - Exonic
905375017 1:37514411-37514433 GGAGGGGAAGCGGCAGCCGCAGG - Intronic
905742364 1:40383316-40383338 GGAGGATAAGAGGCAGGAGCAGG - Intronic
905886823 1:41496225-41496247 GGAGAGGGAGAGGCAGCTGCAGG - Intergenic
906418303 1:45640316-45640338 GCAGCAGAGAAGGCAGCAGCAGG + Exonic
906534905 1:46545953-46545975 GGCAGGGAATAGGCAGCAGCTGG + Intronic
906612286 1:47211970-47211992 CTAGGGGAAGAGGCAGCTGCAGG + Intergenic
908022779 1:59915558-59915580 AGACAGGAAGAAGCAGCAGCAGG + Intronic
908820171 1:68077954-68077976 GGAGTAGAAGCAGCAGCAGCAGG - Intergenic
909938894 1:81588076-81588098 GGAGCAGAATAGGCAGAAGCAGG + Intronic
910891063 1:92020788-92020810 GGAGCAGAGCAGTCAGCAGCTGG + Intergenic
911154511 1:94625117-94625139 GGTGGGTAAGAGGCAGCTGCAGG + Intergenic
911184127 1:94886504-94886526 GCAGGGTAGGAGGCAGCAGCAGG - Intronic
911630210 1:100174993-100175015 GGAGCAAAAGAGGGAGCAGGGGG - Intronic
912174476 1:107140109-107140131 GGAGCGGCAGCAGCTGCAGCCGG + Intronic
912844201 1:113064393-113064415 GGAGAGGCAGAGGCAGAAGCAGG + Intergenic
913287579 1:117240971-117240993 GGAGTGGAAGACTCACCAGCAGG - Intergenic
914244048 1:145872839-145872861 GGAGCGGCAGAGGTTGCAGAGGG - Exonic
914244208 1:145873598-145873620 AGAGCTAAAGAAGCAGCAGCAGG - Exonic
914293637 1:146298136-146298158 GGAGCAGCAGCAGCAGCAGCAGG + Intergenic
914554681 1:148748919-148748941 GGAGCAGCAGCAGCAGCAGCAGG + Intergenic
914747554 1:150511143-150511165 GCTGCGGCAGTGGCAGCAGCGGG - Exonic
914950474 1:152109616-152109638 GGAGCGGGAGAGGCAGTATCGGG - Exonic
914950546 1:152110063-152110085 GGAGCGGGAGAGGCAATATCGGG - Exonic
914950663 1:152110819-152110841 GCAGCGGGAGAGGCAGCTGAGGG - Exonic
915142438 1:153775903-153775925 GGAGCCGGAGATGCAGCGGCCGG + Exonic
915195065 1:154183147-154183169 CGAGCGGAGGAGGCAGGAACCGG - Intronic
915556744 1:156665024-156665046 GGAGCGGCAGCAGCAGCAACGGG + Intergenic
915579211 1:156803426-156803448 GGAGCTGAAGGGGCAGGGGCTGG + Intergenic
915596887 1:156901171-156901193 AGTGCGGAGGAGGCATCAGCTGG - Intronic
916332133 1:163628513-163628535 GGAGAGGAAGAGGAAGGAGAAGG - Intergenic
916752966 1:167740344-167740366 GGAGTGGCAGAGGCAGCTGTGGG - Intronic
917321546 1:173787917-173787939 GGAGAGAAAGAAGCAGCAGGAGG + Intergenic
918149435 1:181785388-181785410 GAAGAAGCAGAGGCAGCAGCTGG + Exonic
918588425 1:186214253-186214275 GGCCCGGGAGAAGCAGCAGCTGG + Intergenic
919880496 1:201897754-201897776 GGAGTGGGACAGACAGCAGCTGG - Exonic
920383212 1:205548098-205548120 GGAGGGGAGGAGACAGGAGCAGG - Intergenic
920438752 1:205964789-205964811 GGAGCTGAGTAAGCAGCAGCAGG - Intergenic
920448081 1:206035268-206035290 GGAGCGGCAGCGGCAGCGGGAGG - Intergenic
920740404 1:208576587-208576609 AGAGAGGAGGAGGCGGCAGCAGG - Intergenic
921466772 1:215497676-215497698 GCAGCAGCAGAGGCAGCAGCAGG + Intergenic
922102237 1:222486814-222486836 GGAGAGGCAGAGGCAGGGGCAGG - Intergenic
922102240 1:222486820-222486842 GGAGAGGGAGAGGCAGAGGCAGG - Intergenic
922195214 1:223353735-223353757 ACAGAGGAAGGGGCAGCAGCAGG + Intronic
922314883 1:224434158-224434180 GCGGCGGGAGGGGCAGCAGCCGG + Exonic
922335592 1:224616341-224616363 GCGGCGGCAGCGGCAGCAGCAGG + Exonic
922513182 1:226186558-226186580 GCAGCGGTGGCGGCAGCAGCGGG + Exonic
922722707 1:227906718-227906740 GGAGAGGGAGAGGCAGGAACAGG - Intergenic
922758526 1:228109753-228109775 GGAGCTGAAGGGGCATCAGCTGG + Intergenic
923475299 1:234326076-234326098 GAAGAGGAAGAGGAAGGAGCAGG + Intergenic
924178688 1:241419158-241419180 GGAGGGGAAGAGGCAGGACTGGG + Intergenic
924462162 1:244269328-244269350 GTAGAGGAAGAGAGAGCAGCCGG - Intergenic
924465056 1:244291971-244291993 AGAGAGGCAGAGGCACCAGCGGG - Intergenic
1062826365 10:571700-571722 GGAGCCCACGGGGCAGCAGCTGG - Intronic
1063121610 10:3108848-3108870 GGAGAGGCACAGGCACCAGCCGG + Intronic
1063233246 10:4086732-4086754 GGAGCGGGGGAGGCAGAAGAGGG - Intergenic
1063985041 10:11493426-11493448 GTAGGGGAAGAGGGAGAAGCAGG - Intronic
1064015113 10:11765593-11765615 GAAGGGGAAGAGACAGCAGGTGG - Intergenic
1064709451 10:18108979-18109001 GGAAAGGAAGAGGGAGAAGCTGG - Intergenic
1065571837 10:27079356-27079378 GGAGAGGTAGAGGCAGCAATTGG - Intronic
1066429151 10:35336259-35336281 GGAGTGGAGGAGGCAGAGGCCGG + Intronic
1067684123 10:48457035-48457057 GGGGCAGAAAGGGCAGCAGCTGG + Intronic
1067766285 10:49090014-49090036 GGAGTGGAAGAGGCCCCAGCAGG + Intronic
1067903368 10:50265010-50265032 GGAACGTAAGAAGCAGCAACTGG + Intergenic
1068316550 10:55351058-55351080 GAGGAGGAGGAGGCAGCAGCGGG - Intronic
1068763089 10:60733668-60733690 GGAGCAGCAGAGGCAGCTCCAGG + Intergenic
1068987249 10:63118702-63118724 GGAGTAGCAGGGGCAGCAGCAGG - Intergenic
1069729325 10:70600845-70600867 GGACGGGCAGGGGCAGCAGCAGG + Exonic
1070312575 10:75284349-75284371 GGCCCAGAAGAGGGAGCAGCAGG + Intergenic
1070732911 10:78843841-78843863 GAAGTGGAAGAGGCAGCACCTGG - Intergenic
1070782688 10:79146742-79146764 GGGGCGGAAGCGGGAGCAGAGGG - Intronic
1071080523 10:81804625-81804647 GGAGCAGCTGAAGCAGCAGCAGG - Intergenic
1071572677 10:86706604-86706626 GCACTGGGAGAGGCAGCAGCAGG - Intronic
1072593024 10:96844736-96844758 GGAGAGGGAAAGGCAGCAGAGGG + Intronic
1072753255 10:97999456-97999478 GAGGGGGAAGAGGCAGCAGGCGG - Intronic
1073091136 10:100940780-100940802 GGAGGGGCAGGGGCAGGAGCAGG - Intronic
1073096132 10:100980871-100980893 GGATCGGTAGCGGGAGCAGCTGG - Exonic
1073191814 10:101656693-101656715 GGAGCGGAGGAAGAGGCAGCAGG + Intronic
1073336562 10:102714475-102714497 GGAGCTGCAGAGGCCGCCGCCGG + Intergenic
1073476351 10:103756457-103756479 GGCTCGGGAGTGGCAGCAGCGGG - Intronic
1073490180 10:103848196-103848218 GGAGGAGGAGAGGGAGCAGCAGG - Intronic
1073622427 10:105062974-105062996 GGAACGAAAGAAACAGCAGCCGG + Intronic
1073902971 10:108244950-108244972 GGAGGGGATGGGGTAGCAGCAGG - Intergenic
1074290802 10:112136926-112136948 GGAGAGGAAGAGGAAGGAGAGGG - Intergenic
1074783311 10:116817981-116818003 GGAGAGGAAGAGGAAGCTGGAGG - Intergenic
1075105710 10:119538767-119538789 GGAGCGGAGGGGGCCCCAGCAGG - Intronic
1075239513 10:120765154-120765176 GGAGATGAAGAGGCAGCCACAGG + Intergenic
1075762916 10:124870309-124870331 GGAGAGGAAGCGGGAGGAGCAGG + Intergenic
1075768898 10:124917082-124917104 AGGGCGGAGGCGGCAGCAGCGGG + Intergenic
1076614528 10:131746953-131746975 GGAGCAGAAGAAGGAGCAGAAGG - Intergenic
1076624912 10:131815865-131815887 GGAGGGGTCCAGGCAGCAGCAGG + Intergenic
1076830561 10:132992321-132992343 GAGGCAGAGGAGGCAGCAGCGGG + Intergenic
1076886404 10:133264793-133264815 GGTGGGGCAGAGGCTGCAGCAGG - Intronic
1077012323 11:384827-384849 GGAGCAGCAGTGGCGGCAGCAGG + Intergenic
1077036519 11:498093-498115 TGAGCTGAAGTGGGAGCAGCAGG + Exonic
1077186113 11:1236136-1236158 GGAGCAGCAGAGGCTGCAGTAGG - Intronic
1077251025 11:1560789-1560811 GGAGGAGGAGAGGCAGCAGGTGG - Intronic
1077510830 11:2961429-2961451 GGAAAGGAAGAGGCAGCTACAGG + Intronic
1077757051 11:5042810-5042832 TGAGTAGATGAGGCAGCAGCAGG + Intergenic
1078019120 11:7640754-7640776 GGAAAGGAAGGGACAGCAGCAGG - Intronic
1078059102 11:8032005-8032027 GGGGCTGGAGGGGCAGCAGCTGG + Intronic
