ID: 903876483

View in Genome Browser
Species Human (GRCh38)
Location 1:26477787-26477809
Sequence CCCAGCAGCCTGTGTTTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 5, 3: 18, 4: 288}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903876479_903876483 15 Left 903876479 1:26477749-26477771 CCTGCATTTAAGAAGAATGAAAT 0: 1
1: 0
2: 5
3: 91
4: 654
Right 903876483 1:26477787-26477809 CCCAGCAGCCTGTGTTTCACTGG 0: 1
1: 0
2: 5
3: 18
4: 288
903876478_903876483 16 Left 903876478 1:26477748-26477770 CCCTGCATTTAAGAAGAATGAAA 0: 1
1: 0
2: 5
3: 58
4: 590
Right 903876483 1:26477787-26477809 CCCAGCAGCCTGTGTTTCACTGG 0: 1
1: 0
2: 5
3: 18
4: 288
903876477_903876483 24 Left 903876477 1:26477740-26477762 CCTTTTTTCCCTGCATTTAAGAA 0: 1
1: 0
2: 5
3: 41
4: 447
Right 903876483 1:26477787-26477809 CCCAGCAGCCTGTGTTTCACTGG 0: 1
1: 0
2: 5
3: 18
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903876483 Original CRISPR CCCAGCAGCCTGTGTTTCAC TGG Intergenic
900188849 1:1344978-1345000 CCCAGCACCCTCTGACTCACCGG + Intronic
900188859 1:1345016-1345038 CCCAGCACCCTCTGACTCACTGG + Intronic
900755944 1:4434808-4434830 CACTGCAACCTCTGTTTCACAGG + Intergenic
901095968 1:6679970-6679992 CACTGCAGCCTGATTTTCACTGG + Intronic
903364242 1:22796165-22796187 CCCAACTGCCTGTCTTTCCCAGG - Intronic
903364569 1:22798045-22798067 CCCAACTGCCTGTCTTTCCCAGG + Intronic
903876483 1:26477787-26477809 CCCAGCAGCCTGTGTTTCACTGG + Intergenic
904004810 1:27358161-27358183 CCCAGGAGCCTTGGTCTCACCGG + Exonic
904463328 1:30693253-30693275 GTGAGCAGCCTGTGCTTCACAGG + Intergenic
905230892 1:36514424-36514446 CCCTGCAGGCTGTGTGTCCCAGG - Intergenic
905734213 1:40315010-40315032 CCCAGCATCCTGTGTTTGGGGGG + Intronic
906167723 1:43699557-43699579 CCAAAGAGCCTGTGTTTCTCTGG + Intronic
907607412 1:55832017-55832039 GCAAGCAGCCTGTTTTTCATAGG - Intergenic
908221707 1:62013847-62013869 CACTGCAGCCTCTGTTTCCCAGG + Intronic
908741995 1:67338612-67338634 CCCAGTAGGCTCTGTTTCAAAGG - Exonic
910406663 1:86898655-86898677 CACAGCAACCTCTGCTTCACGGG + Intronic
910506457 1:87954832-87954854 CCCAGCAGCATCTGAATCACTGG + Intergenic
910874685 1:91867443-91867465 CCCAGCAGCCTTGGTTTCCTTGG + Intronic
912122111 1:106484088-106484110 ACCATCTGCCTGTCTTTCACAGG - Intergenic
912818166 1:112846861-112846883 CACTGCAGCCTCTGTCTCACGGG + Intergenic
915512330 1:156393008-156393030 TCCAGCAGCCTGGGATTCAGTGG + Intergenic
915784367 1:158593074-158593096 CCCAGCACCATTTGTTTAACAGG - Intergenic
915918882 1:159959443-159959465 CCAAGCAGGCTGTGTCTCATGGG + Intergenic
916005383 1:160654748-160654770 CCCAGCTGTCTCTGTTTCTCAGG - Intergenic
916633098 1:166638117-166638139 CCCAGCAGCCTTGGATTCCCAGG + Intergenic
917862170 1:179156800-179156822 CACTGCAGCCTCTGTTTCCCTGG - Intronic
918843792 1:189582666-189582688 CACTGCAGCCTCTGTCTCACAGG + Intergenic
