ID: 903876483

View in Genome Browser
Species Human (GRCh38)
Location 1:26477787-26477809
Sequence CCCAGCAGCCTGTGTTTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903876477_903876483 24 Left 903876477 1:26477740-26477762 CCTTTTTTCCCTGCATTTAAGAA No data
Right 903876483 1:26477787-26477809 CCCAGCAGCCTGTGTTTCACTGG No data
903876479_903876483 15 Left 903876479 1:26477749-26477771 CCTGCATTTAAGAAGAATGAAAT No data
Right 903876483 1:26477787-26477809 CCCAGCAGCCTGTGTTTCACTGG No data
903876478_903876483 16 Left 903876478 1:26477748-26477770 CCCTGCATTTAAGAAGAATGAAA No data
Right 903876483 1:26477787-26477809 CCCAGCAGCCTGTGTTTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903876483 Original CRISPR CCCAGCAGCCTGTGTTTCAC TGG Intergenic