1079367568 11:19822688-19822710 GGAGGGGAAGAGCCATCTGCTGG - Intronic
1080804337 11:35638495-35638517 GGAGAGGGAGAGGCAGGAACTGG + Intergenic
1081991383 11:47339463-47339485 GGGGTGGAAGAAGCAGCAGAGGG - Intronic
1082140650 11:48604339-48604361 GGAGAAGAAGTGGCAGCAGGAGG - Intergenic
1082799887 11:57406702-57406724 GGAGAGGAAGAGGAAGCAGAGGG + Intronic
1082838448 11:57668457-57668479 GGGGCGGAAGGGGCGGCGGCTGG - Intronic
1083464044 11:62833536-62833558 GGAGAGGAAAAGGAGGCAGCTGG - Intronic
1083487704 11:62993799-62993821 GTAGAGGAAGAGGCAGCTGAAGG + Exonic
1084223632 11:67700515-67700537 GGAGCAGAAGGGGCAGAAGCTGG - Intergenic
1084576200 11:69989491-69989513 GGAGGGAAAGAGGGAGCAGGAGG + Intergenic
1084860439 11:72014514-72014536 GGAGAGCCAGGGGCAGCAGCAGG - Exonic
1084933574 11:72575297-72575319 GGAGCTGCAGAGGAAGCAGATGG + Intergenic
1086079593 11:82889540-82889562 GCAGCAGAAGACGCAGCAGCAGG + Intronic
1086365856 11:86109768-86109790 GGAGAGGCAGAGGCAGGGGCAGG - Intergenic
1086365859 11:86109774-86109796 GGAGAGGGAGAGGCAGAGGCAGG - Intergenic
1087407765 11:97751677-97751699 GCAGCGGAACAGGCAGCTTCAGG + Intergenic
1087594739 11:100238477-100238499 GAAGCAGAAGCAGCAGCAGCAGG + Intronic
1088677253 11:112206304-112206326 GGGGCGGCAGGGGCGGCAGCTGG + Intronic
1089653905 11:119933273-119933295 GCAGCGGCAGTGGCAGAAGCTGG - Intergenic
1089656171 11:119948522-119948544 GGAGGGTGACAGGCAGCAGCCGG + Intergenic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1090257075 11:125292374-125292396 GGAGTGGCAGTGGCAGCAGCAGG + Intronic
1090414081 11:126528807-126528829 GGAGAGGAAGAGGAGGAAGCAGG + Intronic
1090431905 11:126653316-126653338 GTGGCAGAAGAGGCACCAGCTGG + Intronic
1090616772 11:128522281-128522303 AGAGCGAACGAGGCAGCCGCCGG - Intronic
1090699293 11:129279569-129279591 GGAGCGGAGGAGGCGGAGGCTGG - Intergenic
1090717826 11:129445767-129445789 GGAGCGGTCAGGGCAGCAGCAGG + Intronic
1091488940 12:916380-916402 GGAGCGGATGGAGAAGCAGCAGG - Exonic
1091771708 12:3156360-3156382 GGAGAGGGAGGGGCAGCAGGTGG + Intronic
1091915385 12:4269373-4269395 GGAGAGCAAGAGGAAGCGGCGGG - Intergenic
1091933694 12:4417671-4417693 GGAGCGGGAGGAGGAGCAGCAGG - Intergenic
1092108915 12:5945330-5945352 GGGGAGGAGGAGGCGGCAGCCGG - Intronic
1092130936 12:6112752-6112774 GGAGAGGAAGAGTCCCCAGCAGG + Intronic
1092257698 12:6936345-6936367 GGAGCAGAAGAGGAAGCAGGAGG - Exonic
1092286261 12:7130657-7130679 CCAGCAGAAGGGGCAGCAGCAGG - Exonic
1092527030 12:9315616-9315638 GGAGCGGGAGGGGCAGGGGCAGG - Intergenic
1093068744 12:14686492-14686514 GGATGGGAAGAGGCAGAAGAGGG + Intronic
1093289976 12:17308231-17308253 TGAGAGTAAGAGCCAGCAGCAGG + Intergenic
1093518884 12:20024466-20024488 GGAGTGGCAGCAGCAGCAGCAGG + Intergenic
1093715648 12:22378289-22378311 AGAGTGGGAGAGGCAGAAGCAGG + Intronic
1094129908 12:27063607-27063629 GAAGCAGCAGAAGCAGCAGCAGG - Intronic
1095273128 12:40244901-40244923 GGAGATGAAGAGGTAGCTGCAGG + Intronic
1096406947 12:51350848-51350870 GGAGTGGGAGATGCAGCAGGAGG - Intergenic
1096464540 12:51841065-51841087 GGAGGGGCTGAGGCAGCTGCTGG - Intergenic
1096679031 12:53242524-53242546 GGAGTGGGAGAGGGATCAGCTGG + Intergenic
1096710465 12:53452105-53452127 AGACCAGCAGAGGCAGCAGCCGG + Intronic
1096717188 12:53498748-53498770 GGAGGGGAGGATGCAACAGCTGG + Intronic
1098461430 12:70736972-70736994 GGAGAGGATGGGGCACCAGCTGG - Intronic
1099389298 12:82059401-82059423 GGAGAGGAAGAGGCTGGAGGAGG + Intergenic
1100131313 12:91497246-91497268 GGAGCTGAAGAGGCAAAAACTGG + Intergenic
1100309186 12:93378289-93378311 GGAGCAGCAGCAGCAGCAGCAGG + Exonic
1100869575 12:98895465-98895487 GGAGGGCAAGGGGCAGAAGCAGG + Intronic
1101716199 12:107315042-107315064 GGTGGAGAAGAGGCAGCATCAGG + Intergenic
1102206442 12:111094260-111094282 GGAGGGGAACAGGCTGCGGCTGG + Intronic
1102217743 12:111173596-111173618 AGAGGTGAGGAGGCAGCAGCAGG + Intronic
1102565725 12:113796348-113796370 GGAGCGGGGCAGACAGCAGCAGG - Intergenic
1102645825 12:114403261-114403283 GGCGCGGAGGAGGCAGGAGGAGG + Intronic
1102908446 12:116694869-116694891 GGAGAGGAAGAGGGAGGAGGAGG + Intergenic
1102962641 12:117102556-117102578 GTCCCGGAACAGGCAGCAGCTGG - Intergenic
1103061748 12:117863878-117863900 GGAGGGTAAGGGGCAGTAGCAGG - Intronic
1103360049 12:120348056-120348078 GGAGCAGGACAGGCAGCAGAAGG - Intronic
1104000146 12:124855044-124855066 GGAGATGAGGAGGCATCAGCAGG + Intronic
1104415739 12:128595593-128595615 GGATTGTAAGAGGCAGCAGGAGG + Intronic
1104460933 12:128955264-128955286 GGAGAGGGAGAGGAAGCAGGAGG - Intronic
1104586018 12:130048510-130048532 AGAGCAGAAGAGGGAACAGCTGG - Intergenic
1104624055 12:130338311-130338333 GGTGCGGGAGATGCAGGAGCCGG + Intronic
1104624097 12:130338437-130338459 GGTGCGGGAGATGCAGGAGCCGG + Intronic
1104624124 12:130338521-130338543 GGTGCGGGAGATGCAGAAGCCGG + Intronic
1104800836 12:131554442-131554464 GGAGGGGCAGTGGCAGCACCGGG + Intergenic
1104897881 12:132173167-132173189 GGAGAGGTCCAGGCAGCAGCAGG + Intergenic
1104908686 12:132229165-132229187 GGAGGAGCAGAGGCAGCTGCAGG - Intronic
1105009346 12:132745074-132745096 GGAGCCGAGCAGGCAGCAGCAGG - Intronic
1106200702 13:27534591-27534613 GGAGCGGCTGAGTCAGCAGCAGG + Intergenic
1106541098 13:30690825-30690847 GGAGAGGAATAGGCAGCATTTGG + Intergenic
1107016917 13:35714824-35714846 GGAGAGGAAGCAGCTGCAGCTGG + Intergenic
1107480692 13:40783575-40783597 CGAGCGGAAGAGGGAGCAGAAGG - Intergenic
1107779107 13:43879518-43879540 GGAACTGCTGAGGCAGCAGCGGG + Exonic
1107793773 13:44029396-44029418 GAAGAGGAAGAGGCACCAGAGGG + Intergenic
1108736289 13:53286471-53286493 GGAGGGAGAGAGGCAGAAGCTGG + Intergenic
1110177612 13:72575913-72575935 AGAGTGTAAGAGGCAGCAGTGGG + Intergenic
1111163130 13:84421256-84421278 GGAGCTGGAGTGGCAGCAACTGG - Intergenic
1112499311 13:99930228-99930250 GGATCGGAAGAGGAAGCTGAAGG - Intergenic
1112504910 13:99969790-99969812 GGAGCAGACGCAGCAGCAGCTGG - Intronic
1112564940 13:100545016-100545038 GCAGCGGAGGCGGCAGCAGGAGG + Intronic
1113471710 13:110551539-110551561 GGTGCAGAAGAGACAGCACCAGG + Intronic
1113674124 13:112196373-112196395 GGTGCTGAGGAGGCAGGAGCAGG - Intergenic
1113975522 13:114225322-114225344 GGAGGGGAAGAGACAGAAGGAGG + Intergenic
1114174592 14:20309274-20309296 GGAGAGGCAGAGGCAGAGGCAGG - Intergenic
1114627219 14:24137410-24137432 GGAGCGGAAGAAACAGCAGGAGG + Exonic
1115102250 14:29716462-29716484 GGAGGGGAAGAAGGAACAGCAGG + Intronic
1116594343 14:46820428-46820450 GTAGCGGGAGAGGCACCGGCGGG + Intergenic
1117072500 14:52069282-52069304 GGAGTGGAAGGGGCAGCTCCAGG - Intergenic
1117298015 14:54396725-54396747 GGGGCGGAAGAGTCAGAAGGCGG - Intergenic
1117870475 14:60195311-60195333 TGAGATGAAGAGGCAGAAGCAGG - Intergenic
1118308448 14:64675397-64675419 GGAGCGGGAGAGGCAGGAAGGGG - Intergenic
1118766762 14:68915247-68915269 GGAGGGGAAGAAGGAGCAGGGGG - Intronic
1118822205 14:69352881-69352903 GGACCGGAAGAGGCAGCGTCGGG - Intronic
1119035934 14:71230869-71230891 GGAACGGCAGTGGCAGCAGTGGG + Intergenic
1119778056 14:77260401-77260423 GGACCATGAGAGGCAGCAGCAGG - Intergenic
1121111085 14:91313616-91313638 GGAGAGGGAGAACCAGCAGCTGG - Exonic