920453956 1:206083540-206083562 CCCAGAAGCTTCTGTGTCACTGG - Intronic
921052501 1:211521032-211521054 CCCAGCTCACTGTGTTTCATTGG + Intergenic
921338463 1:214111085-214111107 TCCAGCAGCATGTGTTCCAGGGG - Intergenic
921353118 1:214257859-214257881 CACAGCAGCCCGTGCTTCAAAGG + Intergenic
922142855 1:222907483-222907505 CTCAGCAACCTGTGTTTTAGTGG + Intronic
922223674 1:223627420-223627442 CCCAGCTGCCTGGGTTTCTGGGG + Intronic
922772552 1:228194685-228194707 CCCAGCAGCCTGTGGGTCCCTGG - Intergenic
923852695 1:237814765-237814787 CCCTGCAGCCTCTGGTTCAGGGG - Intronic
1063459977 10:6209034-6209056 CCAAGTAGCCTCTGTCTCACGGG + Intronic
1067845138 10:49713555-49713577 CCCAGGAGCTTGGCTTTCACAGG + Intergenic
1070056065 10:72935721-72935743 TCAAGCAGCCTGTGATTCCCTGG - Exonic
1070694538 10:78552200-78552222 CACAGCAGCCTGAGCTTCACCGG + Intergenic
1072518972 10:96213562-96213584 CCAATCAGCCTGTATGTCACGGG - Intronic
1073206847 10:101774211-101774233 CCCAGCCGCCTGGGTTCCCCAGG + Intronic
1073350907 10:102819112-102819134 CCCACCAGCCTGGGGTTCAATGG - Intergenic
1074110757 10:110421227-110421249 TCCAGGGGCCTGTGTTTAACAGG + Intergenic
1074753516 10:116608718-116608740 CCCAGCAGCCTGGCTTACAGAGG - Intronic
1075246319 10:120825183-120825205 CCCCGCAACCTGAGTTTCACTGG - Intergenic
1075413459 10:122246114-122246136 CCCAGCAGCATCTGCGTCACTGG + Intronic
1075832433 10:125422831-125422853 CCCAGAATCCTGTGTTTGTCCGG - Intergenic
1076004299 10:126935716-126935738 CCCAGCATCCTGTGAATCAGAGG + Intronic
1076515205 10:131041739-131041761 CCCAGCAGGATGAGTTCCACCGG - Intergenic
1076785936 10:132749974-132749996 CCCAGCAGTCTGACTTGCACTGG - Intronic
1076939840 10:133596088-133596110 CCCAGCCGACATTGTTTCACTGG - Intergenic
1077168873 11:1157662-1157684 CCCAGCAGCCTGTGAGTTCCTGG - Intergenic
1078370836 11:10743709-10743731 CCGTGCAGCCTGTGTTCCACTGG - Intergenic
1079316315 11:19410733-19410755 CCCTGCAGCCAGTGTTTCCAGGG + Intronic
1079367556 11:19822589-19822611 CCTAGAAGCCTTTGTTTCAAAGG - Intronic
1079814121 11:25033822-25033844 CCCAGGTGCCTGTTTTTCAATGG - Intronic
1080214408 11:29824923-29824945 GCCAGGAGCCTATGTTACACAGG + Intergenic
1082735807 11:56854500-56854522 ACCAACAGCCTGTATTTCTCAGG + Intergenic
1082834273 11:57640194-57640216 CCCTCCAGCCTCTGTTTCTCTGG + Intergenic
1083385530 11:62306567-62306589 CCCAGCAAGCTAAGTTTCACTGG - Intergenic
1083955391 11:65980035-65980057 CACTGCAGCCTGTGTCTCCCAGG - Intergenic
1084485413 11:69445083-69445105 CCCAGCAGCCTCTGTTTGGTGGG + Intergenic
1086118748 11:83283884-83283906 CCCTGCAGCCTGTGCCTCCCAGG - Intronic
1087317250 11:96616786-96616808 CCCTTCAGCCTCTGTTTCAGTGG + Intergenic
1088937152 11:114414076-114414098 TCCAGCTGCCTTTGTTTCGCTGG + Intronic
1089136523 11:116253620-116253642 CCCTGCAGGCTGTGTCTCGCTGG + Intergenic
1089303947 11:117515277-117515299 CCCTGTAGCCTGGTTTTCACAGG + Intronic