1121275802 14:92666846-92666868 GGAGCTGAAAAGGCAGCCTCTGG - Intronic
1122413055 14:101535756-101535778 GGAGTAGAAAGGGCAGCAGCAGG - Intergenic
1122874146 14:104655573-104655595 GCCGAGGCAGAGGCAGCAGCCGG + Intergenic
1122886632 14:104713242-104713264 AGAGAGGAGGAAGCAGCAGCTGG + Exonic
1122984362 14:105205457-105205479 GCAAGGGCAGAGGCAGCAGCGGG - Intergenic
1123468728 15:20534702-20534724 GGAGGAAAAGAGGCAGGAGCAGG - Exonic
1123468749 15:20534807-20534829 GGAGGAGAAGAGGCAGGAGCAGG - Exonic
1123468799 15:20535086-20535108 GGAGGAGAAGAGGCAGGAGCAGG - Exonic
1123468822 15:20535227-20535249 GCAGGAGAAGAGGCAGGAGCAGG - Exonic
1123472108 15:20562914-20562936 GGAAGGGAAGAGTCAGCAGCAGG - Intergenic
1123645895 15:22437439-22437461 GGAAGGGAAGAGTCAGCAGCAGG + Intergenic
1123649226 15:22465421-22465443 GCAGGAGAAGAGGCAGGAGCAGG + Exonic
1123649249 15:22465562-22465584 GGAGGAGAAGAGGCAGGAGCAGG + Exonic
1123649314 15:22465922-22465944 GGAGGAGAAGAGGCAGGAGCAGG + Exonic
1123649335 15:22466027-22466049 GGAGGAAAAGAGGCAGGAGCAGG + Exonic
1123681614 15:22768206-22768228 GGAGCAGATGAGGAAGCAGGAGG - Intergenic
1123681672 15:22768458-22768480 GGAGCAGATGAGGAAGCAGGAGG - Intergenic
1123681769 15:22768941-22768963 GGAGCAGATGAGGGAGCAGGAGG - Intergenic
1123729074 15:23130069-23130091 GGAGGAGAAGAGGCAGGAGCAGG - Exonic
1123729097 15:23130210-23130232 GCAGGAGAAGAGGCAGGAGCAGG - Exonic
1123732412 15:23157905-23157927 GGAAGGGAAGAGTCAGCAGCAGG - Intergenic
1123747242 15:23327555-23327577 GGAGGAGAAGAGGCAGGAGCAGG - Intergenic
1123747265 15:23327696-23327718 GCAGGAGAAGAGGCAGGAGCAGG - Intergenic
1123750547 15:23355287-23355309 GGAAGGGAAGAGTCAGCAGCAGG - Intronic
1123761947 15:23440214-23440236 GGAGCAGAAGATGTGGCAGCAGG - Exonic
1123761992 15:23440505-23440527 GGAGGAGAAGATGCAGGAGCAGG - Exonic
1123762015 15:23440628-23440650 GGAGAAGAAGACGCAGGAGCAGG - Exonic
1123762088 15:23441046-23441068 GGAGGAGAAGATGCAGAAGCAGG - Exonic
1123762109 15:23441169-23441191 GGAGAAGAAGATGCAGGAGCAGG - Exonic
1123762171 15:23441538-23441560 GGAGGGGAAGATGCGGGAGCAGG - Exonic
1124247754 15:28085277-28085299 CAAGAGGCAGAGGCAGCAGCTGG - Intronic
1124279536 15:28351045-28351067 GGAGGAAAAGAGGCAGGAGCAGG - Intergenic
1124279557 15:28351150-28351172 GGAGGAGAAGAGGCAGGAGCAGG - Intergenic
1124279615 15:28351471-28351493 GGAGGAGAAGAGGCAGGAGCAGG - Intergenic
1124279638 15:28351612-28351634 GCAGGAGAAGAGGCAGGAGCAGG - Intergenic
1124282916 15:28379203-28379225 GGAAGGGAAGAGTCAGCAGCAGG - Intronic
1124299783 15:28532410-28532432 GGAAGGGAAGAGTCAGCAGCAGG + Intronic
1124303060 15:28559996-28560018 GCAGGAGAAGAGGCAGGAGCAGG + Intergenic
1124303083 15:28560137-28560159 GGAGGAGAAGAGGCAGGAGCAGG + Intergenic
1124303141 15:28560458-28560480 GGAGGAGAAGAGGCAGGAGCAGG + Intergenic
1124303162 15:28560563-28560585 GGAGGAAAAGAGGCAGGAGCAGG + Intergenic
1124333832 15:28842678-28842700 GGAGCAGATGAGGAAGCAGGAGG - Intergenic
1124333869 15:28842846-28842868 GGAGCAGATGAGGAAGCAGGAGG - Intergenic
1124333936 15:28843260-28843282 GGAGCAGCAGATGCAGGAGCAGG - Intergenic
1124513975 15:30350590-30350612 GGAGCAGGAGTGGCAGCAGTGGG - Intergenic
1124706813 15:31973435-31973457 GGAGCTGAAGAGACAGAAACCGG - Intergenic
1124728946 15:32180175-32180197 GGAGCAGGAGTGGCAGCAGTGGG + Intergenic
1125181802 15:36887410-36887432 GCCGCGGAAGAGGCAGGAGAGGG + Intergenic
1125526056 15:40375628-40375650 GGAGAGGAGCAGGCAGGAGCGGG - Intergenic
1125709634 15:41774507-41774529 GCAGCGGTAGAGGCAGCAGCAGG - Exonic
1125968169 15:43890901-43890923 GGAGCTGAAGAGGGCACAGCGGG + Intronic
1126450781 15:48806333-48806355 GCTGCGGCAGAAGCAGCAGCAGG + Intronic
1127072037 15:55296743-55296765 GGTAGGGAATAGGCAGCAGCAGG - Intronic
1127868737 15:63052680-63052702 GTACCGGCAGAGGCAACAGCAGG + Intronic
1128511032 15:68314021-68314043 GGAGAGGAAGGGCCAGAAGCAGG + Intronic
1128549121 15:68586428-68586450 GGAGCTGAGGAGGGAGCAACAGG + Intronic
1129453757 15:75665011-75665033 GGAGCAGGAGAGGCAGCAGAAGG - Intergenic
1129467424 15:75731798-75731820 GGAGAGGAAGAGGGAGCAGAAGG - Intergenic
1129607485 15:77031911-77031933 GGAGGCGAGGAGGCAGCAGGGGG - Intronic
1129716261 15:77852843-77852865 GGAGCAGGAGAGGCAGGAGCGGG + Intergenic
1129839465 15:78734821-78734843 GGAGCGGAGGGTGCAGGAGCAGG + Intergenic
1130087360 15:80788786-80788808 GGAGCGGAAGAGAGATGAGCAGG - Intronic
1130522244 15:84672246-84672268 GGAGAGGCAGAGGCAGGGGCAGG - Intronic
1131268296 15:90931797-90931819 GGAGAGAAAGAGGCTGCAGGTGG - Exonic
1131340743 15:91598387-91598409 GGAGCGGAAGAGGAAGAGGGAGG + Intergenic
1131852107 15:96554539-96554561 GGAGAGGAAGTAGAAGCAGCAGG - Intergenic
1132660230 16:1057927-1057949 GGGGCAGAAGGGACAGCAGCAGG - Intergenic
1132766341 16:1536227-1536249 GGAACGCAAGAGGTAGCAACAGG - Intronic
1132803994 16:1767321-1767343 GGAGGGGAAGAGGCTCCTGCTGG + Intronic
1132808337 16:1786104-1786126 GGCTCGGCAGAGGCAGCAGAGGG - Intronic
1133004316 16:2869825-2869847 GGAGAGGAACAACCAGCAGCAGG + Intergenic
1133481990 16:6179645-6179667 GGAGAAGGAGAGGCAGCAGCAGG - Intronic
1133747963 16:8701837-8701859 GGAGTGGAATGGGCAGGAGCAGG + Intronic
1134043234 16:11083768-11083790 GGAGCGCCACAGGCAGCAGGAGG - Intronic
1134678235 16:16105353-16105375 GGAGTGGCAGAGGGAGCAACTGG - Intronic
1134874838 16:17688788-17688810 GGAAGGGAAGAGGGAGCAGGTGG + Intergenic
1136120186 16:28127869-28127891 GGAGTGGAGGAGGCAGGACCAGG - Intronic
1136172523 16:28497421-28497443 GAAAAGGAAGAGGCAGCAGCAGG + Exonic
1136236897 16:28919878-28919900 GGAGCGACAGCAGCAGCAGCAGG - Exonic
1136411609 16:30080965-30080987 GATGCGGAAGAGGGAGCGGCAGG + Intronic
1137938128 16:52655254-52655276 CGAGCGGAGGAGGCAGGAACCGG + Intergenic
1138294060 16:55871868-55871890 TGAGCAGAAGAGGCAGCTACCGG + Intronic
1139336634 16:66236481-66236503 GGAGCAGCAGAGGAAGAAGCAGG + Intergenic
1139392271 16:66612475-66612497 GGAACGGTAGAGTCAGCTGCAGG + Intronic
1139514474 16:67445210-67445232 GGAGAGAAAGGCGCAGCAGCCGG + Intronic
1139545694 16:67648567-67648589 GGAGCGACAGAAGCAGGAGCGGG - Intronic
1139685033 16:68596879-68596901 GGTGTGGCAGAGGCAGCAGGTGG - Intergenic
1141589957 16:85061823-85061845 GGGGCGGAAGGGGTTGCAGCAGG + Intronic
1141704345 16:85656508-85656530 GGAGCGCCAGCGGGAGCAGCGGG + Exonic
1141774886 16:86116624-86116646 GGAGAGGCAGAGCCAGCAGCTGG + Intergenic
1141805226 16:86337413-86337435 GTGGCGGAAGTGGGAGCAGCAGG - Intergenic
1141808243 16:86356385-86356407 GGAGAGGAAGAGGGAGGAGGAGG + Intergenic
1142168301 16:88605426-88605448 TGAGGGCAAGAGGCAGCAGGGGG + Intronic
1142212644 16:88815820-88815842 GGGGCAGCAGAGGCAGCCGCAGG + Intronic
1142559861 17:803476-803498 GGACGGGAAGAGGAAGCAGCAGG + Intronic
1143361126 17:6372185-6372207 GGAGGAGAAGAAGCAGCAGGAGG + Intergenic
1143381290 17:6497955-6497977 GGAGCGGGTGAGGCAGCCGCAGG + Intronic
1143548596 17:7614838-7614860 GGAGCGGCAGCGGCAGCAGCGGG - Exonic
1143617914 17:8064472-8064494 TGAGTGGAAGAGGGAGAAGCTGG + Intergenic
1143757401 17:9076974-9076996 GGAGAGGGCCAGGCAGCAGCTGG - Intronic
1143866142 17:9925542-9925564 GGAGATGAAGACCCAGCAGCTGG - Exonic
1144464106 17:15482721-15482743 GGAGGGGCAGAGGCTGGAGCTGG - Intronic
1144676558 17:17165932-17165954 GGAGCAGGAGAGGCAGGAGAGGG + Intronic
1144872759 17:18380979-18381001 GACGCAGAAGAGGCTGCAGCAGG + Exonic
1145029721 17:19495401-19495423 GGAGCAGCAGGAGCAGCAGCAGG - Intronic
1145029723 17:19495422-19495444 GGAGCAGCAGGAGCAGCAGCAGG - Intronic
1145243443 17:21252840-21252862 GGAAAGGCAGAGGCAGGAGCTGG - Intronic
1145267366 17:21386314-21386336 GGAGAGGGAGAGGCAGCACAGGG - Intronic
1145864148 17:28229216-28229238 GAAGCTGAAGAGGCAGCTGTAGG + Intergenic
1145993924 17:29094986-29095008 GCAGCGGGAGAAGCTGCAGCGGG - Exonic
1146288867 17:31594070-31594092 GGTGGGGAAGGTGCAGCAGCTGG + Intergenic
1146488207 17:33261007-33261029 GGAGCGCAAGGGTCTGCAGCTGG - Intronic
1147317022 17:39625941-39625963 GGAGCGGGAGCGGGAGGAGCTGG - Intergenic
1147419544 17:40315540-40315562 GGAGGGGAAGAGGAGTCAGCTGG + Intronic
1147517952 17:41140041-41140063 GCAGCTGGAGATGCAGCAGCTGG + Exonic
1147518887 17:41149378-41149400 GCAGCTGGAGATGCAGCAGCTGG + Exonic
1147997875 17:44371016-44371038 GGGGAGGAAGGGACAGCAGCAGG + Intergenic
1148021694 17:44557715-44557737 GCAGCAGCAGCGGCAGCAGCAGG - Exonic
1148443108 17:47721839-47721861 GGAGGGGATGAGGCAGCTGGTGG + Intergenic
1148806438 17:50266372-50266394 GGAGGACAGGAGGCAGCAGCTGG + Intergenic
1149581138 17:57751059-57751081 GGAGCTGAAGACACAGGAGCAGG + Intergenic
1149599708 17:57885523-57885545 GGAGCAGCAGCGGCAGCGGCGGG - Exonic
1150613822 17:66753748-66753770 GGAGGGGAAGAGGCCACAGGAGG + Intronic
1151498389 17:74473427-74473449 GGTGTGGAGGAGGCAGCGGCAGG - Intronic
1151748491 17:76024020-76024042 GACGCAGAAGAGGCTGCAGCAGG - Exonic
1151840644 17:76615125-76615147 GCAGGGGAGGAGGCAGCACCAGG - Intergenic
1151956457 17:77382617-77382639 GGAGAGGCAGAGGGAGCTGCAGG + Intronic
1152280058 17:79379922-79379944 GGTGCGGGAGAGGCCGCGGCAGG - Intronic
1152280089 17:79380064-79380086 GGAGAGGAAGGGGCTGCAGTGGG - Intronic
1152651378 17:81495057-81495079 GGAGCAGCAGCAGCAGCAGCAGG - Intergenic
1152879764 17:82808341-82808363 GGAGGGGATGAGGCAGGTGCAGG + Intronic
1152879784 17:82808402-82808424 GGAGAGGATGAGGCAGGTGCGGG + Intronic
1152879890 17:82808705-82808727 GGAGGGGATGAGGCAGGTGCAGG + Intronic
1152900926 17:82940659-82940681 GGAGAGGAACCGGGAGCAGCTGG + Intronic
1153314488 18:3708536-3708558 GGAGAGGAAGAGGCAGGAAACGG - Intronic
1154121212 18:11654105-11654127 GGAGCAGAAGAGGCAGGTGCAGG - Intergenic
1154344700 18:13532133-13532155 AGAGCTGCAGAGGCAGCTGCCGG + Intronic
1155343475 18:24836169-24836191 GGAGCAGATGAGGCATGAGCAGG + Intergenic
1155526084 18:26717424-26717446 GCAGCGGAAGCAGCAGGAGCTGG + Intergenic
1156160293 18:34350942-34350964 GGAGGGGCAGAGGCAGCAGGGGG - Intergenic
1156174379 18:34525423-34525445 GGAGCTGAAAGGGCAGCAGAGGG - Intronic
1156511370 18:37639759-37639781 GGTGAGGAAGGGGCAGCAGAAGG + Intergenic
1157542847 18:48524500-48524522 GGAAAGGAAGAGGTAGCTGCAGG - Intergenic
1157593817 18:48851761-48851783 GGTGGGGAAGAGGCAGAACCCGG - Intronic
1158403477 18:57141221-57141243 GGAGCAGGAGAGACAGCAGGAGG - Intergenic
1158446286 18:57524748-57524770 GGAGAGGAAGAGGAAGGAGGAGG + Intergenic
1159874951 18:73800622-73800644 GCAGCAGCAGAGGCAGCAGCTGG + Intergenic
1160019595 18:75170209-75170231 AGATCGGAAGATGCAGCTGCAGG + Intergenic
1160084161 18:75759052-75759074 GGAGTGGAAGAAGTATCAGCTGG - Intergenic
1160503123 18:79411948-79411970 GGGGAGGAAGCGGGAGCAGCAGG - Intronic
1160540426 18:79617536-79617558 GGAGAGGCAGATGCAGCAGCGGG - Intergenic
1160798475 19:956450-956472 GGAGGGGAGGGGGCGGCAGCCGG + Intronic
1160810004 19:1009185-1009207 GGAGCAGCAGCAGCAGCAGCAGG + Exonic
1160841952 19:1150267-1150289 GGAGCACACGGGGCAGCAGCGGG + Intronic
1160873195 19:1286186-1286208 GGAGCAGCAGCGGGAGCAGCGGG - Exonic
1160900180 19:1424083-1424105 GGAGAGGAAGAGGGAGGAGGTGG - Intronic
1161347853 19:3777052-3777074 GAAGTGGGAGAGGCAGGAGCAGG + Intergenic
1161435099 19:4258379-4258401 GGAGCGGCGGAGGCAGCAGCAGG + Exonic
1161633992 19:5375652-5375674 GGAGAGGAAGAGGAAGAAGAAGG + Intergenic
1161634003 19:5375703-5375725 GGAGAGGAAGAGGAAGGAGAAGG + Intergenic
1162076580 19:8191946-8191968 GAAGAGGAAGAGGAAGCAGAAGG + Intronic
1162100216 19:8334652-8334674 GCTGCGGAGGAGGCAGCGGCGGG - Exonic
1162435294 19:10654515-10654537 GGAGGGGCAGAGGCGGGAGCGGG - Intronic
1162861268 19:13507101-13507123 GGAGCAGAAGAGGCAGCCGTTGG - Intronic
1163013758 19:14441232-14441254 GGAGCGGGAGCGGCTGCGGCGGG + Exonic
1163415660 19:17184994-17185016 GGAGCAGGAGAGGCAGAAGGTGG + Intronic
1163428946 19:17255406-17255428 GCAGCGGAGGTGGCAGCAGCGGG - Exonic
1163847816 19:19647138-19647160 GGAGATGAAGAGGAAGCAGCCGG + Exonic
1164762622 19:30739322-30739344 GGTGAGGAGGGGGCAGCAGCAGG - Intergenic
1164897931 19:31893584-31893606 GGAGCAGAAGAGGAAGAAGAAGG + Intergenic
1164897959 19:31893776-31893798 GGAGCAGAAGAGGAAGAAGGAGG + Intergenic
1164990168 19:32676989-32677011 GGGGAGGGAGCGGCAGCAGCAGG - Exonic
1165108606 19:33488488-33488510 GGACTGGGACAGGCAGCAGCTGG + Intronic
1165145372 19:33726937-33726959 GGAGGGGAAGGTGCAGGAGCTGG - Intronic
1165285425 19:34838047-34838069 ATAGCGGCAGTGGCAGCAGCAGG + Intergenic
1165293304 19:34906185-34906207 GCAGCGGCAGTGGCAGCAGCGGG - Intergenic
1165388429 19:35525107-35525129 GGGGAGGAAAAGGCAGCAGGAGG - Intronic
1165549681 19:36573489-36573511 GGCGCGGAAGAGGCGGCTGGTGG + Intronic
1166245439 19:41522321-41522343 GGCGAGGAAGAGGCAGCGCCGGG - Intergenic
1166300473 19:41909631-41909653 GGAAGGGATGAGGCAGGAGCGGG + Intronic
1166373117 19:42313409-42313431 GGAGCAGCAGCGGCGGCAGCAGG - Exonic
1166385062 19:42376207-42376229 TGAGAGGAAGAGGAAGAAGCAGG - Exonic
1166416609 19:42599877-42599899 GGAGCAGAAGAGGGAGGTGCAGG + Intronic
1166433079 19:42742521-42742543 GGAGAAGAAGAGGGAGCAGCAGG + Intronic
1166436180 19:42767747-42767769 GAAGCAGAAGAGGGAGCAGCAGG + Intronic
1166455923 19:42939236-42939258 GGAGCAGAAGAGGGAGCAGCAGG + Intronic
1166465716 19:43028511-43028533 GGAGAAGAAGACGGAGCAGCAGG + Intronic
1166471856 19:43084715-43084737 GGAGCAGAAGAGGGAGCAGCAGG + Intronic
1166482990 19:43188531-43188553 GGAGCAGAAGAGGGAGCAGCAGG + Intronic
1166485471 19:43207663-43207685 GGAGCAGAAGAGGGAGCAGCAGG + Intergenic
1166492623 19:43271569-43271591 AGAGCAGAAGAGGGAGCAGCAGG + Intergenic
1166523567 19:43497198-43497220 GGAGCGGGAGAGCCGGCAGGAGG - Exonic
1166743451 19:45128462-45128484 GTAGAGGCAGCGGCAGCAGCAGG + Intronic
1166864971 19:45830314-45830336 GGAACTGGAGAGGCAGCAGGGGG - Intronic
1166984271 19:46650080-46650102 GGAGAGGCAGAGGCAGAGGCAGG - Intronic
1167703821 19:51066448-51066470 GGAGAGGAAAAAGCAGGAGCCGG + Intergenic
1168152554 19:54456705-54456727 AGAGCTGAAGAAGCAGAAGCGGG + Exonic
1168332754 19:55579475-55579497 GAAACGGAAGAGGCGGCCGCAGG + Exonic
925966280 2:9069742-9069764 GGGGTGGAAGAGGCAGCATATGG - Intergenic
926243530 2:11105469-11105491 GGTGTGGGAGAGGCAGCCGCCGG + Intergenic
929445394 2:41997154-41997176 GGAAGGGAAAAAGCAGCAGCGGG + Intergenic
929805913 2:45145007-45145029 GCAGGGGCAGAGGAAGCAGCTGG + Intergenic