1091213603 11:133885510-133885532 CCCAGCCCCTTGTGTTTCCCAGG + Intergenic
1091799377 12:3315291-3315313 CCCAGCCGGCTGTGTTTGAGAGG + Intergenic
1093468524 12:19476295-19476317 CCCAGCAGCATTTGTTGCAAAGG + Intronic
1094112635 12:26878052-26878074 CACTGCAGCCTTTGTTTCCCAGG + Intergenic
1095756736 12:45776217-45776239 CCAAGCAGTCTGTTTTTAACAGG + Intronic
1100221129 12:92505565-92505587 CCCAGCTGCCAGTGTCACACTGG - Intergenic
1100383975 12:94088588-94088610 CTCACCAACCTGTGTCTCACAGG + Intergenic
1101019700 12:100541355-100541377 CACTGCAGCCTCTGTTTCCCAGG + Intronic
1102281632 12:111623196-111623218 CCCTGCAGCCTCTGTTTCCCAGG + Intergenic
1103985850 12:124767095-124767117 CCCAGCAGCCCGGGTCTCTCTGG - Intergenic
1106113950 13:26801236-26801258 AACAGCAGCCTGTGTTTGTCAGG + Intergenic
1110012009 13:70348307-70348329 CAAAGCAGCATGTGGTTCACAGG + Intergenic
1111021082 13:82453358-82453380 CCCAGCACCATTTGTTTAACAGG - Intergenic
1111494795 13:89034121-89034143 CACAGCAGCCTTTTTATCACAGG + Intergenic
1112352956 13:98651858-98651880 CACAGCCTCCTTTGTTTCACAGG - Intergenic
1113582179 13:111437558-111437580 CCCAGCAGCCTGGGGGTCAGGGG - Intergenic
1113905719 13:113818298-113818320 CCCAGGGGGCTGTGTTCCACGGG + Intergenic
1113916557 13:113877426-113877448 CCCAGGAGCCTGTGGTGAACGGG + Intergenic
1116139491 14:40972505-40972527 CCCAGCAGTCTGAGTTTCACAGG + Intergenic
1116419809 14:44719867-44719889 AGCAGCAGCCTGAGCTTCACAGG - Intergenic
1117599991 14:57365136-57365158 CCCAGCAACCTGAGATCCACTGG + Intergenic
1119359641 14:74037583-74037605 CCCAGCCACCTGTCTTTCAAAGG + Intronic
1120734432 14:88037358-88037380 GACAGCAGCTTGTTTTTCACAGG - Intergenic
1121604781 14:95232619-95232641 TCCAGTAAACTGTGTTTCACGGG + Intronic
1122379603 14:101293010-101293032 CTCTGCAGCCTGCGTTCCACGGG - Intergenic
1122803955 14:104247449-104247471 TCCTGCAGCCTGTGGTGCACAGG + Intergenic
1122805101 14:104252525-104252547 CGCAGCAGCCTCTGTCTCAGGGG + Intergenic
1122889416 14:104725495-104725517 CCCAGCACCCTGTGTGGCTCAGG + Intronic
1124607352 15:31179600-31179622 CCATGCAGCCTGTGGGTCACGGG + Intergenic
1124641479 15:31398981-31399003 CCAAGCATCCTGTGTGTCCCTGG + Intronic
1127362005 15:58252553-58252575 CACTGCAGCCTGTGTCTCAAAGG - Intronic
1127932121 15:63603834-63603856 AAAAGCAGCCTGTGTCTCACAGG - Intergenic
1127942535 15:63714061-63714083 CCCAGCAATCTGTGTTTTAAAGG + Intronic
1128019933 15:64381413-64381435 CCCAGCCGAGGGTGTTTCACTGG + Exonic
1129744829 15:78010993-78011015 ACCAGGACCCTGAGTTTCACGGG + Intronic
1131607680 15:93926055-93926077 CCCAGCAGCCTGGCTGTCATGGG - Intergenic
1132566941 16:627872-627894 CCCAGCTGCCTGGGCTTGACCGG + Exonic
1132940782 16:2507080-2507102 CCCAGCAGCCTCGGTCTCACTGG - Intronic
1135143339 16:19940234-19940256 CCCCGCAGCCTGTGTTCCCCAGG - Intergenic
1135835065 16:25817915-25817937 CCCACCAGACTGTATGTCACTGG + Intronic
1136010590 16:27360990-27361012 CCAAGCCCCCTGAGTTTCACTGG + Intronic