929889640 2:45908295-45908317 AGTGCTGAAGAGGCAGCTGCAGG + Intronic
930124013 2:47782800-47782822 GGAGCGGAAGCGGGAACAGCGGG - Intronic
931671715 2:64653825-64653847 GCAGCGGAGGAGGAAGCAGGAGG + Exonic
932099957 2:68889690-68889712 GGAGAGGAAGTGGCTGCCGCAGG - Intergenic
932212535 2:69944540-69944562 GGACTGGAAGCGTCAGCAGCCGG + Intergenic
932420519 2:71598756-71598778 TGAGGGGACGAGGCAGGAGCTGG - Intronic
933700139 2:85249238-85249260 GTAGCGGCAGTGGCAGCAGCTGG - Intronic
933729623 2:85446915-85446937 GGAGCTGAAGTGGCAGCACCAGG + Intergenic
936152203 2:110028003-110028025 GGAGGGGTACAGGGAGCAGCTGG - Intergenic
936192475 2:110343410-110343432 GGAGGGGTACAGGGAGCAGCTGG + Intergenic
936266962 2:111018221-111018243 GGGACGGAGGAGGGAGCAGCGGG + Intronic
937004500 2:118499102-118499124 AGACCTGAGGAGGCAGCAGCTGG - Intergenic
937160817 2:119759719-119759741 GGAGCGGCGGCGGCAGCAACAGG - Exonic
937321694 2:120964719-120964741 GGAGAGGACGAGGAGGCAGCTGG + Intronic
937324532 2:120982639-120982661 GGTGGGGAGGAAGCAGCAGCCGG + Intronic
937470314 2:122168807-122168829 GGAGCCTAACAGGAAGCAGCTGG - Intergenic
937764016 2:125638900-125638922 GGAGCAGCATAGGCAGGAGCAGG - Intergenic
938647424 2:133345968-133345990 GGACAGCAAGAAGCAGCAGCAGG + Intronic
939191055 2:138917247-138917269 GGAGCGGGGGATGCAGCACCCGG + Intergenic
940638850 2:156328060-156328082 GGAGGGACCGAGGCAGCAGCTGG - Intronic
940885315 2:158984792-158984814 GGAGCGTAAGAAGCAGAGGCTGG + Intronic
941043399 2:160648176-160648198 GAGGCGCAAGAGGCGGCAGCAGG + Intergenic
941829947 2:169944984-169945006 TGAGGAGCAGAGGCAGCAGCAGG - Intronic
942226100 2:173817432-173817454 GGAGGTAAAAAGGCAGCAGCTGG + Intergenic
942548184 2:177086542-177086564 GGTGCGGAACAGGCAGAAGAGGG - Intergenic
942681327 2:178480524-178480546 GGCGAGGAAGAGGCAGCGCCGGG + Exonic
943051268 2:182916081-182916103 GGAGGGGGAGAGGGAGGAGCAGG - Intronic
943890274 2:193277309-193277331 GAAGCGGGAGCGGCAGCACCAGG - Intergenic
946159338 2:217826592-217826614 GGAGCAGCGGAGGCAGCAGCAGG - Intronic
946164730 2:217857138-217857160 GGAGCAGCAGAGGCAGCCGTGGG - Intronic
946204512 2:218093811-218093833 GGAGAGGAAGAGTAAGGAGCAGG + Intergenic
946410844 2:219514511-219514533 GCAGCGGCAGAGGCAGCACCAGG + Exonic
947077088 2:226356322-226356344 GGAGAATAAGAGGCAGCTGCAGG - Intergenic
947461170 2:230306111-230306133 GGAGCAGCAGTGGCAGCAGTGGG + Intronic
947826976 2:233113168-233113190 GGAGCAGCAGAGCCAGAAGCAGG - Intronic
948163636 2:235844656-235844678 GGAGTGGATGAGACAGAAGCTGG - Intronic
948355543 2:237374436-237374458 GGAGCTGAGCAGGCTGCAGCCGG - Exonic
948404714 2:237708606-237708628 GGAGCTGGAGCGGCAGCAGAAGG + Exonic
948456404 2:238106510-238106532 GGAGCTGGAGAGGCAGCCCCGGG - Intronic
948612131 2:239176458-239176480 GGAGCTGGAGAAGCAGCACCGGG - Exonic
948624682 2:239261734-239261756 GGGGAGGAAGGGGCAGCAGTGGG + Intronic
948756538 2:240162831-240162853 GGAGGGGAGGAGGCAGCTGGAGG - Intergenic
948866501 2:240777704-240777726 GGAGCTTTAGTGGCAGCAGCGGG - Intronic
949006137 2:241649521-241649543 AGAGCTGGAGAGGCAGCAGATGG + Intronic
1168771888 20:420867-420889 CCAGCGGAAGCAGCAGCAGCAGG + Exonic
1169506134 20:6213343-6213365 GGAGAGGGAGAGGGAGGAGCTGG + Intergenic
1169900929 20:10550923-10550945 AGAGAGGGAGGGGCAGCAGCTGG - Intronic
1170408250 20:16062271-16062293 GCAGCAGAAGTGGCAGCACCTGG - Intergenic
1170465253 20:16617064-16617086 GGATCTGAAGTTGCAGCAGCTGG + Intergenic
1171207288 20:23290890-23290912 GGAGAGGAAGTGGCAGGAGCGGG - Intergenic
1171232584 20:23499597-23499619 GGAGGGGAAGGGGCAGAACCAGG + Intergenic
1171472386 20:25382557-25382579 GGAGGAGAAGTTGCAGCAGCGGG + Intronic
1171945003 20:31368659-31368681 GCATAGGAAGAGCCAGCAGCAGG - Exonic
1171945179 20:31370154-31370176 GCATAGGAAGAGCCAGCAGCAGG - Intronic
1172064277 20:32207983-32208005 GGAGCGGCAGAAGCAGCAGCAGG - Exonic
1172379427 20:34475684-34475706 GGAGAGGCAGAGGCAGGGGCAGG + Intronic
1172517769 20:35547378-35547400 GGAGAAGCAGAGGCATCAGCTGG - Intronic
1172876587 20:38168120-38168142 GGAGAGGAAGTGGGGGCAGCTGG - Intergenic
1172908042 20:38383992-38384014 AGATCTGAAGATGCAGCAGCTGG - Intergenic
1173168848 20:40706091-40706113 GGAGGGGAAGATGCAGCTCCTGG + Intergenic
1173224205 20:41152434-41152456 GGAACAGAAAAAGCAGCAGCAGG - Intronic
1173250080 20:41359754-41359776 AGAGAGGCAGCGGCAGCAGCCGG - Exonic
1173251073 20:41364578-41364600 GGAGAGGAAGCCGGAGCAGCAGG - Intronic
1174477107 20:50803265-50803287 GGAGCAGTAGCGGCTGCAGCGGG + Intronic
1175182285 20:57157132-57157154 ATGGCGGCAGAGGCAGCAGCAGG + Intergenic
1175755358 20:61526157-61526179 GGAGGGGGAGGGGCACCAGCAGG - Intronic
1175772547 20:61632809-61632831 GGAGAGGAAGAGGAAGCGGGTGG - Intronic
1175831615 20:61967722-61967744 GGAGGGGAAAAGGCAGCAAGGGG - Intronic
1176008949 20:62881473-62881495 GGAGCAGAAGAGACAGCTGGAGG - Exonic
1176029884 20:63006806-63006828 GCAGCGGCAGCGGCAGCGGCGGG - Exonic
1176145867 20:63565215-63565237 GAAGAGGAAGAGGCACGAGCTGG - Exonic
1176184545 20:63771207-63771229 GGAGCGGAGGAGAGAGGAGCCGG + Intronic
1176199496 20:63854115-63854137 GGGGCGGAGGAGGAAGGAGCAGG - Intergenic
1176372953 21:6073573-6073595 AGAGAGGAAGTGGCAGAAGCTGG + Intergenic
1176379191 21:6103342-6103364 GCAGGGGCAGAGGCAGCAGCAGG + Intergenic
1176379197 21:6103360-6103382 GCAGGGGCAGGGGCAGCAGCAGG + Intergenic
1176379205 21:6103384-6103406 GCAGGGGCAGAGGCAGCGGCAGG + Intergenic
1176379217 21:6103414-6103436 GCAGGGGCAGGGGCAGCAGCAGG + Intergenic
1176382751 21:6121285-6121307 GGAGTGGGGGCGGCAGCAGCGGG - Exonic
1178331384 21:31696584-31696606 GGAGGAGGAGAGGCAGCAGCGGG + Exonic
1178498885 21:33109795-33109817 GGAGCGGGAGGTGCAGAAGCCGG - Intergenic
1178764784 21:35440074-35440096 GGAGCGGGAGAGGGAGAAGGAGG - Intronic
1179251291 21:39673657-39673679 GGAGCTGAGGTGGCAGCAGAGGG - Intergenic
1179513738 21:41892280-41892302 GGAGCTGGAGAGGCGGGAGCAGG + Intronic
1179667772 21:42924348-42924370 TGAGAGGAAGAGGCAGGGGCTGG + Intergenic
1179740718 21:43416954-43416976 GGAGTGGGGGCGGCAGCAGCGGG + Exonic
1179744256 21:43434823-43434845 GCAGGGGCAGGGGCAGCAGCAGG - Intergenic
1179744268 21:43434853-43434875 GCAGGGGCAGAGGCAGCGGCAGG - Intergenic
1179744276 21:43434877-43434899 GCAGGGGCAGGGGCAGCAGCAGG - Intergenic
1179744282 21:43434895-43434917 GCAGGGGCAGAGGCAGCAGCAGG - Intergenic
1179750524 21:43464670-43464692 AGAGAGGAAGTGGCAGAAGCTGG - Intergenic
1179889573 21:44328748-44328770 GGAGGGGAACAGGCAGGAGGCGG + Intergenic
1179954771 21:44732468-44732490 GGAGCTCAGGAAGCAGCAGCAGG + Intergenic
1180214489 21:46315732-46315754 GGAGGGCAAGGGGCAGCATCAGG + Intronic
1181175492 22:21032530-21032552 GCAGCGGCTGCGGCAGCAGCAGG - Exonic
1181224651 22:21384053-21384075 CGAGCGGGAGCGGCGGCAGCTGG + Exonic
1181253981 22:21550760-21550782 CGAGCGGGAGCGGCGGCAGCTGG - Exonic
1181271398 22:21660928-21660950 GTAGCGGCAGAGGTGGCAGCAGG - Intronic
1181407831 22:22697449-22697471 GGATGGGATGAGGCTGCAGCTGG + Intergenic
1181420111 22:22792031-22792053 GGATGGGATGAGGCTGCAGCTGG + Intronic
1181639995 22:24191305-24191327 GGAGCCGATGAGGTACCAGCAGG + Intergenic