1136191172 16:28615627-28615649 CCCAACTGCCTGTGTTGCCCAGG - Intronic
1136504899 16:30696849-30696871 CCCTGCAGCCTCTGTCTCCCGGG - Intergenic
1138527952 16:57619833-57619855 TCCAGCAGCCTCTGCTTCCCAGG + Intronic
1139901128 16:70329578-70329600 CTCAGCAGCATTTGTTTGACGGG + Intronic
1139905978 16:70366371-70366393 CTCAGCAGCATTTGTTTGACGGG + Intronic
1140644234 16:77012093-77012115 CACTGCAGCCTCTGTTTCCCAGG - Intergenic
1141621060 16:85236634-85236656 CCCAACAGCCTGTATTTCTTTGG + Intergenic
1141837274 16:86550064-86550086 CACAGCAGCCAGTGTCTGACTGG - Intronic
1142692704 17:1616565-1616587 CCCAGCAGCCTGAGCTTCCTCGG + Exonic
1142932401 17:3298227-3298249 CCAAGAAGCCTGTCTTACACAGG + Intergenic
1143708931 17:8720097-8720119 CCCACCAGGATCTGTTTCACAGG + Intergenic
1144682529 17:17205334-17205356 CCCAGTGGCCTGAGATTCACTGG + Intronic
1145370133 17:22300833-22300855 CGCAGCAGCCATTGTTTCAAGGG + Intergenic
1148013283 17:44503107-44503129 CCCCGCGGCCTGAGTTTCAGGGG + Intronic
1148220625 17:45859245-45859267 TCCAGCAGCCTCTGCATCACTGG + Intergenic
1148904700 17:50904858-50904880 CCCAGCAGCCTGTGGCTGGCAGG + Intergenic
1149480824 17:57001810-57001832 CCCAGCAGCCTAGGTTTCACTGG + Intronic
1149491350 17:57086653-57086675 TCCAGCAGCCTAGATTTCACTGG - Intronic
1150353338 17:64462714-64462736 CACAGCAGCCTCTGTCTCCCTGG + Intronic
1151541109 17:74764885-74764907 CCCAGCAGCCTGTCCTTGCCCGG + Intronic
1151820684 17:76495139-76495161 CCCGGCAGCCGGGTTTTCACGGG + Intronic
1152463914 17:80455203-80455225 CCCAGCACCCAGCGTTTAACAGG + Intergenic
1153044167 18:840526-840548 CCCAGCAGCCTGAGATGAACTGG + Intergenic
1153962088 18:10148468-10148490 GCCAGAAGCCTGTGGTGCACAGG + Intergenic
1154476587 18:14765640-14765662 GCCAGCAAACTGTGTATCACAGG - Intronic
1154947689 18:21178358-21178380 CCCAACAGGCTGTGTTTCTGAGG - Intergenic
1155377380 18:25175184-25175206 CACAATAGCCTGTGTGTCACAGG + Intronic
1157564058 18:48667973-48667995 CCCTGCAGCCTGTGTTTCCATGG + Intronic
1158611278 18:58942811-58942833 CCCAGCAGTATTTGTTTAACAGG + Intronic
1160841870 19:1149957-1149979 CGCAGCAGCCTGAGCTTCCCGGG - Intronic
1160985095 19:1834936-1834958 CCCTGCAGCCTGTGACCCACTGG + Intronic
1161099888 19:2416365-2416387 CCCAGCAGCCCCTCTTTCCCTGG + Intronic
1162040153 19:7965997-7966019 CACAGCAGCATGTGTGGCACTGG + Intronic
1164230362 19:23281798-23281820 CCATGCAGACTGTGATTCACTGG - Intergenic
1166502071 19:43349109-43349131 CTCAGCAGGCTGTGTTGCAGGGG + Intergenic
1166508041 19:43384343-43384365 CTCAGCAGGCTGTGTTGCAGGGG - Intergenic
1167990685 19:53358257-53358279 CTCTGCAGCCTGTGTTTTCCAGG - Intergenic
1168250395 19:55138170-55138192 CCCAGCAGCCTCTGCGGCACTGG - Intronic
925141933 2:1556963-1556985 ACCAGCAGCATGTGAGTCACTGG - Intergenic
926057204 2:9781001-9781023 TCCAGCAGCCTCTGTTACAAGGG - Intergenic
927680005 2:25132855-25132877 CCCTGGAGCCTGTGCCTCACTGG + Intronic