1181782409 22:25202609-25202631 GGAGGGGCAGAGGCTGGAGCTGG + Intronic
1182358960 22:29735497-29735519 GTAGTGGCAGTGGCAGCAGCAGG - Intronic
1182442415 22:30372124-30372146 GGAGAGGCAGGTGCAGCAGCTGG + Exonic
1182556899 22:31134178-31134200 GGAGCAGTAATGGCAGCAGCCGG + Exonic
1183313593 22:37124932-37124954 GGAGACAAAGAGGAAGCAGCTGG - Intergenic
1183392277 22:37552395-37552417 GGGGCGGGAGGGGCAGCAGAAGG - Intergenic
1183528025 22:38335885-38335907 GAAGTTGAAGAGGAAGCAGCAGG - Intronic
1184241363 22:43212731-43212753 GGTGGGGAAAACGCAGCAGCCGG + Intronic
1184250313 22:43256484-43256506 GGAGTAGAAGTAGCAGCAGCAGG + Intronic
1184422823 22:44391724-44391746 GGAGAGGAAGGGGCTGCAGGTGG - Intergenic
1184457333 22:44618590-44618612 GGAGGGGCAGAGGCAGGGGCAGG + Intergenic
1184986530 22:48139919-48139941 AGAGCGGGAGAGGCAGCTGATGG + Intergenic
1185039893 22:48498334-48498356 GGGGCTGAAGAGGCAGGGGCTGG + Intronic
1185140348 22:49097358-49097380 GGAGAGGCAGACGGAGCAGCCGG - Intergenic
949617313 3:5768138-5768160 GGAACAGAAGAGGCAGAAGTTGG + Intergenic
949935015 3:9109853-9109875 GGAGCAGGAGAGGGAGGAGCAGG + Intronic
950575934 3:13832079-13832101 GGAGCAGGAGAAGCAGGAGCAGG - Intronic
951587560 3:24231045-24231067 GGAGCAGAAGAGGATACAGCTGG - Intronic
952396454 3:32924975-32924997 GGAGCGGGAGGGAGAGCAGCAGG - Intergenic
952492543 3:33885961-33885983 GGAGCCGTAGGGGCAGCAGTTGG + Intergenic
952748456 3:36804051-36804073 GAAGAGGAGGAGGCAGAAGCTGG - Intergenic
953771257 3:45780015-45780037 GGAGTGGAAGAGGTACCAGAAGG + Exonic
954368111 3:50156711-50156733 GGAGCTGAAGGGGGAGCAGCAGG - Intronic
957376768 3:79368685-79368707 GGAGAGGAAGGAGCAGCAGCAGG - Intronic
958798730 3:98732875-98732897 GCCGCGAGAGAGGCAGCAGCCGG + Exonic
960043067 3:113169996-113170018 GGAGAACAAGAGGCAGCTGCAGG + Intergenic
960466010 3:117997282-117997304 CGAGCGGAAGAGGCGAGAGCAGG - Intergenic
960516455 3:118607800-118607822 GGAGGGGTAGAGGAAGCAGTGGG + Intergenic
960998083 3:123352431-123352453 GCAGCGGGAGAACCAGCAGCAGG - Exonic
961007036 3:123412116-123412138 GGATGGGAAGAGACAGCAGGAGG + Intronic
962201329 3:133403343-133403365 GGGGGGGAAGAGGCAGCTGCAGG - Intronic
962837189 3:139199812-139199834 GCAGTAGCAGAGGCAGCAGCAGG + Intronic
962853568 3:139325624-139325646 GGCACTGAGGAGGCAGCAGCTGG + Intronic
963796475 3:149635599-149635621 GAAGCGGAAGAGGGAGGAGGAGG + Intronic
965165654 3:165192798-165192820 GGAGGAGAAGGGGCTGCAGCAGG + Intronic
965560976 3:170062265-170062287 CGTGCGGCGGAGGCAGCAGCGGG + Intronic
965672057 3:171157516-171157538 GGAGCACAAGCGGCAGCTGCTGG - Exonic
966372078 3:179261123-179261145 GGAGCTGGAGCGGCAGCAGAAGG - Intronic
966863575 3:184243940-184243962 GGAGCGGGACAGGTAGCCGCTGG + Exonic
966939656 3:184737591-184737613 GCAGAGGAAGAGGCAGAAGAAGG + Intergenic
966981345 3:185139106-185139128 GGAGAGGGAGAGGGAGCAGGAGG + Intronic
967042032 3:185702728-185702750 GATGGGGAGGAGGCAGCAGCAGG - Intronic
967178844 3:186885568-186885590 GGAGAGGCAGAGGCAGGGGCAGG + Intergenic
968582700 4:1402394-1402416 AGAGGCGAAGAGGAAGCAGCTGG + Intergenic
968631281 4:1653458-1653480 GGAGCAGAGGAGGGAGCTGCCGG - Intronic
968633296 4:1663968-1663990 GGAGCGCACGAGGCGGCAGCCGG + Intronic
968712122 4:2126828-2126850 GCAGCTGAAGAGGGAGCACCAGG + Intronic
968737307 4:2304113-2304135 GGAGGGGCAGGGGCAGGAGCTGG - Intronic
969222200 4:5768323-5768345 GTAGGGGCAGAGGCAGAAGCAGG + Intronic
969322968 4:6424174-6424196 GGAGAGGAAGTCACAGCAGCAGG + Intronic
969498661 4:7540205-7540227 GGAGAGGCAGAGGCAGGGGCAGG - Intronic
969532689 4:7738624-7738646 AGAACGGCAGTGGCAGCAGCTGG - Intronic
969616876 4:8258397-8258419 GGAGCAGCAGAGGCAGGAGGTGG - Intergenic
970446536 4:16127473-16127495 GGGGAGGAAGAGGCAGAAGAGGG - Intergenic
971420255 4:26467910-26467932 GGAGGGGAAGAGGAAGGAGAAGG + Intergenic
971757455 4:30721395-30721417 GGAGCAGTAGCAGCAGCAGCAGG + Exonic
972285450 4:37643849-37643871 GAAGCTGAAGAGGCCACAGCTGG + Intronic
972697864 4:41465457-41465479 GGAGGAGAAGAGGTAGCAGGAGG - Intronic
972725826 4:41745970-41745992 GCAGCGGCAGCGGCGGCAGCTGG - Exonic
973279232 4:48341778-48341800 GGTGCGGAAGCTGCAGGAGCTGG + Exonic
973336268 4:48959496-48959518 GGAGTAGAAGGGGCAGAAGCAGG + Intergenic
973981881 4:56314528-56314550 GGAGCGGAGGCGGCAGGAGGAGG + Exonic
974674846 4:65076488-65076510 GGAGGGGATGGGGGAGCAGCAGG - Intergenic
976272843 4:83248131-83248153 GGTGCGGCAGAAGCAGCAGATGG + Intergenic
979789259 4:124757636-124757658 AGAGCAGAAGCAGCAGCAGCAGG - Intergenic
982276332 4:153640089-153640111 GGGGCAGGAGAGGCAGCTGCGGG + Intergenic
982504143 4:156196875-156196897 GGAGCAGAAGAGCCACCAACAGG + Intergenic
982933196 4:161435437-161435459 GGAGGGGAAGAGGGAGAAGTGGG + Intronic
983238644 4:165207483-165207505 GCAGCGGCAGCAGCAGCAGCAGG + Intronic
983583300 4:169330224-169330246 AGAGCGGAAGTGGGAGCAGTGGG - Intergenic
984490142 4:180423953-180423975 GGAGGGGGAGAGGGAGCAGTTGG + Intergenic
984854947 4:184187068-184187090 GGAGGGGAGGAAGCAGAAGCAGG + Intronic
985471693 5:50782-50804 GAAGCGGGTGGGGCAGCAGCCGG - Intergenic
985850854 5:2388212-2388234 GGGAAGGCAGAGGCAGCAGCTGG + Intergenic
985895927 5:2750158-2750180 GGAGGGGAAGAGGGAGTAGGGGG - Intronic
986392605 5:7300217-7300239 GGTGCGGAAGCGGGAGGAGCAGG - Intergenic
986651185 5:9964666-9964688 GGAGGGGAACAGGCACCTGCAGG + Intergenic
986972424 5:13352710-13352732 TGGGAGGAAGAAGCAGCAGCAGG - Intergenic
987030502 5:13972515-13972537 GCAGAGGTAGAGGAAGCAGCGGG - Intergenic
987179262 5:15349445-15349467 GGAGCAGAAGGGGCAGGAGAAGG + Intergenic
987216828 5:15746276-15746298 GGAGCGGTAGAGTCGGCAGTTGG + Intronic
987744068 5:21947886-21947908 GGAGCTGGAGTAGCAGCAGCTGG - Intronic
988540071 5:32100564-32100586 GGAGCAGGAGTGGCAGGAGCGGG + Intronic
988612668 5:32741980-32742002 GGAGCCAAAGAGCCAGCACCTGG + Intronic
988628313 5:32900902-32900924 GAAGCTGGAGTGGCAGCAGCTGG + Intergenic
990988532 5:61662477-61662499 GGAGGGGAAGGGACAGCAGAGGG + Intronic
991361096 5:65821077-65821099 GGAAAGGCAGAGGCAGCGGCAGG + Intronic
991588672 5:68225809-68225831 GGAGCCAAAGAGGGAGCAGTGGG - Intronic
991764272 5:69958023-69958045 GGAGCTGGAGTAGCAGCAGCTGG - Intergenic
991783055 5:70160124-70160146 GGAGCTGGAGTAGCAGCAGCTGG + Intergenic
991843504 5:70833095-70833117 GGAGCTGGAGTAGCAGCAGCTGG - Intergenic
991875497 5:71160451-71160473 GGAGCTGGAGTAGCAGCAGCTGG + Intergenic
992096316 5:73366243-73366265 GGAGCGGGACAGGCAGAAGAAGG + Intergenic
992811153 5:80389812-80389834 GGAGGGGCAGAGGAAGCAGAAGG + Intergenic
994083264 5:95731322-95731344 GCAGCGGCAGCGGCAGCAGGAGG + Exonic
994597570 5:101859735-101859757 GGAAGGGAAGACGCAGAAGCCGG + Intergenic
995596491 5:113753483-113753505 GTAGAGGGAGAGGCACCAGCGGG - Intergenic
996850025 5:127941327-127941349 GGAAAGGAAGATTCAGCAGCTGG + Intergenic
997592557 5:135084870-135084892 AGAGCGGTAAAGGCAGGAGCAGG - Intronic
997636132 5:135408522-135408544 GGAGAGGGAGAGGCAGAGGCAGG - Intergenic
997647173 5:135489300-135489322 GGAGGGTAGGACGCAGCAGCAGG + Intergenic
997725178 5:136114171-136114193 GTAGGGGAAGACGCAGGAGCAGG + Intergenic