927695533 2:25237088-25237110 CCCAGCAGCCACTAGTTCACAGG + Intronic
929805313 2:45140027-45140049 CACAGCAGCCAGTGTCTCAGGGG + Intergenic
930423452 2:51182401-51182423 CCCAGCAGCATTTGTTGAACAGG - Intergenic
935320841 2:101887543-101887565 CCCAGCATCCAATGTTTCATGGG + Intronic
936505005 2:113098993-113099015 CCCAGCAGCCTGTGTGACAGCGG - Intergenic
936715541 2:115182957-115182979 CCCAGCAGCCTGTTGTCCATGGG - Intronic
937770346 2:125713583-125713605 CCAAGCTGCCTGTGTGACACTGG + Intergenic
939113126 2:138031214-138031236 CCCTGCAGACTGTGTTTTCCAGG - Intergenic
940589598 2:155704558-155704580 CACAGCAGCCTTTGTCTCATAGG - Intergenic
940820249 2:158346181-158346203 CAGAGCAGCTTGTGTTTCTCAGG + Intronic
941854334 2:170214945-170214967 CCCTCCAGCTTGTGTTTGACTGG - Intronic
942961750 2:181837676-181837698 CCAAGCTACCTGTGTTTCCCTGG + Intergenic
943590978 2:189796280-189796302 CACTGCAGCCTCTGTTTCCCGGG - Intronic
945012045 2:205475295-205475317 CCCATCAGCATGTGTTGCAAAGG + Intronic
946211648 2:218152005-218152027 CCCAGCAGCCTTAGTTTCTTAGG + Intergenic
947504358 2:230695531-230695553 CCCTGCAGCCTCTGCCTCACAGG - Intergenic
948920307 2:241063269-241063291 CCCTGGAGCCTGCGTTTCTCAGG - Intronic
949022915 2:241751668-241751690 CCCTGCAGCCTGTGGTTAAGCGG + Intronic
1169149703 20:3279763-3279785 CCCAGCTGCCTGTGAGACACTGG - Intronic
1169843241 20:9962510-9962532 CCCACCAGCCTGTGTTGCCAAGG - Intergenic
1170531444 20:17296533-17296555 CCCAGAAGGCTGAGTTTGACAGG - Intronic
1171178599 20:23074602-23074624 CTCACCATCCTGTGGTTCACTGG - Intergenic
1171273139 20:23832025-23832047 GCCAGCAGCCTGAGTTCCAGAGG - Intergenic
1172750008 20:37244167-37244189 CCAAGCAGCCAGGGTGTCACTGG + Intergenic
1173281504 20:41632244-41632266 CCCAGGAATCTGTGTTTGACAGG - Intergenic
1174557199 20:51404237-51404259 CCCAGCTGTCTGTGTGTCCCTGG - Intronic
1174584354 20:51595939-51595961 CCGAACACCCTGTGATTCACAGG - Intergenic
1175086279 20:56461797-56461819 CTCAGCAGCCAGGGTTTTACTGG + Intergenic
1175182775 20:57160367-57160389 CCCAGCAGGCTGGATGTCACTGG + Intergenic
1177624881 21:23646651-23646673 CCCAGGAGCCTGTCTGTCTCCGG + Intergenic
1179433916 21:41346619-41346641 AGCAGCAGCCTGTGTGGCACAGG - Intronic
1179438555 21:41378168-41378190 CCCAGCAGCCTGTCTCCCAGAGG - Intronic
1179438575 21:41378268-41378290 CCCAGCAGCCTGTCTCCCAATGG - Intronic
1179533080 21:42033241-42033263 CACAGCAACCTGAGTTTCAGAGG - Intergenic
1179953652 21:44725720-44725742 CCCTGCAGCCTCTGCTTCCCGGG - Intergenic
1180004507 21:45014005-45014027 CACAGCAACCTCTGTCTCACGGG + Intergenic
1181084069 22:20431250-20431272 CCCACCAGCCTGCGTGGCACAGG + Exonic
1181609920 22:24005457-24005479 CCCAGGATCCTGTGTTCCCCAGG + Intergenic
1181689319 22:24549636-24549658 CCAAGCAGCCTGTAGTCCACAGG + Intronic
1182550437 22:31098069-31098091 CCCAACAGCCTCTGTTACATGGG - Intronic
1183442931 22:37833518-37833540 CCCAGCAGCCTGTGTCCCATGGG - Intronic
1183480726 22:38063716-38063738 CACTGCAGCCTCTGTTTCCCAGG + Intronic
1183671174 22:39273791-39273813 CACTGCAGCCTCTGTTTCCCTGG - Intergenic
1185182848 22:49373031-49373053 CCCAGCACCCGGTGCTTCCCTGG - Intergenic
1185414987 22:50704942-50704964 CCCAGCTGCCTGTCTATCCCAGG + Intergenic
950107657 3:10398515-10398537 CCCAGCAGCCCAGGCTTCACGGG + Intronic
950659296 3:14456882-14456904 GCCAGCAGCCTGTGGTGGACAGG + Intronic
952518545 3:34130760-34130782 TCCTCCAGCCTGTGTTCCACAGG + Intergenic
952723211 3:36555061-36555083 CCCAGCTGCCTGTGATTGAAAGG - Intergenic
954387285 3:50250735-50250757 CCCAGGAGCCTGTATTACCCAGG - Intronic
954699487 3:52443840-52443862 CCCAGCAGACTGGGCTTCCCAGG + Intronic
955446127 3:59011853-59011875 ACCAGCAGCATTTCTTTCACAGG + Intronic
956616235 3:71175504-71175526 CCCATCAGCTTGTTTTTCAAAGG + Intronic
956847023 3:73193126-73193148 CCTCGCAGGCTGTGTTTCTCAGG + Intergenic
960397728 3:117157522-117157544 CCCACCAGCCTGTATTTCTGAGG + Intergenic
961645925 3:128392782-128392804 CCGAGCAGCCTGTGTGTGCCAGG - Intronic
961779022 3:129310698-129310720 CCCAGCAGCCTGTGCTACTGTGG + Intergenic
962211776 3:133485809-133485831 CCCAGCTACTTGTGTGTCACAGG + Intergenic
962631566 3:137281423-137281445 CCCTGCAGACTCTCTTTCACTGG - Intergenic
963581386 3:147130097-147130119 CCCAACTGCCTGTGCTTCCCAGG + Intergenic
964410171 3:156389638-156389660 CCCAGCATTCTGTGTTTAACAGG + Intronic
965119764 3:164539379-164539401 CACAGCAGGTTGAGTTTCACAGG - Intergenic
967813188 3:193777601-193777623 TCCAGCACCCTGTGTTTTAACGG + Intergenic
968299197 3:197600339-197600361 CCCGGCAGCCTGTTTTGTACAGG + Intergenic
968947003 4:3670428-3670450 CACAGCAGCCTCTGTCTCACAGG - Intergenic
969486672 4:7476083-7476105 CCCACCAGCCTGTGGCTCTCAGG - Intronic
971373199 4:26034734-26034756 CCTTGCAGGCTGTGTTTCAGAGG - Intergenic
971913008 4:32821173-32821195 CCCTGCAGCCTTTGTTTCCCAGG + Intergenic
974298781 4:60038451-60038473 CCCAGCAGCAGGTGCTACACTGG + Intergenic
974546165 4:63309947-63309969 CACCGCAGCCTCTGTTTCATGGG + Intergenic
977854737 4:101875903-101875925 CACTCCAGCTTGTGTTTCACTGG - Intronic
980243094 4:130202273-130202295 GCCAGCAGCCTGGGTGCCACAGG + Intergenic
980646620 4:135651638-135651660 CACCCCAGCCAGTGTTTCACGGG - Intergenic
983177345 4:164606097-164606119 ACCAGCACCATGTGTTTCATAGG - Intergenic
983445090 4:167840438-167840460 CCCAGCAGCCTGGATCTCAGTGG - Intergenic
989084940 5:37666074-37666096 TCCAGCTGCCTGAGATTCACTGG - Intronic
990332103 5:54738420-54738442 CCCAGCAGCCTGGTTTTAAGAGG - Intergenic
992820842 5:80494544-80494566 CCCTCCAGCCTGTGTTACAGAGG - Intronic
993984596 5:94583022-94583044 CCCAGCAATCTGTTTTTAACAGG - Intronic
995177045 5:109190437-109190459 ACAAGCAGTCTGTGTCTCACTGG + Exonic
999140861 5:149360691-149360713 GCCATCACCCTGTGTCTCACTGG - Intronic