997786111 5:136715501-136715523 GGAGGGGAAGGGGCAGGAGCAGG - Intergenic
997858166 5:137391785-137391807 GGAGCTCAAGAGGAAGCAGTTGG - Intronic
998262178 5:140639749-140639771 GGCGCGGAGGGAGCAGCAGCTGG + Exonic
998280332 5:140801236-140801258 GGAGCAGAAGAGAAAGCAGCAGG - Exonic
998467452 5:142357163-142357185 GGGGCGGAGGAGGCGGAAGCGGG - Intergenic
998643890 5:144041656-144041678 GGAGCGAAAGAGGCAGGAACTGG + Intergenic
999248530 5:150167915-150167937 GGAGGGGAAGCGGGAGCAGTGGG + Intronic
999255861 5:150209759-150209781 GGAGAGGCAGAGGCTGCAGAAGG - Exonic
999281573 5:150369723-150369745 GGAGCTGGAAAGGCTGCAGCCGG + Intronic
1000285066 5:159819802-159819824 AGAGCCAAAGAGGCAGCAGGAGG + Intergenic
1000463400 5:161548142-161548164 GGAAGGGAAGAGGCAGCCTCTGG - Intronic
1000497722 5:162006473-162006495 TGAACAGAAGAGGCAGCTGCAGG + Intergenic
1001476508 5:172054661-172054683 GGAGGAGAAGAGGCAGAAGTCGG - Exonic
1001766105 5:174248331-174248353 GGAGCCTGAGAGGCAGCAGAGGG + Intergenic
1001794437 5:174490346-174490368 GCACCTGCAGAGGCAGCAGCAGG + Intergenic
1001917457 5:175573850-175573872 GGGGCAGGAGAGGGAGCAGCGGG - Intergenic
1002174037 5:177391380-177391402 GGGCTGGCAGAGGCAGCAGCAGG - Intronic
1002193543 5:177490820-177490842 GGAATGGAAGAGGCAGGAGGTGG + Intronic
1002290022 5:178194163-178194185 AGGGCAGAGGAGGCAGCAGCGGG - Intergenic
1003105290 6:3210642-3210664 GGAAGGGAAGAGGAAGCAGGAGG + Intergenic
1004774471 6:18827433-18827455 GGTGAGGAAGAGGGAGTAGCAGG + Intergenic
1005290768 6:24376464-24376486 CGAGCAGTAGAGGCAGAAGCAGG + Intergenic
1005522589 6:26613729-26613751 GGAGCGGGAGATGAGGCAGCCGG - Intergenic
1005832402 6:29681167-29681189 GGAGCGGAAGAGGGCGGGGCCGG - Intergenic
1006321094 6:33320010-33320032 GAAGAGGAAGAAGCAGCAGCAGG - Exonic
1006458619 6:34145412-34145434 GGAGCGGGAGAGGCGGCAAGAGG + Intronic
1006573518 6:35025531-35025553 GGAAGTGAAGTGGCAGCAGCAGG - Intronic
1006614678 6:35318327-35318349 GGAGCGGAAGCTGCAGGAGCTGG + Exonic
1006970574 6:38040948-38040970 GGAGGGGCACAGGCGGCAGCAGG - Intronic
1007018999 6:38500238-38500260 GGGGAGGAAAAGGCAGCAGAGGG + Intronic
1007121434 6:39385371-39385393 GGGGAGGATGAGGCAACAGCTGG + Intronic
1008359233 6:50595022-50595044 GGATTGGAAGAGGGAGAAGCAGG + Intergenic
1008649058 6:53544927-53544949 GGAGCGGGAGGAGGAGCAGCGGG - Exonic
1008652003 6:53573461-53573483 AGAGCGGGAGAGCTAGCAGCAGG - Intronic
1008664008 6:53697904-53697926 GGAGAGGAAGAGGCAGAGACAGG + Intergenic
1008874974 6:56315687-56315709 GGAGGGGTAGAGGGAGGAGCGGG - Intronic
1010414893 6:75601872-75601894 GGAGCGGCAGCGGCGGCGGCTGG + Intronic
1011032902 6:82942568-82942590 GGAGCTGAATAGGCAGTGGCTGG - Intronic
1011044599 6:83067758-83067780 GAAGCGGCCGAGCCAGCAGCAGG + Exonic
1011719366 6:90139491-90139513 AGAGGTGATGAGGCAGCAGCTGG - Intronic
1012980987 6:105830842-105830864 GGAGGGGAAGGGGCCGCAGGAGG + Intergenic
1012981004 6:105830887-105830909 GGAGGGGAAGGGGCAGCTGGAGG + Intergenic
1012981012 6:105830908-105830930 GGAGGGGAAGGGGCAGCTGGAGG + Intergenic
1012981020 6:105830929-105830951 GGAGGGGAAGGGGCAGCTGGAGG + Intergenic
1012981036 6:105830970-105830992 GGAGGGGAAGGGGCAGCGGGAGG + Intergenic
1012981050 6:105831012-105831034 GGAGGGGAAGGGGCAGCCGGAGG + Intergenic
1012981119 6:105831187-105831209 GGAGGGGAAGGGGCAGCTGGAGG + Intergenic
1012981141 6:105831251-105831273 GGAGGGGAAGGGGCAGCTGGAGG + Intergenic
1013204382 6:107933693-107933715 GGAGAGGGAGAGGCAGGGGCAGG - Intronic
1015724978 6:136290429-136290451 GGAGCTCAAGCCGCAGCAGCCGG + Intergenic
1017975527 6:159353547-159353569 GAGGCAGAAGAGGCAGCTGCTGG - Intergenic
1018021335 6:159764109-159764131 GAAGAAGAAGAAGCAGCAGCAGG + Intronic
1018154750 6:160975191-160975213 GGAGAGGGAGAGGCAGCAAGAGG - Intergenic
1018273321 6:162103833-162103855 GGTGAGGAAGAGGAGGCAGCTGG - Intronic
1018870442 6:167778518-167778540 GAAGCAGAAGAGGCTGGAGCAGG - Intergenic
1018896939 6:168026035-168026057 GGACCTGAAGAGGAAGCTGCGGG + Intronic
1019170139 6:170129219-170129241 AGAGCCGAAGCAGCAGCAGCCGG + Intergenic
1019493735 7:1326659-1326681 GGGACGGCAGAGGCAGCAGCAGG - Intergenic
1020034937 7:4959081-4959103 GGCGCGGCGGCGGCAGCAGCAGG + Exonic
1020085269 7:5307030-5307052 GAAGAGGGAGAGGCAGGAGCCGG - Exonic
1020275458 7:6622107-6622129 GGAGCAGCAGCAGCAGCAGCTGG + Exonic
1023849114 7:44140520-44140542 GGAGGGGCAGAGGCAGCTGTGGG + Intronic
1024042792 7:45568114-45568136 GAAGGGCTAGAGGCAGCAGCAGG - Intergenic
1024999950 7:55307433-55307455 GGAGTGGAGAAGGCAGAAGCTGG + Intergenic
1025175738 7:56801371-56801393 GGACAGTGAGAGGCAGCAGCTGG + Intergenic
1025696056 7:63775051-63775073 GGACAGTGAGAGGCAGCAGCTGG - Intergenic
1025887745 7:65614386-65614408 GAAGCAGAAGAGGCAGAAGAGGG - Intergenic
1026148636 7:67769866-67769888 GGAGAGGAAGAGGGAGGAGGAGG - Intergenic
1027677960 7:81182309-81182331 GGAGGGGTAAAGTCAGCAGCAGG + Intronic
1028126483 7:87118941-87118963 GGAGTGGAAAAGGAAGGAGCGGG - Intergenic
1028962546 7:96765492-96765514 GGAGCAGCAGCAGCAGCAGCTGG - Intergenic
1029403276 7:100358314-100358336 GGAGCAGCAGGGGCAGCAGCAGG - Exonic
1029443852 7:100602369-100602391 GCAGCGGTGGCGGCAGCAGCAGG - Exonic
1029458636 7:100683330-100683352 GGAGCAGAAGCGGCGGCAGGAGG - Exonic
1029569525 7:101360447-101360469 GGAGAGGCAGAGGCAGAGGCAGG + Intergenic
1029652499 7:101903151-101903173 GGAGGGGCAGGGTCAGCAGCCGG + Intronic
1031334805 7:120515191-120515213 GAAGAGGAAGTGGCAGAAGCAGG - Intronic
1031918257 7:127583009-127583031 GAAGCTGAAGAGGCTGCTGCAGG - Exonic
1032085992 7:128884208-128884230 GTCCCGGAAGAGGCTGCAGCAGG - Intronic
1032239522 7:130149927-130149949 GGTGCAGAAGAGGCAGCCGCAGG + Intergenic
1032465052 7:132138967-132138989 GAGGGGGAAGAGGCAGCAGCTGG - Intronic
1032842817 7:135727412-135727434 GGACGGGCAGAGGCAGCAGCAGG + Exonic
1033429242 7:141273987-141274009 AGAGGGGCAGAGGCAGCAGTTGG - Intronic
1033566317 7:142581466-142581488 GGAGGAGAAGAGGAAGCACCAGG - Intergenic
1033686283 7:143644088-143644110 GGAGTGGAAGAGGCAGATGCAGG - Intronic
1033689455 7:143723227-143723249 GGAGTGGAAGAGGCAGATGCAGG + Exonic
1033698330 7:143813533-143813555 GGAGTGGAAGAGGCAGATGCAGG + Intergenic
1033731749 7:144187390-144187412 AGAGAGGAAGAGGGAGCTGCAGG - Exonic
1033742598 7:144285973-144285995 AGAGAGGAAGAGGGAGCTGCAGG - Intergenic
1033751305 7:144363641-144363663 AGAGAGGAAGAGGGAGCTGCAGG + Exonic
1034354424 7:150441879-150441901 GAAGGGGAAGAGGAAGCAGAAGG - Intergenic
1034386138 7:150742718-150742740 GGAGGAGCAGAGGCAGCAGCAGG + Exonic
1034386796 7:150747208-150747230 GGAGGAGCAGAGGCAGCAGCAGG - Intronic
1034393644 7:150803842-150803864 CAAGGGGAAGGGGCAGCAGCAGG + Intronic
1034415918 7:150964150-150964172 GGGGAGGAAGAGGCTGCAGATGG + Intronic
1034440037 7:151081677-151081699 GGAGCAGCAGGGGCAGCAGCAGG + Exonic
1034577643 7:152014859-152014881 GGATCTGGAAAGGCAGCAGCAGG - Intronic
1034850000 7:154484601-154484623 GGCGGGGAGGAGGCAGGAGCCGG - Intronic
1035331661 7:158099823-158099845 GGGGAGGAAGAGGAGGCAGCCGG - Intronic
1035468637 7:159096055-159096077 GGAGCCCAAGAGCCAGCTGCTGG + Intronic