999335369 5:150711579-150711601 CACTGCAACCTCTGTTTCACGGG + Intronic
999660404 5:153856613-153856635 CCCACCATCCTGGGTTTCCCTGG - Intergenic
999827560 5:155288708-155288730 CCCATAAGCCTGTGTTTCTTAGG - Intergenic
999976449 5:156916486-156916508 ACCAGCAGCCTCCGTGTCACTGG - Intergenic
1000334168 5:160229549-160229571 CCCAGCAGCATGGCTTTCACCGG + Exonic
1001943287 5:175755881-175755903 CCCTGCAGCCTCTGCTTCCCAGG - Intergenic
1002810461 6:623147-623169 CCCAGCGGCCTGTGGTGCACGGG - Intronic
1002931027 6:1635278-1635300 CCCCTCAGCCTGCCTTTCACAGG - Intronic
1004192794 6:13478751-13478773 ACCAGCATCCTCTGCTTCACAGG - Intronic
1005564113 6:27072019-27072041 CCCAGCAATCTGTGTTGAACAGG + Intergenic
1006432160 6:34003612-34003634 CCCAACAGCCCGTGTTCCAAAGG + Intergenic
1006846959 6:37069058-37069080 CCCATCAGACTGTCTCTCACGGG + Intergenic
1007411343 6:41663753-41663775 CCTTGCAGCCTCTGTTTCTCGGG - Intergenic
1008160768 6:48072538-48072560 CCAAGCAGCCTTTGTTTTATTGG + Intergenic
1008480995 6:51984650-51984672 CCCTGAAGCCAGTGTTACACTGG + Intronic
1009581830 6:65546093-65546115 CACTGCAGCCTGTACTTCACAGG + Intronic
1010549830 6:77207958-77207980 ACCAGCAGCCAGTGCTTAACAGG - Intergenic
1011137410 6:84115487-84115509 CCCAGCAGGCTAAGTTCCACTGG - Intergenic
1011862811 6:91782014-91782036 CCCAGCATCCTGAGTATCCCCGG + Intergenic
1014616290 6:123604224-123604246 CACAGCAGCCTGTGCGTGACAGG - Intronic
1015253861 6:131156180-131156202 CCCAGCATCCTGTGTTGCTTGGG + Intronic
1017666705 6:156726191-156726213 CACTGCAGCCTGTGTGTCCCAGG + Intergenic
1021589792 7:22248530-22248552 CCCAGCAGCCTGTGGTCCTCAGG - Intronic
1022440361 7:30427975-30427997 CCCAGCAGCCTGGGAAGCACTGG - Intronic
1023095352 7:36654624-36654646 CCCTGCAGCATGTATATCACAGG + Intronic
1024308784 7:47950204-47950226 CCCAGCAGGCAGGGTTGCACAGG - Intronic
1024612658 7:51080834-51080856 GCCAACAGCCTGTGCCTCACTGG + Intronic
1024767755 7:52681039-52681061 CCCATCATCTTTTGTTTCACTGG - Intergenic
1024822546 7:53350209-53350231 CCCAGCAGGCTCTGTCTAACTGG + Intergenic
1025938058 7:66052777-66052799 CACTGCAGCCTCTGTTTCCCAGG - Intergenic
1026506297 7:70987231-70987253 CCCAGCAGACTGTGTGTGAAGGG + Intergenic
1026588816 7:71679482-71679504 ACCAGCTGCCTGTGTTACAGTGG - Intronic
1028885537 7:95928526-95928548 CCCTGCAGCCTGTGTGGCAGTGG - Intronic
1029494276 7:100888948-100888970 CCCAGCAGCCTGTAGTTCACTGG + Exonic
1029652280 7:101901723-101901745 CCCAGCAGCCCGTGTCTGCCCGG + Intronic
1033210789 7:139458816-139458838 CCCAGAAGCCTGTTTTGCTCAGG - Intronic
1033256992 7:139810110-139810132 CACTGCAACCTCTGTTTCACGGG + Intronic
1033308529 7:140242153-140242175 CCCAGCTTCCTGTTTTTCAGTGG + Intergenic
1034447289 7:151120170-151120192 CCCAGCTGCCTTTGCTGCACAGG + Intronic
1034536313 7:151727989-151728011 CCCAGCAGCCTGCTTTCCAGAGG + Intronic
1036381105 8:8237139-8237161 CCCAGAAGCCATTGTGTCACTGG + Intergenic