1035678768 8:1472284-1472306 GGAGCAGGAGAGGACGCAGCTGG + Intergenic
1036411210 8:8503439-8503461 GGAGCCAAAGATGCAGCAGAGGG + Intergenic
1036773706 8:11595627-11595649 GGACCCCAAGAGGCAGGAGCTGG + Intergenic
1037710521 8:21351756-21351778 GGAACGGGAGAGTCAGCAGGTGG - Intergenic
1037877484 8:22555051-22555073 CAAGCGGGAGGGGCAGCAGCTGG + Intronic
1039212727 8:35235418-35235440 GGAGGGGAAGGGGCGGCTGCGGG + Intergenic
1039503348 8:38033681-38033703 GGAGGGAAAGAAGCAGCAGTTGG + Intronic
1039799101 8:40938859-40938881 GCAGAGGAAGAGGCAGAGGCAGG + Intergenic
1041600525 8:59712094-59712116 GGACCTGAAAATGCAGCAGCTGG + Intergenic
1041787619 8:61652493-61652515 GGATTGGAAGATGCAGAAGCTGG + Intronic
1042380277 8:68105251-68105273 AGAGAGGAGGAGGCAGCAGGAGG - Intronic
1042444026 8:68862552-68862574 GAAGCGGCAGCAGCAGCAGCAGG - Intergenic
1042463202 8:69094764-69094786 GGAGCGAAAGGAGCAGCAACAGG - Intergenic
1042489114 8:69379007-69379029 GGAGCAGAAGCGGGAGGAGCAGG - Intergenic
1043127731 8:76421123-76421145 TGATCGGAAGGGGCAGCAGCTGG - Intergenic
1043487195 8:80709824-80709846 GGATCTGAAGCAGCAGCAGCAGG + Intronic
1044457114 8:92401487-92401509 GGAGAGGAGCAGGCAGGAGCCGG - Intergenic
1045251109 8:100484206-100484228 GGAGAGAAAGAGGCAGTAGAAGG + Intergenic
1046174403 8:110556319-110556341 GCAGCGGCAGCGGCAGCGGCAGG + Intergenic
1047403357 8:124564239-124564261 GCAGTTGTAGAGGCAGCAGCAGG + Intronic
1048153428 8:131916648-131916670 GGAACCGAAGAGGGAGCAGGTGG + Intronic
1048928539 8:139292214-139292236 GGATGGGGAGATGCAGCAGCTGG - Intergenic
1049023775 8:139974849-139974871 GGAGAGGGAGAGGCAGCCGGAGG - Intronic
1049319578 8:141988837-141988859 GGAGCGGAAGGAGCAGCCTCTGG - Intergenic
1049363541 8:142225538-142225560 AGAGGGGAGGAGCCAGCAGCGGG - Intronic
1049595550 8:143481698-143481720 GGAGCTGGATTGGCAGCAGCCGG - Intronic
1049681787 8:143922071-143922093 GGAGCAGCAGCGGCGGCAGCAGG - Exonic
1049681924 8:143922857-143922879 GGAGCAGATGGCGCAGCAGCTGG - Exonic
1049682270 8:143924732-143924754 GGAGCAGCAGCGGCAGCTGCTGG - Exonic
1049710121 8:144059673-144059695 GGAGCGGAAGGGGGAGCGGGTGG - Exonic
1049724526 8:144139456-144139478 GGAGCAGCAGCTGCAGCAGCTGG + Exonic
1049747391 8:144268815-144268837 GCAGGGACAGAGGCAGCAGCAGG + Intronic
1051585057 9:18718627-18718649 GGAGCGGCGGCGGCAGCGGCAGG - Intronic
1053171735 9:35891977-35891999 GCAGTGGCAGAGACAGCAGCAGG - Intergenic
1053508789 9:38669331-38669353 GGAGGGCATGAGGCTGCAGCCGG - Intergenic
1055397451 9:75890766-75890788 GGAGCGGTACAGGCAGCGACCGG - Exonic
1056179093 9:84064253-84064275 GGATGGGAAGAGGCAGGGGCAGG + Intergenic
1057173463 9:92977344-92977366 GGAGATGGAGAGGCAGCAGATGG + Intronic
1057584164 9:96314593-96314615 GGTGCGGGAGAGGGAGCATCAGG + Intergenic
1057698938 9:97349014-97349036 GGCCTGGAAGAGGCAGCAGGCGG + Intronic
1059171784 9:112131520-112131542 TGAGCAGAAGTGGCAGTAGCTGG - Intronic
1059218035 9:112584925-112584947 GGAGAGGAAGGGGAAGCAGTCGG - Intronic
1059490584 9:114663038-114663060 GGAGAGGAGGTGGCAGCAGTCGG - Intergenic
1059592753 9:115679859-115679881 GGAGAGGAAGAGGAAGGAGAAGG - Intergenic
1059764649 9:117372223-117372245 AGAGAGGAAGAGGCAGGTGCAGG - Intronic
1060223459 9:121776332-121776354 GGAGCGGCTGCGGCGGCAGCAGG + Exonic
1060514311 9:124256548-124256570 AGGGCAGACGAGGCAGCAGCTGG - Intergenic
1060698662 9:125731609-125731631 GGAGAGAAAGAGGGAGGAGCTGG - Intergenic
1060824021 9:126677275-126677297 GGAGAGGAGGGGGCAGGAGCAGG - Intronic
1061028696 9:128067008-128067030 GGAGCTGAAGAAGCACCTGCTGG - Exonic
1061181539 9:129027790-129027812 GGAGGGGAGGAGGCACCGGCTGG - Intronic
1061486978 9:130924974-130924996 GGATCGGAAGAGGCAGCGGTGGG - Intronic
1061835241 9:133324273-133324295 GTGGCGGGGGAGGCAGCAGCAGG + Intergenic
1061899666 9:133666458-133666480 GGGGAGGAAGAGGCCTCAGCAGG - Intronic
1062192723 9:135256093-135256115 GGATGGGAAGAGGGGGCAGCGGG - Intergenic
1062230937 9:135480814-135480836 GGAGCGGGCGGGGCAGCAGGAGG - Intronic
1062248657 9:135583428-135583450 AGAGCGGAGGAAGCAGCATCTGG + Intergenic
1062290452 9:135792034-135792056 GGAGCGGATGAGATAGCTGCGGG - Exonic
1062634019 9:137480573-137480595 GGAGGGGAAGGGGCAGCGGCTGG - Intronic
1062641576 9:137521284-137521306 GGAGCTGCAGAGGCACCAGGCGG + Intronic
1062681626 9:137785109-137785131 GGTCTGGAAGAGGCAGGAGCTGG + Intronic
1062720304 9:138038458-138038480 GGAGCTGAAGAGGAAGCCCCTGG - Intronic
1203779984 EBV:95941-95963 GGAGCGGGAGGGGCAGGAGCAGG + Intergenic
1203779989 EBV:95956-95978 GGAGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780117 EBV:96301-96323 GGAGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780136 EBV:96352-96374 GGAGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780141 EBV:96367-96389 GGAGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780146 EBV:96382-96404 GGAGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780231 EBV:96613-96635 GGAGCAGGAGGGGCAGGAGCAGG + Intergenic
1203792119 EBV:157388-157410 GGAGCAGAAGAGGCAGAACATGG - Intergenic
1185612900 X:1402798-1402820 GGAGGGGAAGAGGCTGCATTTGG - Intergenic
1186463472 X:9766057-9766079 GGAGAGGAAGAGGGAGGAGGAGG + Intronic
1186991439 X:15073515-15073537 AGAGCCAAAGAGGCTGCAGCTGG - Intergenic
1187181443 X:16946892-16946914 GCAGCGGCAGCGGCAGCGGCGGG + Exonic
1187505605 X:19875875-19875897 GGACCCCAAGAAGCAGCAGCTGG - Intronic
1187507206 X:19887478-19887500 GCAGCAGCAGAGGCAGCAGCGGG - Exonic
1187686773 X:21823246-21823268 GCAGTGGAAGAGACTGCAGCAGG - Intergenic
1189358452 X:40329244-40329266 AGAGCACAAGAGGGAGCAGCTGG + Intergenic
1189399654 X:40655412-40655434 GGACTGGAAGAGGCAGCCACTGG - Intronic
1190301975 X:49062342-49062364 GCAGGGGAGGAGGCAGCAGGAGG - Intronic
1190329536 X:49227054-49227076 GCAGCGGGAGAAGCAGCAGATGG - Exonic
1190712678 X:53081591-53081613 GGGGAGGAAGGGGCAGAAGCGGG + Intergenic
1191640276 X:63424182-63424204 GCACCTGCAGAGGCAGCAGCTGG + Intergenic
1191851299 X:65588198-65588220 GGAAAGGAGGAGGCAGCAGTTGG - Intergenic
1192583890 X:72305661-72305683 GGCGCGAGAGTGGCAGCAGCCGG - Intronic
1192630751 X:72776607-72776629 GAAGCTGCAGAGGCAGCCGCTGG + Intergenic
1192650959 X:72944197-72944219 GAAGCTGCAGAGGCAGCCGCTGG - Intergenic
1193602037 X:83519131-83519153 GGAGGGAAAGACTCAGCAGCAGG + Intergenic
1193814064 X:86084620-86084642 GGAGCGGAAGGGAGAGCAGGGGG - Intergenic
1194237106 X:91398700-91398722 AGAGGGGTAGAGGAAGCAGCAGG + Intergenic
1197055582 X:122114306-122114328 ACAGGGGAAGAGGAAGCAGCAGG - Intergenic
1197756832 X:130001608-130001630 GGAGAGGAAGAGGGGGAAGCAGG + Intronic
1199843264 X:151672215-151672237 GGAGCAGCAGCGGCAGCTGCGGG + Exonic
1200102071 X:153693183-153693205 GGAGGTGGAGAGGCTGCAGCAGG + Intronic
1200267837 X:154655377-154655399 AGAGCAGCAGAGGCAGAAGCAGG - Intergenic
1200380242 X:155829637-155829659 GCAGCAGCAGTGGCAGCAGCAGG - Intergenic
1200714383 Y:6520707-6520729 GGAGCGGCAGAAGGACCAGCGGG + Intergenic
1201019440 Y:9640449-9640471 GGAGCGGCAGAAGGACCAGCGGG - Intergenic
1201159945 Y:11158818-11158840 GGGGCACAAGAGCCAGCAGCTGG - Intergenic
1201514136 Y:14799028-14799050 GGAGGGGAAGGGGCTGAAGCAGG + Intronic