1036770419 8:11575044-11575066 CCCAGCAGCCTCTCTGGCACAGG - Intergenic
1037762965 8:21754235-21754257 CCTAGTACCCTGTGTTTGACAGG + Intronic
1039726548 8:40223668-40223690 CACTGCAGCCTCTGTTTCCCAGG + Intergenic
1041506398 8:58603241-58603263 CCCAGTACCCTGTGTTTCCATGG - Exonic
1042489110 8:69378984-69379006 CCCAGCAGCATGTATCCCACTGG + Intergenic
1042539057 8:69889533-69889555 CACTGCAGCCTCTGTTTCCCGGG + Intergenic
1043962227 8:86430123-86430145 CACAGCAGCCTCTGCTTCCCGGG - Intronic
1044785216 8:95786440-95786462 CCAAGCAGCCTCAGTTCCACTGG - Intergenic
1045320000 8:101075211-101075233 TCAAGCAGTCTGTGTTCCACTGG + Intergenic
1046809348 8:118515803-118515825 CACAGGAGGCTGTGTTTAACTGG + Intronic
1047964435 8:130035531-130035553 GGGAGCAGCCTGTGTTTCAAAGG + Intergenic
1049016083 8:139921125-139921147 TCCATCAGCCTGTGTTTCACAGG - Intronic
1049173995 8:141180229-141180251 CCCAGCATCCTGTGTGCCATGGG - Intronic
1049312141 8:141938876-141938898 CCCAGCAGCCTCTGACTCACAGG - Intergenic
1051825733 9:21216930-21216952 CCTAGAAGCCTGTGTGACACAGG - Exonic
1052791036 9:32875901-32875923 CTCAGCACCCTGGGTGTCACGGG + Intergenic
1053349658 9:37404778-37404800 CACAGCAGCGTGTGTCTGACAGG - Intergenic
1056025252 9:82487906-82487928 CCCAGCAGCCTGTCTGTCCTTGG + Intergenic
1056188658 9:84163243-84163265 CCCAGCAAGCTGTGTTTTAACGG + Intergenic
1056947243 9:91008815-91008837 CCCAGCAGCCTGTATCACATAGG + Intergenic
1057306308 9:93914128-93914150 CCCAGCAGCTTCTGGTTCACTGG - Intergenic
1057919100 9:99082073-99082095 CCCTGCAGGCTGTGCTTCCCCGG - Intergenic
1059133615 9:111781645-111781667 CACTGCAGCCTCTGTTTCCCAGG - Intronic
1059848289 9:118305898-118305920 CACACCAGCCTGTGTTTTCCTGG - Intergenic
1060911949 9:127358195-127358217 CCTGGCAGCCTGTCTGTCACTGG + Intronic
1061364295 9:130163388-130163410 CCCTGCAGCCTCTGCTTCCCAGG + Intergenic
1061417290 9:130454028-130454050 CCCAGCAGCCTGTGTGGCCAGGG + Intronic
1062108347 9:134767915-134767937 CCCAGCCCTCTGTGTTTCTCAGG - Intronic
1062200457 9:135300147-135300169 CCCAGCAGCCTGGGCATCAGAGG - Intergenic
1186351022 X:8739748-8739770 CTTAGCAATCTGTGTTTCACTGG + Intergenic
1188697449 X:33213127-33213149 CACAGCACTCTGTGTTTTACCGG + Intronic
1189317325 X:40065225-40065247 CCCAGCAGCCTGGGTCTGCCTGG - Intronic
1191110818 X:56802256-56802278 CCCAGCAGCCAGTGTGAAACTGG + Intergenic
1191760040 X:64636734-64636756 CACTCCAGCTTGTGTTTCACTGG + Intergenic
1192745323 X:73932452-73932474 CACCGCAGCCTCTGTTTCCCAGG - Intergenic
1193574619 X:83183080-83183102 CCCAGCGACCTGTGTTTCCAGGG + Intergenic
1195830008 X:109046512-109046534 TCCTGCAGTCTGTGTTTCCCAGG + Intergenic
1197336117 X:125211220-125211242 CACTGCAGCCTCTGTTTCCCAGG + Intergenic
1198314060 X:135449423-135449445 CCCAGTAGCCTGCTTTGCACAGG + Intergenic
1200936098 Y:8739816-8739838 CCCTTCATCCTGGGTTTCACAGG + Intergenic
1201720428 Y:17090335-17090357 CCCAGCAGACTGTGTTTGACTGG - Intergenic